Prosecution Insights
Last updated: May 29, 2026
Application No. 18/558,919

COMPOSITIONS AND METHODS RELATED TO THE TREATMENT OF OCULAR DISEASES IN EQUINES

Non-Final OA §102§103
Filed
Nov 03, 2023
Priority
May 03, 2021 — provisional 63/183,234 +2 more
Examiner
NGUYEN, QUANG
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The University of North Carolina at Chapel Hill
OA Round
1 (Non-Final)
38%
Grant Probability
At Risk
1-2
OA Rounds
1y 5m
Est. Remaining
91%
With Interview

Examiner Intelligence

Grants only 38% of cases
38%
Career Allowance Rate
281 granted / 736 resolved
-21.8% vs TC avg
Strong +53% interview lift
Without
With
+52.8%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
44 currently pending
Career history
805
Total Applications
across all art units

Statute-Specific Performance

§101
0.4%
-39.6% vs TC avg
§103
58.2%
+18.2% vs TC avg
§102
6.7%
-33.3% vs TC avg
§112
10.1%
-29.9% vs TC avg
Black line = Tech Center average estimate • Based on career data from 736 resolved cases

Office Action

§102 §103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s amendment filed on 03/12/2026 has been entered. Claims 1-8, 10-11, 13, 15-21, 24 and 32 are pending in the present application. Applicant's election with traverse of Group I, drawn to a composition for treating ocular disease in equines, in the reply filed on 03/12/2026 is acknowledged. Applicant also elected the following species with traverse: (i) AAV8 as a species of an AAV vector; (ii) a buffer as a species of a further component in the composition; (iii) dexamethasone as a species of a steroid; (iv) flunixin meglumine as a species of NSAID; (v) cyclosporin as a species of an immunosuppressant; and (vi) gentamicin as a species of an antibiotic. A. With respect to the Group restriction, the traversal is on the ground(s) that a restriction/unity of invention determination is a threshold procedural matter, not a merit determination; and even if some consideration of the prior art is appropriate at the restriction stage to assess whether a shared feature constitutes a contribution, that determination should be made only where the prior art clearly anticipates or render obvious the “special technical feature” (STF) without dispute. Applicant argued that neither Scaria nor Moss individually discloses a composition comprising an AAV vector encoding an equine IL-10 polypeptide, formulated for ocular administration to an equid; and the Examiner’s proposed combination requires multiple inferential steps that would not be obvious. Specifically, Scaria does not teach equine-specific IL-10 in an ocular context; Moss does not teach ocular delivery, and cannot supply this missing teaching; and the combination requires impermissible hindsight. This is not found persuasive for the reasons discussed below. First, a shared technical feature in Groups I-II is a composition for treating ocular disease in equines comprising: an adeno-associated virus (AAV) vector comprising a polynucleotide encoding an equine IL-10 polypeptide, or a functional derivative or variant thereof, and a pharmaceutically acceptable carrier and/or excipient, wherein the composition is suitable for ocular administration to an equid. A determination of prior art must be made whether the shared technical feature common to the identified Groups I-II is not a contribution over the art. In this instance, at least Moss et al already disclosed a composition comprising 1x1012 viral genomes of a recombinant self-complementary AAV5-IL-10 comprising a full-length equine IL-10 cDNA in 3 mL of sterile PBS (phosphate-buffered saline) for injection into each middle carpal joint of a horse (Abstract; particularly right column, sections titled “Adeno-associated viral vector production” and “Intra-articular injections” at page 111). Since the composition of Moss et al has the same two components namely: a recombinant AAV vector and a pharmaceutically acceptable carrier (sterile PBS) of the claimed composition, and therefore it is also suitable for ocular administration into an equine. Please note that the patentability of composition claims depends on the claimed structure, not on the use or purpose of the structure; and stating an intended use is not sufficient to structurally distinguish from the prior art. Please see the 102(a)(1) rejection below for more details. Second, the combination of Scaria et al and Moss et al also renders the “special technical feature” (STF) obvious (Please see the 103 rejection below for details). It is noted that under 35 U.S.C. 103, none of the cited references have to teach every limitation of claim 1 alone. For example, the Scaria reference does not have to teach specifically the use of equine IL-10 even though the reference clearly teaches at least a composition comprising an improved rAAV (e.g., rAAV2, rAAV8, rAAVrh8R and others) for enhanced gene therapy of ocular disorders (e.g., age related macular degeneration, intraocular inflammation, glaucoma, and posterior uveitis), wherein the rAAV comprise one or more substitutions of amino acids that interact with heparan sulfate proteoglycan (e.g., reducing or ablating binding to HSPG), and a heterologous nucleic acid encoding a therapeutic polypeptide that includes anti-inflammatory factors such as IL10, IL1-ra, TGFβ and IL4 (see at least Abstract; Brief Summary of the Invention; particular paragraphs [0008]-[0013], [0019], [0070], [0106], [0127], [0169]). Scaria et al also taught that the dose of viral particles administered (e.g., subretinal and/or intravitreal administration) to an individual (e.g., human, horses, cats, dogs and others) is at least about 1x108 to about 1x1013 genome copies/kg of body weight (paragraphs [0127] and [0206]); and the composition comprising the rAAV particles and a buffer and/or a pharmaceutically acceptable excipient (paragraphs [0070], [0197] and [0201]). It would have been obvious for an ordinary skill in the art to modify the composition of Scaria et al by also selecting a full-length equine IL-10 cDNA as a heterologous nucleic acid encoding the therapeutic anti-inflammatory factor IL-10 in the form of an improved rAAV particle for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis in an individual that includes an equine/horse with a reasonable expectation of success because Moss et al already disclosed successfully a composition comprising 1x1012 viral genomes of a recombinant self-complementary AAV5-IL-10 comprising a full-length equine IL-10 cDNA in 3 mL of sterile PBS (phosphate-buffered saline) for injection into each middle carpal joint of a horse, that resulted in a sustained interleukin-10 transgene expression; and concluded that future studies investigating the chondroprotective effects of IL-10 in inflamed joints in vivo are warranted. Third, with respect to Applicant’s argument on impermissible hindsight reconstruction Examiner would like to recite a paragraph from in re Oetiker, 977, F.2d 1443, 1448 (Fed. Cir. 1992). "[T]here must be some teaching, reason, suggestion, or motivation found "in the prior art" or "in the prior art references" to make a combination to render an invention obvious within the meaning of 35 U.S.C. 103 (1998). Similar language appears in a number of opinions and if taken literally would mean that an invention cannot be held to have been obvious unless something specific in a prior art reference would lead an inventor to combine the teachings therein with another piece of prior art. This restrictive understanding of the concept of obviousness is clearly wrong…. While there must be some teaching, reason, suggestion, or motivation to combine existing elements to produce the claimed device, it is not necessary that the cited references or prior art specifically suggest making the combination…. In sum, it is off the mark for litigants to argue, as many do, that an invention cannot be held to have been obvious unless a suggestion to combine the prior art teachings is found in a specific reference." Although the cited artisans do not specifically point out a motivation to in their disclosure, an ordinarily skilled artisan would have been able to identify the need for the combination of the teachings without the disclosure of the instant application. It must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Accordingly, there is no unifying special technical feature between Groups I-II. B. With respect to the species restriction, Applicant argued that the elected species are mutually consistent and compatible, as each is a component that may be present in the same composition as defined by independent claim 1, and no incompatibility exists among these elected species. Applicant argued that the Examiner’s stated rationale is a boilerplate and insufficient and all of the enumerated species are dependent claim limitations on a common independent claim 1, which defines the core inventive concept of an AAV vector comprising a polynucleotide encoding an equine IL-10 polypeptide, formulated for ocular administration to an equid. Additionally, Applicant argued that the Examiner has not identified distinct prior art references applicable to individual species but not others, has not identified distinct 101 or 112 issues unique to individual species, and has not provided a particularized explanation of why the prior art field applicable to a dexamethasone-containing composition would not overlap substantially with the filed applicable to a flunixin meglumine-containing composition, where both are dependent claims directed to optional anti-inflammatory adjuvants in the same AAV-eqIL-10 ocular composition. First, the examiner has searched and examined all elected species. Second, once again there is no unifying special technical feature between Groups I-II. Please refer to the Examiner’s responses in Section A above. Third, please refer at least to the multiple prior art references in the form of Mach et al (WO 2005/009755), Ronald et al (WO 2014/052640) and Sallam et al (Med Hypothesis Discov Innov Ophthalmol 7:140-155, 2018) for Applicant’s elected species, let alone for numerous other non-elected species encompassed by pending claims. The requirement is still deemed proper and is therefore made FINAL. Accordingly, claims 24 and 32 are withdrawn from further consideration because they are drawn to a non-elected invention. Therefore, claims 1-8, 10-11, 13 and 15-21 are examined on the merits herein with the above elected species. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1, 7-8, 10-11 and 13 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Moss et al (Human Gene Therapy 31:110-118, published on line 21 Jan 2020) and evidenced by Cell Signaling Technology Product Sheet (2013). The instant claims are drawn to a composition for treating ocular disease in equines (an intended use) comprising: an adeno-associated virus (AAV) vector comprising a polynucleotide encoding an equine IL-10 polypeptide, or a functional derivative or variant thereof; and a pharmaceutically acceptable carrier and/or excipient; wherein the composition is suitable for ocular administration to an equid. Moss et al already disclosed a composition comprising 1x1012 viral genomes of a recombinant self-complementary AAV5-IL-10 comprising a full-length equine IL-10 cDNA in 3 mL of sterile PBS (phosphate-buffered saline) for injection into each middle carpal joint of a horse (Abstract; particularly right column, sections titled “Adeno-associated viral vector production” and “Intra-articular injections” at page 111). A sterile PBS has a pH within the recited range of from a about 4.0 to about 8.0 in claim 13 as evidenced by the Cell Signaling Technology Product Sheet for a sterile PBS at pH 7.2. Moss et al found a sustained interleukin-10 transgene expression, and they stated “This study demonstrates the feasibility and efficiency of intra-articular AAV5-IL-10, and future studies investigating the chondroprotective effects of IL-10 in inflamed joints in vivo are warranted” (last sentence of the Abstract). Since the composition of Moss et al has the same two components namely: a recombinant AAV vector and a pharmaceutically acceptable carrier (sterile PBS) of the claimed composition, and therefore it is also suitable for ocular administration into an equine. Please note that the patentability of composition claims depends on the claimed structure, not on the use or purpose of the structure; and stating an intended use is not sufficient to structurally distinguish from the prior art. Thus, the teachings of Moss et al meet every limitation of the instant claims. Accordingly, the reference anticipates the instant claims. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1, 7-8, 10-11, 13 and 21 are rejected under 35 U.S.C. 103 as being unpatentable over Scaria et al (WO 2015/168666) in view of Moss et al (Human Gene Therapy 31:110-118, published on line 21 Jan 2020). The instant claims are drawn to a composition for treating ocular disease in equines (an intended use) comprising: an adeno-associated virus (AAV) vector comprising a polynucleotide encoding an equine IL-10 polypeptide, or a functional derivative or variant thereof; and a pharmaceutically acceptable carrier and/or excipient; wherein the composition is suitable for ocular administration to an equid. Scaria et al already disclosed at least a composition comprising an improved rAAV (e.g., rAAV2, rAAV8, rAAVrh8R and others) for enhanced gene therapy of ocular disorders (e.g., age related macular degeneration, intraocular inflammation, glaucoma, and posterior uveitis), wherein the rAAV comprise one or more substitutions of amino acids that interact with heparan sulfate proteoglycan (e.g., reducing or ablating binding to HSPG), and a heterologous nucleic acid encoding a therapeutic polypeptide that includes anti-inflammatory factors such as IL10, IL1-ra, TGFβ and IL4 (see at least Abstract; Brief Summary of the Invention; particular paragraphs [0008]-[0013], [0019], [0070], [0106], [0127], [0169]). Scaria et al also taught that the dose of viral particles administered (e.g., subretinal and/or intravitreal administration) to an individual (e.g., human, horses, cats, dogs and others) is at least about 1x108 to about 1x1013 genome copies/kg of body weight (paragraphs [0127] and [0206]); and the volume of the composition injected to the subretinal space of the retina is any amount between 1uL to 1mL (paragraph [0204]). Moreover, Scaria et al taught the composition comprising the rAAV particles and a buffer and/or a pharmaceutically acceptable excipient (paragraphs [0070], [0197] and [0201]), and a kit containing rAAV particles or compositions containing rAAV particles (paragraph [0106]). Scaria et al also stated explicitly “[t]hese compositions can be combined with pharmaceutically vehicles such as saline, Ringer’s balanced salt solution (pH 7.4), and the like” (paragraph [0197]). Scaria et al further disclosed that the disclosed compositions can be used either alone or in combination with one or more additional therapeutic agents for treating ocular disorders, and the one or more additional therapeutic agents include polypeptide neurotrophic factors (e.g., GDNF, CNTF, BDNF), and anti-angiogenic nucleic acids (e.g., siRNA, miRNA, ribozymes) against VEGF (paragraph [0220]). Scaria et al did not teach specifically an improved rAAV particle comprising a polynucleotide encoding an equine IL-10 polypeptide for treating an individual that includes an equine/horse. Before the effective filing date of the present application (05/03/2021), Moss et al already disclosed a composition comprising 1x1012 viral genomes of a recombinant self-complementary AAV5-IL-10 comprising a full-length equine IL-10 cDNA in 3 mL of sterile PBS (phosphate-buffered saline) for injection into each middle carpal joint of a horse (Abstract; particularly right column, sections titled “Adeno-associated viral vector production” and “Intra-articular injections” at page 111). Moss et al also stated “This study demonstrates the feasibility and efficiency of intra-articular AAV5-IL-10, and future studies investigating the chondroprotective effects of IL-10 in inflamed joints in vivo are warranted” (last sentence of the Abstract). Accordingly, it would have been obvious for an ordinary skill in the art to modify the composition of Scaria et al by also selecting a full-length equine IL-10 cDNA as a heterologous nucleic acid encoding the therapeutic anti-inflammatory factor IL-10 in the form of an improved rAAV particle for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis in an individual that includes an equine/horse, in light of the teachings of Moss et al as set forth above. An ordinary skilled artisan would have been motivated to carry out the above modification because Moss et al already disclosed successfully a composition comprising 1x1012 viral genomes of a recombinant self-complementary AAV5-IL-10 comprising a full-length equine IL-10 cDNA in 3 mL of sterile PBS (phosphate-buffered saline) for injection into each middle carpal joint of a horse, that resulted in a sustained interleukin-10 transgene expression; and concluded that future studies investigating the chondroprotective effects of IL-10 in inflamed joints in vivo are warranted. With respect to dependent claim 21 reciting a kit comprising at least one container, it would also have been obvious that the modified kit must contain at least a container containing at least the modified rAAV particles, particularly Scaria et al already taught specifically a kit containing rAAV particles or compositions containing rAAV particles. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Scaria et al and Moss et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified composition resulting from the combined teachings of Scaria et al and Moss et al as set forth above is indistinguishable and encompassed by the presently claimed composition. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Claims 2-3 and 5-6 are rejected under 35 U.S.C. 103 as being unpatentable over Scaria et al (WO 2015/168666) in view of Moss et al (Human Gene Therapy 31:110-118, published on line 21 Jan 2020) as applied to claims 1, 7-8, 10-11, 13 and 21 above, and further in view of Fisher (US 7,846,428). The combined teachings of Scaria et al and Moss et al were presented above. However, none of the cited references teach specifically that the polynucleotide encoding an equine IL-10 polypeptide is at least 75% identical to SEQ ID NO: 1 of the present application and/or the encoded equine IL-10 polypeptide comprising the sequence of SEQ ID NO: 2; or the polynucleotide encoding the equine IL-10 polypeptide is codon optimized. Before the effective filing date of the present application (05/03/2021), Fisher already taught at least using a viral vector encoding and capable of expressing equine IL-10 for the treatment of OA in addition to a viral vector encoding and capable of expressing an equine pre-proBMP-7, a equine proBMP-7, or a equine BMP-7 mature polypeptide, wherein the nucleotide sequence encoding the equine IL-10 of SEQ ID NO: 60 (100% identical to SEQ ID NO: 2 of the present application) is SEQ ID NO: 59 that exhibits 75.4% identical to SEQ ID NO: 1 of the present application (col. 28, lines 15-27; col.29, line 65 continues to line 4 at column 30; col. 30, lines 11-16; SEQ ID NOs. 59-60; and attached sequence searches below). Additionally, Fisher also taught that codon preference among different species can be dramatically different, and to enhance the expression level of a foreign protein, it is relevant to match the codon frequency of the foreign protein to the one of the host expression system; and the nucleotide sequences are codon optimized using GeneOptimizer (col. 16, line 55 continues to line 16 at col. 17). Accordingly, it would have been obvious for an ordinary skill in the art to further modify the combined teachings of Scaria et al and Moss et al by also selecting the nucleotide sequence encoding the full-length equine IL-10 polypeptide of SEQ ID NO: 59 as a heterologous nucleic acid encoding the therapeutic anti-inflammatory factor IL-10, as well as codon-optimizing the nucleotide sequence encoding equine IL-10 for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis in an individual that includes an equine/horse, in light of the teachings of Fisher as set forth above. An ordinary skilled artisan would have been motivated to further carry out the above modifications because Fisher already taught using a viral vector encoding and capable of expressing equine IL-10 for the treatment of OA, wherein the nucleotide sequence encoding the equine IL-10 of SEQ ID NO: 60 (100% identical to SEQ ID NO: 2 of the present application) is SEQ ID NO: 59 that exhibits 75.4% identical to SEQ ID NO: 1 of the present application. Additionally, Fisher also taught that codon-optimization is used to enhance expression of a foreign protein, and in this instance the nucleotide sequence encoding equine IL-10. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Scaria et al, Moss et al and Fisher; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified composition resulting from the combined teachings of Scaria et al, Moss et al and Fisher as set forth above is indistinguishable and encompassed by the presently claimed composition. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Claims 15-19 are rejected under 35 U.S.C. 103 as being unpatentable over Scaria et al (WO 2015/168666) in view of Moss et al (Human Gene Therapy 31:110-118, published on line 21 Jan 2020) as applied to claims 1, 7-8, 10-11, 13 and 21 above, and further in view of Mach et al (WO 2005/009755), Ronald et al (WO 2014/052640) and Sallam et al (Med Hypothesis Discov Innov Ophthalmol 7:140-155, 2018). The combined teachings of Scaria et al and Moss et al were presented above. However, none of the cited references teach specifically that the composition further comprising a biological active agent that is selected from the group consisting of an immunosuppressant (cyclosporin as the elected species), an NSAID (flunixin meglumine as the elected species), a steroid (dexamethasone as the elected species), an antibiotic (gentamicin as the elected species), and any combination thereof. Before the effective filing date of the present application (05/03/2021), Mach et al already taught to inhibit inflammation in an inflammatory disorder (e.g., ocular inflammation such as uveitis) in a mammal (e.g., human, horse, dog, cat, cow) using CD3 modulators alone or in conjunction with one or more additional therapeutic compound such as an anti-inflammatory agent or immunosuppressive agent that are not limited to methotrexate, Cyclosporin A, corticosteroids, statins, interferon beta, nonsteroidal anti-inflammatory drugs (NSAIDs) and the disease-modifying anti-rheumatic drugs (Abstract; Summary of the Invention; particularly page 4, lines 25-29; page 8, line 29 continues to line 9 at page 9; page 10, lines 6-20; page 14, lines 18-31). Mach et al stated explicitly “The beneficial effect of the combination includes, but is not limited to, pharmacokinetic or pharmacodynamic co-action resulting from the combination of therapeutic agents” (lines 28-30 at page 14). As an example for the treatment of uveitis, anti-CD3 antibodies can be administered in conjunction for example with corticosteroids, methotrexate, Cyclosporin A, Cyclophosphamide and/or statin (lines 3-7 at page 16); while for the treatment of multiple sclerosis a combination of anti-CD3 with for example Glatiramer acetate, Interferon beta-1a, Interferon beta-1a, Interferon beta 1-b, Mitoxantrone, Dexamethasone, Methylprednisolone and/or Prednisone and/or statins (lines 11-14 at page 16). Additionally, Ronald et al also taught the use of a suitable AMPK agonist alone or in combination with other suitable agents such as corticosteroids (e.g., methylprednisolone acetate, dexamethasone and the like), and non-steroidal anti-inflammatory agents (NSAIDs) (e.g., naproxen, ibuprofen, flunixin meglumine, and the like) to treat inflammation due to disease or injury in a human or animal (e.g., man, horses, dogs, cats and others) such as osteoarthritis and ocular inflammation such as uveitis, scleritis and iritis (Abstract; particularly first paragraph at page 18; last sentence at page 21; last paragraph at page 26 continues to first paragraph at page 27). Moreover, Sallam et al already reviewed antimicrobial therapy for infectious uveitis of the posterior segment, including the commonly used intravitreal antimicrobial drugs such as gentamycin, amikacin, vancomycin and moxifloxacin (Abstract; particularly right column, first full paragraph; section titled “Intravitreal Amikacin and Gentamicin” at page 144; and Table 1 at page 150). Accordingly, it would have been obvious for an ordinary skill in the art to further modify the combined teachings of Scaria et al and Moss et al by also further including additional biological active agents such as a dexamethasone (a steroid), flunixin meglumine (a NSAID), Cyclosporin A (an immunosuppressant) and/or gentamicin (an antibiotic) in the composition for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis (e.g., an infectious posterior uveitis) in an individual that includes an equine/horse, in light of the teachings of Mach et al, Ronald et al and Sallam et al as set forth above. An ordinary skilled artisan would have been motivated to further carry out the above modifications because: (i) Mach et al already taught to inhibit inflammation in an inflammatory disorder (e.g., ocular inflammation such as uveitis) in a mammal (e.g., human, horse, dog, cat, cow) using CD3 modulators alone or in conjunction with one or more additional therapeutic compound such as an anti-inflammatory agent or immunosuppressive agent that are not limited to methotrexate, Cyclosporin A, corticosteroids, statins, interferon beta, nonsteroidal anti-inflammatory drugs (NSAIDs) and the disease-modifying anti-rheumatic drugs; (ii) Ronald et al also taught the use of a suitable AMPK agonist alone or in combination with other suitable agents such as corticosteroids (e.g., methylprednisolone acetate, dexamethasone and the like), and non-steroidal anti-inflammatory agents (NSAIDs) (e.g., naproxen, ibuprofen, flunixin meglumine, and the like) to treat inflammation due to disease or injury in a human or animal (e.g., man, horses, dogs, cats and others) such as osteoarthritis and ocular inflammation such as uveitis, scleritis and iritis; and (iii) Sallam et al also disclosed the commonly used intravitreal antimicrobial drugs such as gentamycin, amikacin, vancomycin and moxifloxacin for treating infectious posterior uveitis. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Scaria et al, Moss et al, Mach et al, Ronald et al and Sallam et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified composition resulting from the combined teachings of Scaria et al, Moss et al, Mach et al, Ronald et al and Sallam et al as set forth above is indistinguishable and encompassed by the presently claimed composition. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. Claim 20 is rejected under 35 U.S.C. 103 as being unpatentable over Scaria et al (WO 2015/168666) in view of Moss et al (Human Gene Therapy 31:110-118, published on line 21 Jan 2020) as applied to claims 1, 7-8, 10-11, 13 and 21 above, and further in view of Fang et al (WO 2005/017149). The combined teachings of Scaria et al and Moss et al were presented above. However, none of the cited references teach specifically that AAV vector further comprising a polynucleotide encoding TGFβ or IL-1 receptor antagonist (IL1-ra). Before the effective filing date of the present application (05/03/2021), Fang et al already taught a recombinant vector or construct for expression of two or more recombinant proteins or polypeptides from a single open reading frame using a self-processing peptide which facilitates efficient expression and generation of individual proteins or polypeptides, wherein the recombinant vector includes an adeno-associated virus (AAV), a lentivirus vector or a retrovirus vector (Abstract; and Summary of the Invention). Fang et al also taught that at least the two recombinant proteins include a cytokine such as IL-10 and a growth factor TGF-beta (line 17 at page 23 continues to line 5 at page 25). Accordingly, it would have been obvious for an ordinary skill in the art to further modify the combined teachings of Scaria et al and Moss et al by also further including a polynucleotide encoding another anti-inflammatory factor such as TGF-beta or IL1-ra into the recombinant AAV vector for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis in an individual that includes an equine/horse, in light of the teachings of Fang et al as set forth above. An ordinary skilled artisan would have been motivated to further carry out the above modification because Fang et al already taught successfully a recombinant vector or construct for expression of two or more recombinant proteins or polypeptides from a single open reading frame using a self-processing peptide which facilitates efficient expression and generation of individual proteins or polypeptides, wherein the recombinant vector includes an adeno-associated virus (AAV). Particularly, the primary Scaria et al already taught that a heterologous nucleic acid encoding a therapeutic polypeptide that includes anti-inflammatory factors such as IL10, IL1-ra, TGFβ and IL4 which are useful for treating ocular inflammation and/or posterior uveitis. An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Scaria et al, Moss et al and Fang et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art. The modified composition resulting from the combined teachings of Scaria et al, Moss et al and Fang et al as set forth above is indistinguishable and encompassed by the presently claimed composition. Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. 1. Fischer et al (BMC Veterinary Research 15:29; doi.org/10.1186/s12917-018-1722-7; 12 pages; 2019) disclosed intravitreal injection of low-dose gentamicin for the treatment of recurrent or persistent uveitis in horses. 2. Scaria et al (US 2017/0096683) disclosed the same AAV vectors for retinal and CNS gene therapy as those described in Scaria et al (WO 2015/168666). Conclusion No claim is allowed. Claim 4 is objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s acting SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763. To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300. Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547. Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. /QUANG NGUYEN/Primary Examiner, Art Unit 1631 Sequence 59, Patent No. 7846428 Query Match 75.4%; Score 402.8; Length 537; Best Local Similarity 84.6%; Matches 452; Conservative 0; Mismatches 82; Indels 0; Gaps 0; Qy 1 ATGCACAGCTCCGCCCTGCTGTGCTACCTGGTGTTCCTGGCAGGAGTGGGAGCAAGCCGG 60 ||||||||||| || ||||| || |||||||| |||||||| || |||||||| ||||| Db 1 ATGCACAGCTCAGCACTGCTATGTTACCTGGTCTTCCTGGCCGGGGTGGGAGCCAGCCGA 60 Qy 61 GACCGCGGCACCCAGAGCGAGAACTCCTGTACCCACTTCCCCACCAGCCTGCCTCACATG 120 ||||| ||||||||| |||||| ||| ||||||||||| ||||||||||| |||||| Db 61 GACCGGGGCACCCAGTCTGAGAACAGCTGCACCCACTTCCCAACCAGCCTGCCCCACATG 120 Qy 121 CTGCACGAGCTGAGGGCAGCCTTCTCCAGGGTGAAGACCTTCTTCCAGATGAAGGACCAG 180 || || ||||| | || |||||| |||||||||||| ||||| || |||||||||||| Db 121 CTCCATGAGCTCCGAGCCGCCTTCAGCAGGGTGAAGACTTTCTTTCAAATGAAGGACCAG 180 Qy 181 CTGGACAACATGCTGCTGAACGGCAGCCTGCTGGAGGACTTCAAGGGATACCTGGGATGC 240 |||||||||||| || ||||||| ||||||||||||||| ||||| |||||||| ||| Db 181 CTGGACAACATGTTGTTGAACGGGTCCCTGCTGGAGGACTTTAAGGGTTACCTGGGTTGC 240 Qy 241 CAGGCCCTGTCCGAGATGATCCAGTTCTACCTGGAGGAAGTGATGCCACAGGCCGAGAAC 300 || ||| |||| |||||||||||||| ||||||||||| |||||||| ||||| |||||| Db 241 CAAGCCTTGTCGGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAGGCTGAGAAC 300 Qy 301 CACGGCCCCGACATCAAGGAGCACGTGAACTCCCTGGGCGAGAAGCTGAAGACCCTGAGG 360 |||||||| ||||||||||||||||||||||||||||| || |||||||||||||| | Db 301 CACGGCCCAGACATCAAGGAGCACGTGAACTCCCTGGGGGAAAAGCTGAAGACCCTCCGA 360 Qy 361 GTGAGACTGAGGAGATGCCACAGGTTCCTGCCCTGTGAGAACAAGAGCAAGGCCGTGGAG 420 ||||| ||| || | || || | || ||||||||||| || ||||||||||| |||||| Db 361 GTGAGGCTGCGGCGCTGTCATCGATTTCTGCCCTGTGAAAATAAGAGCAAGGCAGTGGAG 420 Qy 421 CAGGTGAAGAGCGCCTTCTCCAAGCTGCAGGAGAAGGGCGTGTACAAGGCCATGTCCGAG 480 ||||||||||| |||||| ||||| || ||||| || || ||||| |||||| ||| Db 421 CAGGTGAAGAGTGCCTTCAGTAAGCTCCAAGAGAAAGGTGTCTACAAAGCCATGAGTGAG 480 Qy 481 TTCGACATCTTCATCAACTACATCGAGGCCTACATGACCACCAAGATGAAGAAC 534 || |||||||||||||||||||| || ||||| ||||| || |||||||| ||| Db 481 TTTGACATCTTCATCAACTACATAGAAGCCTATATGACAACGAAGATGAAAAAC 534 Sequence 59, Patent No. 7846428 LENGTH: 537 TYPE: DNA ORGANISM: Equus caballus Alignment Scores: Length: 537 Score: 927.00 Matches: 178 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 100.0% Indels: 0 Gaps: 0 US-18-558-919-2 (1-178) x US-11-867-919B-59 (1-537) Qy 1 MetHisSerSerAlaLeuLeuCysTyrLeuValPheLeuAlaGlyValGlyAlaSerArg 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGCACAGCTCAGCACTGCTATGTTACCTGGTCTTCCTGGCCGGGGTGGGAGCCAGCCGA 60 Qy 21 AspArgGlyThrGlnSerGluAsnSerCysThrHisPheProThrSerLeuProHisMet 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GACCGGGGCACCCAGTCTGAGAACAGCTGCACCCACTTCCCAACCAGCCTGCCCCACATG 120 Qy 41 LeuHisGluLeuArgAlaAlaPheSerArgValLysThrPhePheGlnMetLysAspGln 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTCCATGAGCTCCGAGCCGCCTTCAGCAGGGTGAAGACTTTCTTTCAAATGAAGGACCAG 180 Qy 61 LeuAspAsnMetLeuLeuAsnGlySerLeuLeuGluAspPheLysGlyTyrLeuGlyCys 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CTGGACAACATGTTGTTGAACGGGTCCCTGCTGGAGGACTTTAAGGGTTACCTGGGTTGC 240 Qy 81 GlnAlaLeuSerGluMetIleGlnPheTyrLeuGluGluValMetProGlnAlaGluAsn 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 CAAGCCTTGTCGGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAGGCTGAGAAC 300 Qy 101 HisGlyProAspIleLysGluHisValAsnSerLeuGlyGluLysLeuLysThrLeuArg 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CACGGCCCAGACATCAAGGAGCACGTGAACTCCCTGGGGGAAAAGCTGAAGACCCTCCGA 360 Qy 121 ValArgLeuArgArgCysHisArgPheLeuProCysGluAsnLysSerLysAlaValGlu 140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GTGAGGCTGCGGCGCTGTCATCGATTTCTGCCCTGTGAAAATAAGAGCAAGGCAGTGGAG 420 Qy 141 GlnValLysSerAlaPheSerLysLeuGlnGluLysGlyValTyrLysAlaMetSerGlu 160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CAGGTGAAGAGTGCCTTCAGTAAGCTCCAAGAGAAAGGTGTCTACAAAGCCATGAGTGAG 480 Qy 161 PheAspIlePheIleAsnTyrIleGluAlaTyrMetThrThrLysMetLysAsn 178 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 TTTGACATCTTCATCAACTACATAGAAGCCTATATGACAACGAAGATGAAAAAC 534
Read full office action

Prosecution Timeline

Nov 03, 2023
Application Filed
Apr 13, 2026
Non-Final Rejection mailed — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12640251
METHODS OF TREATING DEMENTIA ASSOCIATED WITH ALZHEIMER'S DISEASE WITH PROTECTIVE PROTEIN/CATHEPSIN A (PPCA)
3y 9m to grant Granted May 26, 2026
Patent 12630805
Compositions and Methods of Treatment
3y 2m to grant Granted May 19, 2026
Patent 12612643
RNA-Guided Human Genome Engineering
5y 2m to grant Granted Apr 28, 2026
Patent 12612646
DNA VECTORS AND ELEMENTS FOR SUSTAINED GENE EXPRESSION IN EUKARYOTIC CELLS
2y 10m to grant Granted Apr 28, 2026
Patent 12454689
INTEGRATION OF MESA RECEPTORS AND PROMOTORS TO IMPLEMENT CUSTOMIZED CELLULAR FUNCTION
6y 1m to grant Granted Oct 28, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
38%
Grant Probability
91%
With Interview (+52.8%)
4y 0m (~1y 5m remaining)
Median Time to Grant
Low
PTA Risk
Based on 736 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month