DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claim Status
Claims 6, 10-11, 14, 16-17, 20, 23, 25, 27, 29-30, 32 and 34-64 are cancelled by Applicant.
Claims 1-5, 7-9, 12-13, 15, 18-19, 21-22, 24, 26, 28, 31 and 33 are currently pending and are herein under examination.
Claims 1-5, 7-9, 12-13, 15, 18-19, 21-22, 24, 26, 28, 31 and 33 are rejected.
Claims 1 and 33 are objected.
Priority
The instant application is a national stage entry of PCT Application No. PCT/US2022/026578, filed on April 27, 2022, which claims domestic benefit to U.S. Provisional Application No. 63/180,527, filed on April 27, 2021. The claims to priority are acknowledged. As such, the effective filing date for claims 1-5, 7-9, 12-13, 15, 18-19, 21-22, 24, 26, 28, 31 and 33 is April 27, 2021.
Information Disclosure Statement
No IDS has been filed with this application.
Drawings
The drawings are objected to as failing to comply with 37 CFR 1.84(p)(5) because they do not include the following reference sign(s) mentioned in the description: 184, 186 and 188 in [50-52]
The drawings are objected to as failing to comply with 37 CFR 1.84(p)(5) because they include the following reference character(s) not mentioned in the description: 110 in FIG. 1A; 188A, 188B and 188C in FIG. 1B.
Corrected drawing sheets in compliance with 37 CFR 1.121(d), or amendment to the specification to add the reference character(s) in the description in compliance with 37 CFR 1.121(b) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance.
Claim Objections
Claims 1 and 33 are objected to because of the following informalities:
Claim 1, line 2, should be indented the same as line 4.
Claim 1, line 8, should recite “panel; and”.
Claim 1, line 10, should recite “cells; and”.
Claim 1, line 13, should recite “cell; and”.
Claim 33, line 11, should recite “panel; and”.
Claim 33, line 13, should recite “cells; and”.
Claim 33, line 14, appears that is should be intended to the same degree as the clauses beginning with “obtain” and “call”, as similarly recite in claim 1.
Claim 33, line 16, should recite “cell; and”.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
35 USC 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 4-5, 7, 9, 18, 26 and 28 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims dependent from a rejected claim are also rejected, unless otherwise noted.
Claims 4-5 recite “the amplicon of the second type”. It is unclear which one is referenced because claim 1, lines 11-12, recites “for each of one or more of the called cells … one or more amplicons of a second type”, indicating that each called cell has one or more amplicons of a second type. Clarify which amplicon from which cell is referenced.
Claim 9 recites “the number of human amplicons in the targeted sequencing panel”, which lacks antecedent basis. Claim 1 recites amplicons of a first and second type as well as a targeted sequencing panel, but there is no prior recitation of a number of human amplicons in the targeted panel. Provide antecedent basis or clarify to what the recitation refers.
Claim 18, line 2, recites “the one or more human cells” which lacks antecedent basis. Claim 1 recites “one or more cells” but does not specify that they are human. Provide antecedent basis or clarify to what the recitation refers.
Claim 26 recites functional language that does not convey a clear-cut indication of the scope of the subject matter covered by the claim. See MPEP 2173.05(g). Claim 26 attempts to further limit claim 1 limitation of “determining whether the called cell is genetically modified”, but the functional language merely recites a result of the “determining” step without defining the metes and bounds of how the result is achieved. For example, does the “determining” step inherently result in a CV less than 1%, or is there some yet unspecified further limitation that confers a CV less than 1%?
Claim 28 is indefinite because the effect of the wherein clause is indefinite. It’s unclear if claim 28 further limits a positively recited step in claim 1, introduces a new positive limitation, or recites an intended use. If claim 28 intends to further limit claim 1 step of “determining whether the called cell is genetically modified”, then it would likely have a similar issue as claim 26 related to functional language. Clarify the limiting effect of claim 28. For examination, claim 28 recites an intended use of the method and thus fails to further limit claim 1. This interpretation results in a rejection under 35 USC 112(d). See below.
Claim 28 recites the relative term “consistent” which renders the claim indefinite. The term “consistent” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The phrase “consistent mean percentage” is unclear because the metes and bounds of “consistent” have not been defined. For example, does consistent mean within 1% difference or 5% difference? Clarify the metes and bounds of consistent.
35 USC 112(d)
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 28 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
As discussed above under 35 USC 112(b), claim 28 fails to further limit claim 1 because it recites an intended use of the method of claim 1. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-5, 7-9, 12-13, 15, 18-19, 21-22, 24, 26, 28, 31 and 33 are rejected under 35 U.S.C. 101 because the claimed invention is directed to an abstract idea without significantly more.
Step 1:
Step 1 asks whether the claims recite statutory subject matter. In the instant case, claims 1-5, 7-9, 12-13, 15, 18-19, 21-22, 24, 26, 28 and 31 recite a method and claim 33 recites a product. As such, these claims recite statutory subject matter (Step 1: YES).
Step 2A, Prong 1:
Claims that recite statutory subject matter are analyzed under Step 2A, Prong 1 to determine if they recite any concepts that equate to an abstract idea, law of nature or natural phenomena. The instant claims recite the following limitations that equate to one or more categories of judicial exception:
Claim 1 recites “A method comprising: obtaining reads determined using a targeted sequencing panel, the reads sequenced from amplicons derived from a plurality of cells; calling one or more of the cells, wherein the calling comprises: identifying one or more cell barcodes in the obtained reads, wherein the one or more cell barcodes are identified at least for satisfying a total reads cutoff that is defined based on a number of amplicons of a first type in the targeted sequencing panel; attributing one of the identified one or more cell barcodes to one of the one or more cells; for each of one or more of the called cells, determining presence or absence of one or more amplicons of a second type comprising a barcode attributed to the called cell; determining whether the called cell is a genetically modified cell according to the presence or absence of one or more amplicons of the second type comprising the barcode attributed to the called cell.”
Claim 2 recites “wherein the plurality of cells are a plurality of human cells, and wherein the amplicons of the first type comprise human amplicons.”
Claim 3 recites “wherein the total reads cutoff is not defined based on a number of amplicons of the second type in the targeted sequencing panel.”
Claim 4 recites “wherein the amplicon of the second type is from a source that is foreign to the one or more cells.”
Claim 5 recites “wherein the amplicon of the second type is a non-human amplicon or a viral amplicon.”
Claim 7 recites “wherein the viral amplicon is derived from a lentivirus.”
Claim 8 recites “after obtaining reads determined using a targeted sequencing panel, distinguishing between reads suspected to be sequenced from amplicons of the second type and reads sequenced from amplicons of the first type.”
Claim 9 recites “wherein the total reads cutoff is defined as a product between the number of human amplicons in the targeted panel and a constant value X, wherein Xis any one of 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10.”
Claim 12 recites “wherein the one or more cell barcodes are each identified further based on a performance value of the targeted sequencing panel.”
Claim 13 recites “wherein the performance value of the targeted sequencing panel is a product between a constant value Y and a mean coverage of a subset of reads representing reads comprising cell barcodes that satisfy the total reads cutoff.”
Claim 15 recites “wherein Y is any one of 0.1, 0.2, 0.3, 0.4, 0.5, 0.6,0.7, 0.8, 0.9, or 1.”
Claim 18 recites “wherein attributing one of the identified one or more cell barcodes to one of the one or more human cells comprises attributing each identified one or more cell barcodes to a corresponding human cell.”
Claim 19 recites “wherein determining presence or absence of one or more amplicons of the second type comprises normalizing reads suspected to be sequenced from amplicons of the second type to reads sequenced from amplicons of the first type, thereby accounting for variations in sequencing depth and quantity of reads across different cells or across different samples.”
Claim 21 recites “wherein determining presence or absence of one or more amplicons of the second type further comprises comparing the normalized reads suspected to be sequenced from amplicons of the second type to a percentage read cutoff.”
Claim 22 recites “wherein the percentage read cutoff is between 0.05% and 0.5%.”
Claim 24 recites “wherein determining whether the called cell is a genetically modified cell according to the presence or absence of one or more amplicons of the second type comprises determining that the called cell is a genetically modified cell when at least one amplicon of the second type is determined to be present.”
Claim 26 recites “wherein genetically modified cells are successfully identified at a coefficient of variability (CV) percent of less than 1%.”
Claim 28 recites “wherein the method identifies a consistent mean percentage of genetically modified cells at 100% sampling and at 50% subsampling.”
Claim 31 recites “wherein the targeted sequencing panel comprises at least 10 amplicons of the first type and at least 10 amplicons of the second type.”
Claim 33 recites “obtain reads determined using a targeted sequencing panel, the reads sequenced from amplicons derived from a plurality of cells; call one or more of the cells … identify one or more cell barcodes in the obtained reads, wherein the one or more cell barcodes are identified at least for satisfying a total reads cutoff that is defined based on a number of amplicons of a first type in the targeted sequencing panel; attribute one of the identified one or more cell barcodes to one of the one or more cells; for each of one or more of the called cells, determine presence or absence of one or more amplicons of a second type comprising a barcode attributed to the called cell; determine whether the called cell is a genetically modified cell according to the presence or absence of one or more amplicons of the second type comprising the barcode attributed to the called cell.”
Limitations reciting a mental process.
Claims 1-5, 7-9, 12-13, 15, 18-19, 21-22, 24, 31 and 33 contain limitations recited at such a high level of generality that they equate to a mental process because they are similar to the concepts of collecting information, analyzing it, and displaying certain results of the collection and analysis in Electric Power Group, LLC, v. Alstom (830 F.3d 1350, 119 USPQ2d 1739 (Fed. Cir. 2016)), which the courts have identified as concepts that can be practically performed in the human mind. The paragraphs below discuss the broadest reasonable interpretation (BRI) of the limitations in these claims that recite a mental process.
Claims 1 and 33 recite obtaining sequencing reads that were previously generated which includes collecting data. Claims 1 and 33 recite calling a cell by identifying a barcode in the obtained reads includes evaluating whether a number of reads of a barcode exceeds a total reads cutoff. Claims 1, 33 and 18 recite attributing an identified cell barcodes to a cell includes making an a mental association or writing down information on pen and paper. Claims 1 and 33 recite determining the presence of absence of an amplicon of a second type includes evaluating sequence reads to determine if a particular sequence is present. Claims 1 and 33 recite determining whether a cell is genetically modified includes determining absence of the second type of amplicon.
Claim 8 includes aligning suspected sequences to a reference genome. Claim 9 and 21-22 include comparing numbers to thresholds. Claims 12-13 and 15 include comparing performance values of amplicons to a performance value of the targeted sequencing panel. Claim 19 includes performing the calculations recited in specification para. [68] on pen and paper. Claim 24 requires a mental determination based on evaluating information. Claims 2-5, 7 and 31 are included in the judicial exception recited in claim 1 because they merely further limit the judicial exception.
Limitations reciting a mathematical concept.
Claims 9, 13, 15, 21-22, 26 and 28 recite limitations that equate to a mathematical concept because they are similar to the concepts of organizing and manipulating information through mathematical correlations in Digitech Image Techs., LLC v Electronics for Imaging, Inc. (758 F.3d 1344, 111 U.S.P.Q.2d 1717 (Fed. Cir. 2014)), which the courts have identified as mathematical concepts. The paragraphs below discuss the broadest reasonable interpretation (BRI) of the limitations in these claims that recite a mathematical concept.
Claim 9 recites math because the total reads cutoff is a number defined by the product between number of human amplicons and a constant value X. Claims 13 and 15 recite math by requiring a calculation to derive the performance value. Claim 19 includes performing the calculations recited in specification para. [68]. Claims 21-22 requires a mathematical correlation by comparing a number (normalized reads) to a percentage read cutoff. Claims 26 and 28 recite a mathematical concept of a coefficient of variability and a consistent mean percentage.
As such, claims 1-5, 7-9, 12-13, 15, 18-19, 21-22, 24, 26, 28, 31 and 33 recite an abstract idea (Step 2A, Prong 1: YES).
Additional Elements:
Once limitations have been identified that recite a judicial exception, the claims are evaluated for additional elements. The additional elements are then analyzed under Step 2A, Prong 2 then Step 2B. Claims 1-5, 7-9, 12-13, 15, 18-19, 21-22, 24, 26, 28 and 31 do not recite additional elements and are thus not evaluated under Step 2A, Prong 2 or Step 2B. The instant claims recite the following additional elements:
Claim 33 recites “A non-transitory computer readable medium comprising instructions that, when executed by a processor, cause the processor to: … wherein the instructions that cause the processor to call the one or more of the cells further comprises instructions that, when executed by the processor, cause the processor to: …”
These above recited additional elements are analyzed below under both Step 2A, Prong 2 and Step 2B:
Step 2A, Prong 2:
Claims found to recite a judicial exception under Step 2A, Prong 1 are then further analyzed to determine if the claims integrate the recited judicial exception into a practical application or not (Step 2A, Prong 2). The judicial exception is not integrated into a practical application because the claims do not recite additional elements that reflect an improvement to a computer, technology, or technical field (MPEP § 2106.04(d)(1) and 2106.5(a)), require a particular treatment or prophylaxis for a disease or medical condition (MPEP § 2106.04(d)(2)), implement the recited judicial exception with a particular machine that is integral to the claim (MPEP § 2106.05(b)), effect a transformation or reduction of a particular article to a different state or thing (MPEP § 2106.05(c)), nor provide some other meaningful limitation (MPEP § 2106.05(e)). Rather, the claims include limitations that equate to an equivalent of the words “apply it” and/or to instructions to implement an abstract idea on a computer (MPEP § 2106.05(f)), insignificant extra-solution activity (MPEP § 2106.05(g)), and field of use limitations (MPEP § 2106.05(h)). The paragraphs below discuss the additional elements recited above in the instant claims.
Claim 33 recites a non-transitory computer readable medium comprising instructions executed by a processor. There are no limitations requiring anything other than a generic computer and/or generic computing system. Therefore, these limitations equate to mere instructions to implement an abstract idea on a generic computer, which the courts have established does not render an abstract idea eligible in Alice Corp. 573 U.S. at 223, 110 USPQ2d at 1983.
Claim 33 invokes a computer as a tool to perform an existing process such as receiving data, which does not provide a practical application (MPEP2106.05(f)(2)).
As such, claims 1-5, 7-9, 12-13, 15, 18-19, 21-22, 24, 26, 28, 31 and 33 are directed to an abstract idea (Step 2A, Prong 2: NO).
Step 2B:
Claims found to be directed to a judicial exception are then further evaluated to determine if the claims recite an inventive concept that provides significantly more than the judicial exception itself (Step 2B). These claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because these claims recite additional elements that equate to instructions to apply the recited exception in a generic way and/or in a generic computing environment (MPEP § 2106.05(f)) and to well-understood, routine and conventional (WURC) limitations (MPEP § 2106.05(d)). The paragraphs below discuss the additional elements recited above in the instant claims.
Claim 33 recites a non-transitory computer readable medium comprising instructions executed by a processor. There are no limitations requiring anything other than a generic computer and/or generic computing system. Therefore, these limitations equate to instructions to implement an abstract idea on a generic computing environment, which the courts have established does not provide an inventive concept in Intellectual Ventures I LLC v. Capital One Bank (USA), 792 F.3d 1363, 1367, 115 USPQ2d 1636, 1639 (Fed. Cir. 2015).
Claim 33 invokes a computer as a tool to perform an existing process such as receiving data, which does not provide significantly more (MPEP2106.05(f)(2)).
Claim 33 recites a CRM with instruction. This limitation equates to storing information in memory, which the courts have established as a WURC function of a generic computer in Versata Dev. Group, Inc. v. SAP Am., Inc., 793 F.3d 1306, 1334, 115 USPQ2d 1681, 1701 (Fed. Cir. 2015).
When these additional elements are considered individually and in combination, they do not provide an inventive concept because they equate to WURC functions/components of a generic computer. Therefore, these additional elements do not transform the claimed judicial exception into a patent-eligible application of the judicial exception and do not amount to significantly more than the judicial exception itself (Step 2B: No).
As such, claims 1-5, 7-9, 12-13, 15, 18-19, 21-22, 24, 26, 28, 31 and 33 are not patent eligible.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-5, 7-9, 18-19, 21-22, 24, 28, 31 and 33 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Dixit et al. (“Dixit”; cell 167, no. 7 (2016): 1853-1866).
The bold and italicized text below are the limitations of the instant claims, and the italicized text serves to map the prior art onto the instant claims.
Claims 1 and 33:
Although the below claim mapping is specific to claim 33, it is also applied to claim 1 because claim 33 anticipates claim 1.
A non-transitory computer readable medium comprising instructions that, when executed by a processor, cause the processor to:
Dixit discloses Perturb-Seq which is a scalable single-cell RNA (scRNA) profiling of pooled genetic screens (title). Dixit discloses software and algorithms, indicating a computer-implemented method (pg. e1, Key Resources Table).
obtain reads determined using a targeted sequencing panel, the reads sequenced from amplicons derived from a plurality of cells;
scRNA-seq is performed on cells transduced with a pool of lentiviral constructs encoding a single-guide RNA (sgRNA) and a guide barcode (GBC) which encodes the identity of a CRISPR knockout perturbation (pg. 1854, col. 2, last para. – pg. 1855, col. 1, para. 1) (FIG. 1A) (FIG. 1C).
The limitation “reads determined using a targeted sequencing panel” is a product by process that defines a process previously performed (i.e. using a targeted sequencing panel) to obtain the product of “reads”. MPEP 2113.I recites “[e]ven though product-by-process claims are limited by and defined by the process, determination of patentability is based on the product itself. The patentability of a product does not depend on its method of production. If the product in the product-by-process claim is the same as or obvious from a product of the prior art, the claim is unpatentable even though the prior product was made by a different process." As such, the obtained reads of Dixit read on the claimed product of “reads” even though produced by a different method.
call one or more of the cells, wherein the instructions that cause the processor to call the one or more of the cells further comprises instructions that, when executed by the processor, cause the processor to: identify one or more cell barcodes in the obtained reads,
scRNA-seq tags each cell’s mRNA with a unique cell barcode (CBC), which associates the cell’s transcriptional profile with a delivered genetic perturbation encoded by the GBC (pg. 1855, col. 1, para. 1) (FIG. 1A). The CBCs were used to identify cell types in the bioinformatic pipeline (pg. e4, sec. Alignment of cell barcode).
wherein the one or more cell barcodes are identified at least for satisfying a total reads cutoff that is defined based on a number of amplicons of a first type in the targeted sequencing panel;
Dixit recites “[f]or strict filtering, chimeric reads were removed by thresholding molecules that, for a given unique combination of cell barcode and UMI, received less than 20% of the reads” (pg. e5, para. 3). The limitation “a total reads cutoff that is defined based on a number of amplicons of a first type in the targeted sequencing panel” recites a product by process. As such, “less than 20% of the reads” of Dixit reads on the product of “a total reads cutoff.”
attribute one of the identified one or more cell barcodes to one of the one or more cells;
Each cell has a unique CBC (FIG. 1A). Thus, each of the different cell types, K562 and BMDC (FIG. 1C), has a unique CBC.
for each of one or more of the called cells, determine presence or absence of one or more amplicons of a second type comprising a barcode attributed to the called cell; determine whether the called cell is a genetically modified cell according to the presence or absence of one or more amplicons of the second type comprising the barcode attributed to the called cell.
A PCR protocol was used to detect GBCs following whole transcriptome application (pg. 1855, col. 1, para. 3). For each of the cells in FIG. 1, Dixit recites “[t]o associate cell barcodes with guides, we used the sgRNA/GBC dictionary generated by either Sanger sequencing or NGS. Paired-end reads containing a cell barcode and UMIs on one side and GBC barcode on the other side were isolated and collapsed into unique molecules by first demultiplexing a sequencing run using bcl2fastq2” (pg. e4, para. 4). Presence of a GBC is used to screen for CRISPR perturbations (FIG. 1).
Claim 2:
The cells were human K562 cells and sequence reads from the cells were mapped to the CBC (FIG. 1A-B) (pg. e4, sec. Alignment of cell barcode).
Claim 3:
Dixit recites “[f]or strict filtering, chimeric reads were removed by thresholding molecules that, for a given unique combination of cell barcode and UMI, received less that 20% of the reads” (pg. e5, para. 3). Threshold is defined by the CBC and UMI, which is not the GBC.
Claims 4-5 and 7:
Cells are transduced using a lentiviral construct containing a GBC (FIG. 1A-1B) (pg. 1854, col. 2, para. 1).
Claim 8:
Dixit recites “[p]aired-end reads containing a cell barcode and UMIs on one side and GBC barcode on the other side were isolated and collapsed into unique molecules by first demultiplexing a sequencing run using bcl2fastq2 … The reads were then concatenated and GBC reads isolated using the following constant sequence within the GBC transcript: GGCACAAGCTTAATTAAGAATT” (pg. e4, para. 4).
Claim 9:
The broadest reasonable interpretation of claim 9 includes the “total reads cutoff” being a product by process. As such, the following teaching of Dixit reads on the claimed product of “total reads cutoff” even though produced by a different method: “[f]or strict filtering, chimeric reads were removed by thresholding molecules that, for a given unique combination of cell barcode and UMI, received less that 20% of the reads” (pg. e5, para. 3).
Claim 18:
The pooled CRISPR screen included six Perturb-seq experiments analyzing 200,000 cells (FIG. 1C), which included two different cell types BMDC and K562, wherein each cell type had a unique cell barcode (FIG. 1A) (pg. 1855, col. 1, para. 2).
Claims 19 and 24:
Dixit recites “[i]n some cases, we observed more than one GBC in a cell. To distinguish between those arising from multiple infections and those due to PCR chimeras or ambient RNA, we filter low-abundance contaminants by normalizing the observed GBCs within each CBC (Figures S1D and S1E) and retain cells with more than one GBC for epistasis analysis (Figure 1D)” (pg. 1855, col. 1, para. 3).
Claims 21-22:
FIG 1SD shows percentage of normalized reads of a GBC within a given CBC, wherein low-level contaminants are below the red line which is 0.1%.
Claim 28:
Dixit down-samples read/cell in FIG. 7B to detect gene level regulation versus signature or state level regulation (pg. 1862, col. 2, para. 2). FIG 7B shows that 50% sequencing depth is similar to 100% sequencing depth in cells that were transduced with the lentiviral vector.
Claim 31:
Each cell undergoes scRNA-seq and each cell contains a GBC and a CBC (FIG. 1A,1B). Over 200,000 cells were screened (pg. 1855, col. 1, para. 1). This results in over 10 amplicons for both the GBC and CBC.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 12 is rejected under 35 USC 103 for being unpatentable over Dixit et al. (“Dixit”; cell 167, no. 7 (2016): 1853-1866), as applied to claim 1, in view of Ocasio et al. (“Ocasio”; Nature communications 10, no. 1 (2019): 5829).
The limitations of claim 1 are taught above by Dixit under 35 USC 102. The bold and italicized text below are the limitations of the instant claims, and the italicized text serves to map the prior art onto the instant claims.
Claim 12:
Dixit identifies cell barcodes (CBC) for each cell type (FIG. 1A) and defines a cutoff as 20% of reads for a barcode (pg. e4-e5, sec. Alignment of cell barcodes). However, Dixit does not identify a CBC based on a performance value defined as a product between a constant value Y and a mean coverage of a subset of reads.
Ocasio uses scRNA-seq to analyze cellular diversity in medulloblastomas in transgenic mice (abstract). Cells, identified by barcodes, were filtered that had greater than 4-5 standard deviations above median nUMI or nGene (pg. 15, col. 2, para. 4). nUMI and nGene are considered “performance value” because they are quality control metrics for scRNA-seq.
It would have been prima facie obvious to modify Dixit’s method of scRNA-seq that uses barcodes and UMIs by filtering for nUMI and nGene because Ocasio teaches that this removes cells that may be doublets, improperly merged barcodes, or sequencing artifacts (pg. 15, col. 2, para. 4). There would have been a reasonable expectation of success because both Dixit and Ocasio use scRNA-seq with barcodes and UMIs. Thus, the method of Ocasio could be implemented with Dixit.
Claim 26 is rejected under 35 USC 103 for being unpatentable over Dixit et al. (“Dixit”; cell 167, no. 7 (2016): 1853-1866), as applied to claim 1, in view of Peng et al. (“Peng”; BMC genomics 16, no. 1 (2015): 589).
The limitations of claim 1 are taught above by Dixit under 35 USC 102. The italicized text below are the limitations of the instant claims mapped to the prior art.
Claim 26:
Dixit identifies CRISPR perturbed cells via a guide barcoded (GBC) associated with the Perturb-seq vector (FIG. 1B). There was a 98% detection probability of GBCs (pg. 1855, col. 1, para. 3). However, Dixit does not disclose a CV percent of less than 1% for identifying the CRISPR perturbed cells.
Peng reduces amplification artifacts in high multiplex amplicon sequencing using molecular barcodes (title). Peng teaches “most measurements using barcodes have much smaller technical noise, assessed by the coefficient of variation (CV), than those using raw sequence reads (Fig. 3b) … For low abundance transcripts, sampling error could significantly contribute to observed variation. To confirm this, theoretical Poisson distribution CV-vs-mean was plotted (Fig. 3c). CVs for barcodes were very close to the Poisson CV, suggesting that using molecular barcodes enabled us to lower the counting variation close to the theoretical limits set by Poisson sampling error” (pg. 6, col. 2, para. 2). FIG 3C shows that for certain numbers of barcode counts, the CV % can be less than 1%.
It would have been prima facie obvious to have substituted the barcodes in the GBCs of Dixit with the barcodes described by Peng because Peng teaches that identifying their barcodes results in an advantageous CV of less than 1% (FIG 3C). One of ordinary skill could have substituted the barcodes because they serve the same purpose of unique identification, and the results would have been predictable because the barcode design of Peng is known in the art (Fig 3C) (pg. 3, col. 1, para. 2) and both Peng and Dixit use barcodes in an RNA-seq experiment.
Conclusion
No claims are allowed.
Claims 13 and 15 are free from the prior art because the prior art does not fairly teach or suggest the following limitations in claim 13: “wherein the performance value of the targeted sequencing panel is a product between a constant value Y and a mean coverage of a subset of reads representing reads comprising cell barcodes that satisfy the total reads cutoff”. The closest prior art is Zhang et al. (“Zhang”; Molecular cell 73, no. 1 (2019): 130-142) who discloses various filtering techniques for barcodes but does not describe the filtering method of instant claim 13. Subsamples reads at different depths (FIG 5).
Notable, but not relied upon, prior art includes: Leong et al. (WO 2021/251905 A1) assess transduction efficiency and specificity of vectors at a single cell level using barcodes.
Inquiries
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Noah A. Auger whose telephone number is (703)756-4518. The examiner can normally be reached M-F 7:30-4:30 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Karlheinz Skowronek can be reached at (571) 272-9047. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/N.A.A./Examiner, Art Unit 1687
/KAITLYN L MINCHELLA/Primary Examiner, Art Unit 1685
Prosecution Insights