DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Applicant’s amendment filed on 07/10/2026 has been entered.
Amended claims 1-2, 5-8, 10-11, 13, 15-21, 24 and 32 are pending in the present application.
Applicant elected previously with traverse of Group I, which is drawn to a composition for treating ocular disease in equines.
Applicant also elected the following species with traverse: (i) AAV8 as a species of an AAV vector; (ii) a buffer as a species of a further component in the composition; (iii) dexamethasone as a species of a steroid; (iv) flunixin meglumine as a species of NSAID; (v) cyclosporin as a species of an immunosuppressant; and (vi) gentamicin as a species of an antibiotic.
Claims 24 and 32 were withdrawn previously from further consideration because they are drawn to a non-elected invention.
Accordingly, amended claims 1-2, 5-8, 10-11, 13 and 15-21 are examined on the merits herein with the above elected species.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Amended claims 1-2, 5-8, 10-11, 13 and 15-21 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This is a new ground of rejection necessitated by Applicant’s amendment.
In currently amended independent claim 1, it is unclear what is encompassed by the new limitation “wherein the polynucleotide encoding the equine IL-10 polypeptide is at least 80% identical to SEQ ID NO: 1”. This is because prior to this limitation, the claim also recites “a polynucleotide encoding an equine IL-10 polypeptide, or a functional derivative or variant thereof”. Accordingly, it is unclear whether a polynucleotide encoding a functional derivative or variant of an equine IL-10 polypeptide is also required to be at least 80% identical to SEQ ID NO: 1? Clarification is requested because the metes and bounds of the claim are not clearly determined. For prior art purposes, the examiner interprets the new limitation to restrict only a polynucleotide encoding the equine polypeptide to be at least 80% identical to SEQ ID NO: 1, and not a polynucleotide encoding a functional derivative or variant of an equine IL-10 polypeptide.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Amended claims 1, 7-8, 10-11 and 13 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Moss et al (Human Gene Therapy 31:110-118, published on line 21 Jan 2020) and evidenced by Cell Signaling Technology Product Sheet (2013). This is a modified rejection necessitated by Applicant’s amendment.
The instant claims are drawn to a composition for treating ocular disease in equines (an intended use) comprising: an adeno-associated virus (AAV) vector comprising a polynucleotide encoding an equine IL-10 polypeptide, or a functional derivative or variant thereof; wherein the polynucleotide encoding the equine IL-10 polypeptide is at least 80% identical to SEQ ID NO:1; and a pharmaceutically acceptable carrier and/or excipient; wherein the composition is suitable for ocular administration to an equid. Please note that amended claims still encompass a recombinant AAV vector comprising a polynucleotide encoding a functional derivative or variant of an equine IL-10 polypeptide, wherein such polynucleotide is not required to be at least 80% identical to SEQ ID NO: 1 since the claims recite clearly and specifically the limitation “wherein the polynucleotide encoding the equine IL-10 polypeptide is at least 80% identical to SEQ ID NO: 1”.
Moss et al already disclosed a composition comprising 1x1012 viral genomes of a recombinant self-complementary AAV5-IL-10 comprising a full-length equine IL-10 cDNA in 3 mL of sterile PBS (phosphate-buffered saline) for injection into each middle carpal joint of a horse (Abstract; particularly right column, sections titled “Adeno-associated viral vector production” and “Intra-articular injections” at page 111). A sterile PBS has a pH within the recited range of from a about 4.0 to about 8.0 in claim 13 as evidenced by the Cell Signaling Technology Product Sheet for a sterile PBS at pH 7.2. Moss et al found a sustained interleukin-10 transgene expression, and they stated “This study demonstrates the feasibility and efficiency of intra-articular AAV5-IL-10, and future studies investigating the chondroprotective effects of IL-10 in inflamed joints in vivo are warranted” (last sentence of the Abstract). The full-length equine IL-10 cDNA that is taught by Moss et al can be considered a polynucleotide encoding a functional derivative or variant of an equine IL-10 polypeptide of the present application, and such polynucleotide is not required to be at least 80% identical to SEQ ID NO: 1 as encompassed by the instant claims.
Since the composition of Moss et al has the same two components namely: a recombinant AAV vector and a pharmaceutically acceptable carrier (sterile PBS) of the claimed composition, and therefore it is also suitable for ocular administration into an equine. Please note that the patentability of composition claims depends on the claimed structure, not on the use or purpose of the structure; and stating an intended use is not sufficient to structurally distinguish from the prior art. Thus, the teachings of Moss et al meet every limitation of the instant claims.
Accordingly, the reference anticipates the instant claims.
Response to Arguments
Applicant’s arguments related to the above modified 102(a)(1) rejection in the Amendment filed on 07/10/2026 (pages 6-7) have been fully considered, but they are respectfully not found persuasive for the reasons discussed below.
Applicant argued basically that Moss has provided no teachings on injection into any ocular tissue, any ocular pharmacology, biodistribution or toxicity assessment. Applicant also argued that the limitation “wherein the composition is suitable for ocular administration to an equid” is not merely a statement of an intended use, rather it is a limitation that constrains the structural and formulation characteristics of the composition itself; and the Examiner has provided no evidence that Moss’s intraarticular PBS formulation satisfies the requirements for ocular administration to equines. Moreover, amended claim 1 now requires that the polynucleotide encoding equine IL-10 be at least 80% identical to SEQ ID NO: 1, while Moss used an equine IL-10 cDNA derived from a liver sample referenced to GenBank accession number U38200.1, which is the native, non-codon-optimized equine IL-10 sequence that does not meet the limitation “at least 80% identical to SEQ ID NO: 1” as now claimed.
First, once again the composition of Moss et al has the same two components namely: a recombinant AAV vector and a pharmaceutically acceptable carrier (sterile PBS) of the claimed composition, and therefore it is also suitable for ocular administration into an equine. Please note that the patentability of composition claims depends on the claimed structure, not on the use or purpose of the structure; and stating an intended use is not sufficient to structurally distinguish from the prior art. Moreover, there is no factual evidence of record indicating or suggesting that the composition of Moss et al is not suitable for ocular administration to an equid.
Second, the full-length equine IL-10 cDNA that is taught by Moss et al can be considered a polynucleotide encoding a functional derivative or variant of an equine IL-10 polypeptide of the present application, and such polynucleotide is not required to be at least 80% identical to SEQ ID NO: 1 because amended independent claim 1 merely recites specifically “wherein the polynucleotide encoding the equine IL-10 polypeptide is at least 80% identical to SEQ ID NO: 1”.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Amended claims 1, 7-8, 10-11, 13 and 21 are rejected under 35 U.S.C. 103 as being unpatentable over Scaria et al (WO 2015/168666) in view of Moss et al (Human Gene Therapy 31:110-118, published on line 21 Jan 2020). This is a modified rejection necessitated by Applicant’s amendment.
The instant claims are drawn to a composition for treating ocular disease in equines (an intended use) comprising: an adeno-associated virus (AAV) vector comprising a polynucleotide encoding an equine IL-10 polypeptide, or a functional derivative or variant thereof; wherein the polynucleotide encoding the equine IL-10 polypeptide is at least 80% identical to SEQ ID NO:1; and a pharmaceutically acceptable carrier and/or excipient; wherein the composition is suitable for ocular administration to an equid. Please note that amended claims still encompass a recombinant AAV vector comprising a polynucleotide encoding a functional derivative or variant of an equine IL-10 polypeptide, wherein such polynucleotide is not required to be at least 80% identical to SEQ ID NO: 1 since the claims recite clearly and specifically the limitation “wherein the polynucleotide encoding the equine IL-10 polypeptide is at least 80% identical to SEQ ID NO: 1”.
Scaria et al already disclosed at least a composition comprising an improved rAAV (e.g., rAAV2, rAAV8, rAAVrh8R and others) for enhanced gene therapy of ocular disorders (e.g., age related macular degeneration, intraocular inflammation, glaucoma, and posterior uveitis), wherein the rAAV comprise one or more substitutions of amino acids that interact with heparan sulfate proteoglycan (e.g., reducing or ablating binding to HSPG), and a heterologous nucleic acid encoding a therapeutic polypeptide that includes anti-inflammatory factors such as IL10, IL1-ra, TGFβ and IL4 (see at least Abstract; Brief Summary of the Invention; particular paragraphs [0008]-[0013], [0019], [0070], [0106], [0127], [0169]). Scaria et al also taught that the dose of viral particles administered (e.g., subretinal and/or intravitreal administration) to an individual (e.g., human, horses, cats, dogs and others) is at least about 1x108 to about 1x1013 genome copies/kg of body weight (paragraphs [0127] and [0206]); and the volume of the composition injected to the subretinal space of the retina is any amount between 1uL to 1mL (paragraph [0204]). Moreover, Scaria et al taught the composition comprising the rAAV particles and a buffer and/or a pharmaceutically acceptable excipient (paragraphs [0070], [0197] and [0201]), and a kit containing rAAV particles or compositions containing rAAV particles (paragraph [0106]). Scaria et al also stated explicitly “[t]hese compositions can be combined with pharmaceutically vehicles such as saline, Ringer’s balanced salt solution (pH 7.4), and the like” (paragraph [0197]). Scaria et al further disclosed that the disclosed compositions can be used either alone or in combination with one or more additional therapeutic agents for treating ocular disorders, and the one or more additional therapeutic agents include polypeptide neurotrophic factors (e.g., GDNF, CNTF, BDNF), and anti-angiogenic nucleic acids (e.g., siRNA, miRNA, ribozymes) against VEGF (paragraph [0220]).
Scaria et al did not teach specifically an improved rAAV particle comprising a polynucleotide encoding a functional derivative or variant of an equine IL-10 polypeptide for treating an individual that includes an equine/horse.
Before the effective filing date of the present application (05/03/2021), Moss et al already disclosed a composition comprising 1x1012 viral genomes of a recombinant self-complementary AAV5-IL-10 comprising a full-length equine IL-10 cDNA in 3 mL of sterile PBS (phosphate-buffered saline) for injection into each middle carpal joint of a horse (Abstract; particularly right column, sections titled “Adeno-associated viral vector production” and “Intra-articular injections” at page 111). Moss et al also stated “This study demonstrates the feasibility and efficiency of intra-articular AAV5-IL-10, and future studies investigating the chondroprotective effects of IL-10 in inflamed joints in vivo are warranted” (last sentence of the Abstract). The full-length equine IL-10 cDNA that is taught by Moss et al can be considered a polynucleotide encoding a functional derivative or variant of an equine IL-10 polypeptide of the present application, and such polynucleotide is not required to be at least 80% identical to SEQ ID NO: 1 as encompassed by the instant claims.
Accordingly, it would have been obvious for an ordinary skill in the art to modify the composition of Scaria et al by also selecting a full-length equine IL-10 cDNA of Moss et al as a heterologous nucleic acid encoding the therapeutic anti-inflammatory factor IL-10 in the form of an improved rAAV particle for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis in an individual that includes an equine/horse.
An ordinary skilled artisan would have been motivated to carry out the above modification because Moss et al already disclosed successfully a composition comprising 1x1012 viral genomes of a recombinant self-complementary AAV5-IL-10 comprising a full-length equine IL-10 cDNA in 3 mL of sterile PBS (phosphate-buffered saline) for injection into each middle carpal joint of a horse, that resulted in a sustained interleukin-10 transgene expression; and concluded that future studies investigating the chondroprotective effects of IL-10 in inflamed joints in vivo are warranted. With respect to dependent claim 21 reciting a kit comprising at least one container, it would also have been obvious that the modified kit must contain at least a container containing at least the modified rAAV particles, particularly Scaria et al already taught specifically a kit containing rAAV particles or compositions containing rAAV particles.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Scaria et al and Moss et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of Scaria et al and Moss et al as set forth above is indistinguishable and encompassed by the presently claimed composition.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Response to Arguments
Applicant’s arguments related to the above modified 103 rejection in the Amendment filed on 07/10/2026 (pages 7-8) have been fully considered, but they are respectfully not found persuasive for the reasons discussed below.
Applicant argued basically that the central inventive contribution of Scaria is a structurally engineered rAAV capsid comprising one or more amino acid substitutions at positions that interact with heparan sulfate proteoglycan (HSPG), which reduce or ablate HSPG binding to achieve enhanced retinal transduction; however, the pending claims do not require HSPG-modified capsids. Applicant also argued that the Examiner does not explain why a person of ordinary skill would have extracted certain disclosures (e.g., therapeutic payloads and subject species) from Scaria while disregarding the structural features that Scaria identifies as central to achieving its therapeutic construct. Additionally, Applicant argued that Scaria does not specifically teach AAV-mediated ocular delivery of equine IL-10 to equines, while Scaria broadly lists IL-10 among numerous possible therapeutic payloads, and horses among numerous possible subject species, the combination of equine-specific IL-10, ocular delivery, and an equine subject is not exemplified, specifically suggested, or taught by Scaria; and that arriving at this combination is an example of impermissible hindsight reconstruction of the claimed invention. Moreover, Applicant argued that Moss does not supply the missing ocular delivery teaching because Moss was an intraarticular osteoarthritis study and not an ophthalmic application.
First, please note that at least dependent claim 7 recites the limitation “wherein the AAV vector is at least one of an AAV serotype 1…..an AAV serotype 8 (AAV8) vector, an AAV serotype 9 (AAV9) vector, or a derivative or variant thereof”. Thus, the instant claims encompass an AAV vector with an engineered rAAV capsid taught by Scaria et al.
Second, Scaria et al already disclosed at least a composition comprising an improved rAAV (e.g., rAAV2, rAAV8, rAAVrh8R and others) for enhanced gene therapy of ocular disorders (e.g., age related macular degeneration, intraocular inflammation, glaucoma, and posterior uveitis), wherein the rAAV comprise one or more substitutions of amino acids that interact with heparan sulfate proteoglycan (e.g., reducing or ablating binding to HSPG), and a heterologous nucleic acid encoding a therapeutic polypeptide that includes anti-inflammatory factors such as IL10, IL1-ra, TGFβ and IL4 (see at least Abstract; Brief Summary of the Invention; particular paragraphs [0008]-[0013], [0019], [0070], [0106], [0127], [0169]).
Third, with respect to Applicant’s argument on impermissible hindsight reconstruction Examiner would like to recite a paragraph from in re Oetiker, 977, F.2d 1443, 1448 (Fed. Cir. 1992).
"[T]here must be some teaching, reason, suggestion, or motivation found "in the prior art" or "in the prior art references" to make a combination to render an invention obvious within the meaning of 35 U.S.C. 103 (1998). Similar language appears in a number of opinions and if taken literally would mean that an invention cannot be held to have been obvious unless something specific in a prior art reference would lead an inventor to combine the teachings therein with another piece of prior art. This restrictive understanding of the concept of obviousness is clearly wrong…. While there must be some teaching, reason, suggestion, or motivation to combine existing elements to produce the claimed device, it is not necessary that the cited references or prior art specifically suggest making the combination…. In sum, it is off the mark for litigants to argue, as many do, that an invention cannot be held to have been obvious unless a suggestion to combine the prior art teachings is found in a specific reference."
Although the cited artisans do not specifically point out a motivation to in their disclosure, an ordinarily skilled artisan would have been able to identify the need for the combination of the teachings without the disclosure of the instant application. It must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Please refer to the above modified 103 rejection for details along with the provided motivations for combining the cited references.
Fourth, once again it would have been obvious for an ordinary skill in the art to modify the composition of Scaria et al by also selecting a full-length equine IL-10 cDNA of Moss et al as a heterologous nucleic acid encoding the therapeutic anti-inflammatory factor IL-10 in the form of an improved rAAV particle for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis in an individual that includes an equine/horse because Moss et al already disclosed successfully a composition comprising 1x1012 viral genomes of a recombinant self-complementary AAV5-IL-10 comprising a full-length equine IL-10 cDNA in 3 mL of sterile PBS (phosphate-buffered saline) for injection into each middle carpal joint of a horse, that resulted in a sustained interleukin-10 transgene expression to treat an inflamed joint. The full-length equine IL-10 cDNA that is taught by Moss et al can be considered a polynucleotide encoding a functional derivative or variant of an equine IL-10 polypeptide of the present application, and such polynucleotide is not required to be at least 80% identical to SEQ ID NO: 1 as encompassed by the instant claims because amended independent claim 1 merely recites specifically “wherein the polynucleotide encoding the equine IL-10 polypeptide is at least 80% identical to SEQ ID NO: 1”.
Claims 2 and 5-6 are rejected under 35 U.S.C. 103 as being unpatentable over Scaria et al (WO 2015/168666) in view of Moss et al (Human Gene Therapy 31:110-118, published on line 21 Jan 2020) as applied to claims 1, 7-8, 10-11, 13 and 21 above, and further in view of Fisher (US 7,846,428).
The combined teachings of Scaria et al and Moss et al were presented above. However, none of the cited references teach specifically that the encoded functional derivative or variant of an equine IL-10 polypeptide comprising a polypeptide having at least 85% identical to SEQ ID NO: 2 of the present application; or the polynucleotide encoding a functional derivative or variant of an equine IL-10 polypeptide is codon optimized.
Before the effective filing date of the present application (05/03/2021), Fisher already taught at least using a viral vector encoding and capable of expressing equine IL-10 for the treatment of OA in addition to a viral vector encoding and capable of expressing an equine pre-proBMP-7, a equine proBMP-7, or a equine BMP-7 mature polypeptide, wherein the nucleotide sequence encoding the equine IL-10 of SEQ ID NO: 60 (100% identical to SEQ ID NO: 2 of the present application) is SEQ ID NO: 59 that exhibits 75.4% identical to SEQ ID NO: 1 of the present application (col. 28, lines 15-27; col.29, line 65 continues to line 4 at column 30; col. 30, lines 11-16; SEQ ID NOs. 59-60; and attached sequence searches below). Additionally, Fisher also taught that codon preference among different species can be dramatically different, and to enhance the expression level of a foreign protein, it is relevant to match the codon frequency of the foreign protein to the one of the host expression system; and the nucleotide sequences are codon optimized using GeneOptimizer (col. 16, line 55 continues to line 16 at col. 17).
Accordingly, it would have been obvious for an ordinary skill in the art to further modify the combined teachings of Scaria et al and Moss et al by also selecting the nucleotide sequence encoding the full-length equine IL-10 polypeptide set forth in SEQ ID NO: 59 as a heterologous nucleic acid encoding a functional derivative or variant of equine IL-10, as well as codon-optimizing such heterologous nucleic acid sequence for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis in an individual that includes an equine/horse, in light of the teachings of Fisher as set forth above.
An ordinary skilled artisan would have been motivated to further carry out the above modifications because Fisher already taught using a viral vector encoding and capable of expressing equine IL-10 for the treatment of OA, wherein the nucleotide sequence encoding the equine IL-10 of SEQ ID NO: 60 (100% identical to SEQ ID NO: 2 of the present application) is SEQ ID NO: 59 that exhibits 75.4% identical to SEQ ID NO: 1 of the present application. Additionally, Fisher also taught that codon-optimization is used to enhance expression of a foreign protein, and in this instance the nucleotide sequence encoding equine IL-10.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Scaria et al, Moss et al and Fisher; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of Scaria et al, Moss et al and Fisher as set forth above is indistinguishable and encompassed by the presently claimed composition.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Response to Arguments
Applicant’s arguments related to the above modified 103 rejection in the Amendment filed on 07/10/2026 (pages 8 and 10-11) have been fully considered, but they are respectfully not found persuasive for the reasons discussed below.
Applicant argued basically that the patentability of dependent claims 2 and 5-6 stands or falls with claim 1 for the reasons already discussed in the rejection of claims 1, 7-8, 10-11, 13 and 21 above. Moreover, Applicant argued that amended independent claim 1 now requires that the polynucleotide encoding the equine IL-10 polypeptide be at least 80% identical to SEQ ID NO: 1 of the present application; and the closest prior art is Fisher’s SEQ ID NO: 59 which is only 75.4% identical to Applicant’s SEQ ID NO: 1. Furthermore, Applicant argued that 80% threshold of the amended claim reflects a meaningful structural difference between the prior art and the claimed invention.
First, once again the instant claims are drawn to a composition for treating ocular disease in equines (an intended use) comprising: an adeno-associated virus (AAV) vector comprising a polynucleotide encoding an equine IL-10 polypeptide, or a functional derivative or variant thereof; wherein the polynucleotide encoding the equine IL-10 polypeptide is at least 80% identical to SEQ ID NO:1; and a pharmaceutically acceptable carrier and/or excipient; wherein the composition is suitable for ocular administration to an equid. Please note that amended claims still encompass a recombinant AAV vector comprising a polynucleotide encoding a functional derivative or variant of an equine IL-10 polypeptide, wherein such polynucleotide is not required to be at least 80% identical to SEQ ID NO: 1 since the claims recite clearly and specifically the limitation “wherein the polynucleotide encoding the equine IL-10 polypeptide is at least 80% identical to SEQ ID NO: 1”. Accordingly, the nucleotide sequence encoding the full-length equine IL-10 polypeptide set forth in SEQ ID NO: 59 of Fisher et al can also be considered as a heterologous nucleic acid encoding a functional derivative or variant of equine IL-10; and such polynucleotide is not required to be at least 80% identical to SEQ ID NO: 1 as encompassed by the instant claims.
Second, please also refer to the Examiner’s same responses to Applicant’s arguments on the rejection of claims 1, 7-8, 10-11, 13 and 21 above.
Claims 15-19 are rejected under 35 U.S.C. 103 as being unpatentable over Scaria et al (WO 2015/168666) in view of Moss et al (Human Gene Therapy 31:110-118, published on line 21 Jan 2020) as applied to claims 1, 7-8, 10-11, 13 and 21 above, and further in view of Mach et al (WO 2005/009755), Ronald et al (WO 2014/052640) and Sallam et al (Med Hypothesis Discov Innov Ophthalmol 7:140-155, 2018).
The combined teachings of Scaria et al and Moss et al were presented above. However, none of the cited references teach specifically that the composition further comprising a biological active agent that is selected from the group consisting of an immunosuppressant (cyclosporin as the elected species), an NSAID (flunixin meglumine as the elected species), a steroid (dexamethasone as the elected species), an antibiotic (gentamicin as the elected species), and any combination thereof.
Before the effective filing date of the present application (05/03/2021), Mach et al already taught to inhibit inflammation in an inflammatory disorder (e.g., ocular inflammation such as uveitis) in a mammal (e.g., human, horse, dog, cat, cow) using CD3 modulators alone or in conjunction with one or more additional therapeutic compound such as an anti-inflammatory agent or immunosuppressive agent that are not limited to methotrexate, Cyclosporin A, corticosteroids, statins, interferon beta, nonsteroidal anti-inflammatory drugs (NSAIDs) and the disease-modifying anti-rheumatic drugs (Abstract; Summary of the Invention; particularly page 4, lines 25-29; page 8, line 29 continues to line 9 at page 9; page 10, lines 6-20; page 14, lines 18-31). Mach et al stated explicitly “The beneficial effect of the combination includes, but is not limited to, pharmacokinetic or pharmacodynamic co-action resulting from the combination of therapeutic agents” (lines 28-30 at page 14). As an example for the treatment of uveitis, anti-CD3 antibodies can be administered in conjunction for example with corticosteroids, methotrexate, Cyclosporin A, Cyclophosphamide and/or statin (lines 3-7 at page 16); while for the treatment of multiple sclerosis a combination of anti-CD3 with for example Glatiramer acetate, Interferon beta-1a, Interferon beta-1a, Interferon beta 1-b, Mitoxantrone, Dexamethasone, Methylprednisolone and/or Prednisone and/or statins (lines 11-14 at page 16).
Additionally, Ronald et al also taught the use of a suitable AMPK agonist alone or in combination with other suitable agents such as corticosteroids (e.g., methylprednisolone acetate, dexamethasone and the like), and non-steroidal anti-inflammatory agents (NSAIDs) (e.g., naproxen, ibuprofen, flunixin meglumine, and the like) to treat inflammation due to disease or injury in a human or animal (e.g., man, horses, dogs, cats and others) such as osteoarthritis and ocular inflammation such as uveitis, scleritis and iritis (Abstract; particularly first paragraph at page 18; last sentence at page 21; last paragraph at page 26 continues to first paragraph at page 27).
Moreover, Sallam et al already reviewed antimicrobial therapy for infectious uveitis of the posterior segment, including the commonly used intravitreal antimicrobial drugs such as gentamycin, amikacin, vancomycin and moxifloxacin (Abstract; particularly right column, first full paragraph; section titled “Intravitreal Amikacin and Gentamicin” at page 144; and Table 1 at page 150).
Accordingly, it would have been obvious for an ordinary skill in the art to further modify the combined teachings of Scaria et al and Moss et al by also further including additional biological active agents such as a dexamethasone (a steroid), flunixin meglumine (a NSAID), Cyclosporin A (an immunosuppressant) and/or gentamicin (an antibiotic) in the composition for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis (e.g., an infectious posterior uveitis) in an individual that includes an equine/horse, in light of the teachings of Mach et al, Ronald et al and Sallam et al as set forth above.
An ordinary skilled artisan would have been motivated to further carry out the above modifications because: (i) Mach et al already taught to inhibit inflammation in an inflammatory disorder (e.g., ocular inflammation such as uveitis) in a mammal (e.g., human, horse, dog, cat, cow) using CD3 modulators alone or in conjunction with one or more additional therapeutic compound such as an anti-inflammatory agent or immunosuppressive agent that are not limited to methotrexate, Cyclosporin A, corticosteroids, statins, interferon beta, nonsteroidal anti-inflammatory drugs (NSAIDs) and the disease-modifying anti-rheumatic drugs; (ii) Ronald et al also taught the use of a suitable AMPK agonist alone or in combination with other suitable agents such as corticosteroids (e.g., methylprednisolone acetate, dexamethasone and the like), and non-steroidal anti-inflammatory agents (NSAIDs) (e.g., naproxen, ibuprofen, flunixin meglumine, and the like) to treat inflammation due to disease or injury in a human or animal (e.g., man, horses, dogs, cats and others) such as osteoarthritis and ocular inflammation such as uveitis, scleritis and iritis; and (iii) Sallam et al also disclosed the commonly used intravitreal antimicrobial drugs such as gentamycin, amikacin, vancomycin and moxifloxacin for treating infectious posterior uveitis.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Scaria et al, Moss et al, Mach et al, Ronald et al and Sallam et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of Scaria et al, Moss et al, Mach et al, Ronald et al and Sallam et al as set forth above is indistinguishable and encompassed by the presently claimed composition.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Response to Arguments
Applicant’s arguments related to the above modified 103 rejection in the Amendment filed on 07/10/2026 (page 9) have been fully considered, but they are respectfully not found persuasive for the reasons discussed below.
Applicant argued basically that the patentability of claims 15-19 depends on the patentability of amended independent claim 1 for the reasons set forth above. Additionally, Applicant argued that the Examiner has relied on at least five references to supply separate pieces of the claimed compositions, but has not articulated a reason, grounded in the knowledge of a person of ordinary skill at the relevant time, and why those teachings would have been selected and combined in the manner claimed.
First, please refer to the Examiner’s same responses to Applicant’s arguments on the rejection of claims 1, 7-8, 10-11, 13 and 21 above.
Second, in response to applicant's argument that the examiner has combined an excessive number of references, for example 5 references, reliance on a large number of references in a rejection does not, without more, weigh against the obviousness of the claimed invention. See In re Gorman, 933 F.2d 982, 18 USPQ2d 1885 (Fed. Cir. 1991).
Third, please refer to the above 103 rejection for details along with the motivations provided for combining the cited references. Mach et al, Ronald et al and Sallam et al were cited to supplement the combined teachings of Scaria et al and Moss et al for the limitations recited in dependent claims 15-19.
Claim 20 is rejected under 35 U.S.C. 103 as being unpatentable over Scaria et al (WO 2015/168666) in view of Moss et al (Human Gene Therapy 31:110-118, published on line 21 Jan 2020) as applied to claims 1, 7-8, 10-11, 13 and 21 above, and further in view of Fang et al (WO 2005/017149).
The combined teachings of Scaria et al and Moss et al were presented above. However, none of the cited references teach specifically that AAV vector further comprising a polynucleotide encoding TGFβ or IL-1 receptor antagonist (IL1-ra).
Before the effective filing date of the present application (05/03/2021), Fang et al already taught a recombinant vector or construct for expression of two or more recombinant proteins or polypeptides from a single open reading frame using a self-processing peptide which facilitates efficient expression and generation of individual proteins or polypeptides, wherein the recombinant vector includes an adeno-associated virus (AAV), a lentivirus vector or a retrovirus vector (Abstract; and Summary of the Invention). Fang et al also taught that at least the two recombinant proteins include a cytokine such as IL-10 and a growth factor TGF-beta (line 17 at page 23 continues to line 5 at page 25).
Accordingly, it would have been obvious for an ordinary skill in the art to further modify the combined teachings of Scaria et al and Moss et al by also further including a polynucleotide encoding another anti-inflammatory factor such as TGF-beta or IL1-ra into the recombinant AAV vector for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis in an individual that includes an equine/horse, in light of the teachings of Fang et al as set forth above.
An ordinary skilled artisan would have been motivated to further carry out the above modification because Fang et al already taught successfully a recombinant vector or construct for expression of two or more recombinant proteins or polypeptides from a single open reading frame using a self-processing peptide which facilitates efficient expression and generation of individual proteins or polypeptides, wherein the recombinant vector includes an adeno-associated virus (AAV). Particularly, the primary Scaria et al already taught that a heterologous nucleic acid encoding a therapeutic polypeptide that includes anti-inflammatory factors such as IL10, IL1-ra, TGFβ and IL4 which are useful for treating ocular inflammation and/or posterior uveitis.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Scaria et al, Moss et al and Fang et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of Scaria et al, Moss et al and Fang et al as set forth above is indistinguishable and encompassed by the presently claimed composition.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Response to Arguments
Applicant’s arguments related to the above modified 103 rejection in the Amendment filed on 07/10/2026 (page 9) have been fully considered, but they are respectfully not found persuasive for the reasons discussed below.
Applicant argued basically that the patentability of claim 20 depends on the patentability of amended independent claim 1 for the reasons set forth above.
Once again, please refer to the Examiner’s same responses to Applicant’s arguments on the rejection of claims 1, 7-8, 10-11, 13 and 21 above. The Fang reference was cited to supplement the combined teachings of Scaria et al and Moss et al for the limitation recited in dependent claim 20.
Amended claims 1, 7-8, 10-11, 13 and 21 are also rejected under 35 U.S.C. 103 as being unpatentable over Scaria et al (WO 2015/168666) in view of Fotin-Mleczek et al (US 10,293,058). This is a new ground of rejection necessitated by Applicant’s amendment.
Scaria et al already disclosed at least a composition comprising an improved rAAV (e.g., rAAV2, rAAV8, rAAVrh8R and others) for enhanced gene therapy of ocular disorders (e.g., age related macular degeneration, intraocular inflammation, glaucoma, and posterior uveitis), wherein the rAAV comprise one or more substitutions of amino acids that interact with heparan sulfate proteoglycan (e.g., reducing or ablating binding to HSPG), and a heterologous nucleic acid encoding a therapeutic polypeptide that includes anti-inflammatory factors such as IL10, IL1-ra, TGFβ and IL4 (see at least Abstract; Brief Summary of the Invention; particular paragraphs [0008]-[0013], [0019], [0070], [0106], [0127], [0169]). Scaria et al also taught that the dose of viral particles administered (e.g., subretinal and/or intravitreal administration) to an individual (e.g., human, horses, cats, dogs and others) is at least about 1x108 to about 1x1013 genome copies/kg of body weight (paragraphs [0127] and [0206]); and the volume of the composition injected to the subretinal space of the retina is any amount between 1uL to 1mL (paragraph [0204]). Moreover, Scaria et al taught the composition comprising the rAAV particles and a buffer and/or a pharmaceutically acceptable excipient (paragraphs [0070], [0197] and [0201]), and a kit containing rAAV particles or compositions containing rAAV particles (paragraph [0106]). Scaria et al also stated explicitly “[t]hese compositions can be combined with pharmaceutically vehicles such as saline, Ringer’s balanced salt solution (pH 7.4), and the like” (paragraph [0197]). Scaria et al further disclosed that the disclosed compositions can be used either alone or in combination with one or more additional therapeutic agents for treating ocular disorders, and the one or more additional therapeutic agents include polypeptide neurotrophic factors (e.g., GDNF, CNTF, BDNF), and anti-angiogenic nucleic acids (e.g., siRNA, miRNA, ribozymes) against VEGF (paragraph [0220]).
Scaria et al did not teach specifically an improved rAAV particle comprising a polynucleotide encoding an equine IL-10 polypeptide, wherein the polynucleotide encoding the equine IL-10 is at least 80% identical to SEQ ID NO: 1 for treating an individual that includes an equine/horse.
Before the effective filing date of the present application (05/03/2021), Fotin-Mleczek et al already disclosed an optimized RNA sequence of SEQ ID NO: 4174 that encodes the IL-10 cytokine, wherein the optimized RNA sequence of SEQ ID NO: 4174 is already 79.9% (80%) identical to the codon-optimized equine IL-10 DNA polynucleotide of SEQ ID NO: 1 of the present application (see at least col. 17, lines 29-36; Table 1; and attached sequence search below).
Accordingly, it would have been obvious for an ordinary skill in the art to modify the composition of Scaria et al by also selecting a IL-10 DNA sequence that encodes the optimized RNA sequence of SEQ ID NO: 4174 of Fotin-Mleczek et al (replacement of 76 Us with Ts) as a heterologous nucleic acid encoding the therapeutic anti-inflammatory factor IL-10 in the form of an improved rAAV particle for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis in an individual that includes an equine/horse.
An ordinary skilled artisan would have been motivated to carry out the above modification because Fotin-Mleczek et al already disclosed an optimized RNA sequence of SEQ ID NO: 4174 that encodes the IL-10 cytokine, wherein the optimized RNA sequence of SEQ ID NO: 4174 is already 79.9% (80%) identical to the codon-optimized equine IL-10 DNA polynucleotide of SEQ ID NO: 1 of the present application, let alone replacement of all 76 Us with Ts in SEQ ID NO: 4174 for a DNA molecule. With respect to dependent claim 21 reciting a kit comprising at least one container, it would also have been obvious that the modified kit must contain at least a container containing at least the modified rAAV particles, particularly Scaria et al already taught specifically a kit containing rAAV particles or compositions containing rAAV particles.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Scaria et al and Fotin-Mleczek et al et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of Scaria et al and Fotin-Mleczek et al et al as set forth above is indistinguishable and encompassed by the presently claimed composition.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Claims 15-19 are rejected under 35 U.S.C. 103 as being unpatentable over Scaria et al (WO 2015/168666) in view of Fotin-Mleczek et al (US 10,293,058) as applied to claims 1, 7-8, 10-11, 13 and 21 above, and further in view of Mach et al (WO 2005/009755), Ronald et al (WO 2014/052640) and Sallam et al (Med Hypothesis Discov Innov Ophthalmol 7:140-155, 2018).
The combined teachings of Scaria et al and Fotin-Mleczek et al were presented above. However, none of the cited references teach specifically that the composition further comprising a biological active agent that is selected from the group consisting of an immunosuppressant (cyclosporin as the elected species), an NSAID (flunixin meglumine as the elected species), a steroid (dexamethasone as the elected species), an antibiotic (gentamicin as the elected species), and any combination thereof.
Before the effective filing date of the present application (05/03/2021), Mach et al already taught to inhibit inflammation in an inflammatory disorder (e.g., ocular inflammation such as uveitis) in a mammal (e.g., human, horse, dog, cat, cow) using CD3 modulators alone or in conjunction with one or more additional therapeutic compound such as an anti-inflammatory agent or immunosuppressive agent that are not limited to methotrexate, Cyclosporin A, corticosteroids, statins, interferon beta, nonsteroidal anti-inflammatory drugs (NSAIDs) and the disease-modifying anti-rheumatic drugs (Abstract; Summary of the Invention; particularly page 4, lines 25-29; page 8, line 29 continues to line 9 at page 9; page 10, lines 6-20; page 14, lines 18-31). Mach et al stated explicitly “The beneficial effect of the combination includes, but is not limited to, pharmacokinetic or pharmacodynamic co-action resulting from the combination of therapeutic agents” (lines 28-30 at page 14). As an example for the treatment of uveitis, anti-CD3 antibodies can be administered in conjunction for example with corticosteroids, methotrexate, Cyclosporin A, Cyclophosphamide and/or statin (lines 3-7 at page 16); while for the treatment of multiple sclerosis a combination of anti-CD3 with for example Glatiramer acetate, Interferon beta-1a, Interferon beta-1a, Interferon beta 1-b, Mitoxantrone, Dexamethasone, Methylprednisolone and/or Prednisone and/or statins (lines 11-14 at page 16).
Additionally, Ronald et al also taught the use of a suitable AMPK agonist alone or in combination with other suitable agents such as corticosteroids (e.g., methylprednisolone acetate, dexamethasone and the like), and non-steroidal anti-inflammatory agents (NSAIDs) (e.g., naproxen, ibuprofen, flunixin meglumine, and the like) to treat inflammation due to disease or injury in a human or animal (e.g., man, horses, dogs, cats and others) such as osteoarthritis and ocular inflammation such as uveitis, scleritis and iritis (Abstract; particularly first paragraph at page 18; last sentence at page 21; last paragraph at page 26 continues to first paragraph at page 27).
Moreover, Sallam et al already reviewed antimicrobial therapy for infectious uveitis of the posterior segment, including the commonly used intravitreal antimicrobial drugs such as gentamycin, amikacin, vancomycin and moxifloxacin (Abstract; particularly right column, first full paragraph; section titled “Intravitreal Amikacin and Gentamicin” at page 144; and Table 1 at page 150).
Accordingly, it would have been obvious for an ordinary skill in the art to further modify the combined teachings of Scaria et al and Fotin-Mleczek et al by also further including additional biological active agents such as a dexamethasone (a steroid), flunixin meglumine (a NSAID), Cyclosporin A (an immunosuppressant) and/or gentamicin (an antibiotic) in the composition for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis (e.g., an infectious posterior uveitis) in an individual that includes an equine/horse, in light of the teachings of Mach et al, Ronald et al and Sallam et al as set forth above.
An ordinary skilled artisan would have been motivated to further carry out the above modifications because: (i) Mach et al already taught to inhibit inflammation in an inflammatory disorder (e.g., ocular inflammation such as uveitis) in a mammal (e.g., human, horse, dog, cat, cow) using CD3 modulators alone or in conjunction with one or more additional therapeutic compound such as an anti-inflammatory agent or immunosuppressive agent that are not limited to methotrexate, Cyclosporin A, corticosteroids, statins, interferon beta, nonsteroidal anti-inflammatory drugs (NSAIDs) and the disease-modifying anti-rheumatic drugs; (ii) Ronald et al also taught the use of a suitable AMPK agonist alone or in combination with other suitable agents such as corticosteroids (e.g., methylprednisolone acetate, dexamethasone and the like), and non-steroidal anti-inflammatory agents (NSAIDs) (e.g., naproxen, ibuprofen, flunixin meglumine, and the like) to treat inflammation due to disease or injury in a human or animal (e.g., man, horses, dogs, cats and others) such as osteoarthritis and ocular inflammation such as uveitis, scleritis and iritis; and (iii) Sallam et al also disclosed the commonly used intravitreal antimicrobial drugs such as gentamycin, amikacin, vancomycin and moxifloxacin for treating infectious posterior uveitis.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Scaria et al, Fotin-Mleczek et al, Mach et al, Ronald et al and Sallam et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of Scaria et al, Fotin-Mleczek et al, Mach et al, Ronald et al and Sallam et al as set forth above is indistinguishable and encompassed by the presently claimed composition.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Claims 2 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Scaria et al (WO 2015/168666) in view of Fotin-Mleczek et al (US 10,293,058) as applied to claims 1, 7-8, 10-11, 13 and 21 above, and further in view of Kim et al ( Gene 199:293-301, 1997) and Fang et al (WO 2005/017149).
The combined teachings of Scaria et al and Fotin-Mleczek et al were presented above. However, none of the cited references teach specifically that the polynucleotide encoding IL-10 is codon-optimized and/or the AAV vector further comprising a polynucleotide encoding TGFβ or IL-1 receptor antagonist (IL1-ra).
Before the effective filing date of the present application (05/03/2021), Kim et al already taught that codon bias has been observed in many species, and the usage of selective codons in a given gene is positively correlated with its expression efficiency (First two sentences in Abstract). Kim et al then demonstrated by exemplification codon optimization for high-level expression of human erythropoietin (EPO) in mammalian cells (Abstract).
Additionally, Fang et al already taught a recombinant vector or construct for expression of two or more recombinant proteins or polypeptides from a single open reading frame using a self-processing peptide which facilitates efficient expression and generation of individual proteins or polypeptides, wherein the recombinant vector includes an adeno-associated virus (AAV), a lentivirus vector or a retrovirus vector (Abstract; and Summary of the Invention). Fang et al also taught that at least the two recombinant proteins include a cytokine such as IL-10 and a growth factor TGF-beta (line 17 at page 23 continues to line 5 at page 25).
Accordingly, it would have been obvious for an ordinary skill in the art to further modify the combined teachings of Scaria et al and Fotin-Mleczek et al by also further codon-optimizing the polynucleotide encoding IL-10, as well as further including a polynucleotide encoding another anti-inflammatory factor such as TGF-beta or IL1-ra into the recombinant AAV vector for treating an ocular disorder such as an intra-ocular inflammation and/or posterior uveitis in an individual that includes an equine/horse, in light of the teachings of Kim et al and Fang et al as set forth above.
An ordinary skilled artisan would have been motivated to further carry out the above modifications because: (i) Kim et al already taught that codon bias has been observed in many species, and the usage of selective codons in a given gene is positively correlated with its expression efficiency; and (ii) Fang et al already taught successfully a recombinant vector or construct for expression of two or more recombinant proteins or polypeptides from a single open reading frame using a self-processing peptide which facilitates efficient expression and generation of individual proteins or polypeptides, wherein the recombinant vector includes an adeno-associated virus (AAV). Particularly, the primary Scaria et al already taught that a heterologous nucleic acid encoding a therapeutic polypeptide that includes anti-inflammatory factors such as IL10, IL1-ra, TGFβ and IL4 which are useful for treating ocular inflammation and/or posterior uveitis.
An ordinary skilled artisan would have a reasonable expectation of success in light of the teachings of Scaria et al, Fotin-Mleczek et al, Kim et al and Fang et al; coupled with a high level of skill for an ordinary skilled artisan in the relevant art.
The modified composition resulting from the combined teachings of Scaria et al, Fotin-Mleczek et al, Kim et al and Fang et al as set forth above is indistinguishable and encompassed by the presently claimed composition.
Therefore, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
1. Fischer et al (BMC Veterinary Research 15:29; doi.org/10.1186/s12917-018-1722-7; 12 pages; 2019) disclosed intravitreal injection of low-dose gentamicin for the treatment of recurrent or persistent uveitis in horses.
2. Scaria et al (US 2017/0096683) disclosed the same AAV vectors for retinal and CNS gene therapy as those described in Scaria et al (WO 2015/168666).
Conclusion
No claim is allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Quang Nguyen, Ph.D., at (571) 272-0776.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s acting SPE, James Douglas (Doug) Schultz, Ph.D., may be reached at (571) 272-0763.
To aid in correlating any papers for this application, all further correspondence regarding this application should be directed to Group Art Unit 1631; Central Fax No. (571) 273-8300.
Any inquiry of a general nature or relating to the status of this application or proceeding should be directed to (571) 272-0547.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll-free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public.
/QUANG NGUYEN/Primary Examiner, Art Unit 1631
Sequence 59,
Patent No. 7846428
Query Match 75.4%; Score 402.8; Length 537;
Best Local Similarity 84.6%;
Matches 452; Conservative 0; Mismatches 82; Indels 0; Gaps 0;
Qy 1 ATGCACAGCTCCGCCCTGCTGTGCTACCTGGTGTTCCTGGCAGGAGTGGGAGCAAGCCGG 60
||||||||||| || ||||| || |||||||| |||||||| || |||||||| |||||
Db 1 ATGCACAGCTCAGCACTGCTATGTTACCTGGTCTTCCTGGCCGGGGTGGGAGCCAGCCGA 60
Qy 61 GACCGCGGCACCCAGAGCGAGAACTCCTGTACCCACTTCCCCACCAGCCTGCCTCACATG 120
||||| ||||||||| |||||| ||| ||||||||||| ||||||||||| ||||||
Db 61 GACCGGGGCACCCAGTCTGAGAACAGCTGCACCCACTTCCCAACCAGCCTGCCCCACATG 120
Qy 121 CTGCACGAGCTGAGGGCAGCCTTCTCCAGGGTGAAGACCTTCTTCCAGATGAAGGACCAG 180
|| || ||||| | || |||||| |||||||||||| ||||| || ||||||||||||
Db 121 CTCCATGAGCTCCGAGCCGCCTTCAGCAGGGTGAAGACTTTCTTTCAAATGAAGGACCAG 180
Qy 181 CTGGACAACATGCTGCTGAACGGCAGCCTGCTGGAGGACTTCAAGGGATACCTGGGATGC 240
|||||||||||| || ||||||| ||||||||||||||| ||||| |||||||| |||
Db 181 CTGGACAACATGTTGTTGAACGGGTCCCTGCTGGAGGACTTTAAGGGTTACCTGGGTTGC 240
Qy 241 CAGGCCCTGTCCGAGATGATCCAGTTCTACCTGGAGGAAGTGATGCCACAGGCCGAGAAC 300
|| ||| |||| |||||||||||||| ||||||||||| |||||||| ||||| ||||||
Db 241 CAAGCCTTGTCGGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAGGCTGAGAAC 300
Qy 301 CACGGCCCCGACATCAAGGAGCACGTGAACTCCCTGGGCGAGAAGCTGAAGACCCTGAGG 360
|||||||| ||||||||||||||||||||||||||||| || |||||||||||||| |
Db 301 CACGGCCCAGACATCAAGGAGCACGTGAACTCCCTGGGGGAAAAGCTGAAGACCCTCCGA 360
Qy 361 GTGAGACTGAGGAGATGCCACAGGTTCCTGCCCTGTGAGAACAAGAGCAAGGCCGTGGAG 420
||||| ||| || | || || | || ||||||||||| || ||||||||||| ||||||
Db 361 GTGAGGCTGCGGCGCTGTCATCGATTTCTGCCCTGTGAAAATAAGAGCAAGGCAGTGGAG 420
Qy 421 CAGGTGAAGAGCGCCTTCTCCAAGCTGCAGGAGAAGGGCGTGTACAAGGCCATGTCCGAG 480
||||||||||| |||||| ||||| || ||||| || || ||||| |||||| |||
Db 421 CAGGTGAAGAGTGCCTTCAGTAAGCTCCAAGAGAAAGGTGTCTACAAAGCCATGAGTGAG 480
Qy 481 TTCGACATCTTCATCAACTACATCGAGGCCTACATGACCACCAAGATGAAGAAC 534
|| |||||||||||||||||||| || ||||| ||||| || |||||||| |||
Db 481 TTTGACATCTTCATCAACTACATAGAAGCCTATATGACAACGAAGATGAAAAAC 534
Sequence 59,
Patent No. 7846428
LENGTH: 537
TYPE: DNA
ORGANISM: Equus caballus
Alignment Scores:
Length: 537
Score: 927.00 Matches: 178
Percent Similarity: 100.0% Conservative: 0
Best Local Similarity: 100.0% Mismatches: 0
Query Match: 100.0% Indels: 0
Gaps: 0
US-18-558-919-2 (1-178) x US-11-867-919B-59 (1-537)
Qy 1 MetHisSerSerAlaLeuLeuCysTyrLeuValPheLeuAlaGlyValGlyAlaSerArg 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGCACAGCTCAGCACTGCTATGTTACCTGGTCTTCCTGGCCGGGGTGGGAGCCAGCCGA 60
Qy 21 AspArgGlyThrGlnSerGluAsnSerCysThrHisPheProThrSerLeuProHisMet 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 GACCGGGGCACCCAGTCTGAGAACAGCTGCACCCACTTCCCAACCAGCCTGCCCCACATG 120
Qy 41 LeuHisGluLeuArgAlaAlaPheSerArgValLysThrPhePheGlnMetLysAspGln 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 CTCCATGAGCTCCGAGCCGCCTTCAGCAGGGTGAAGACTTTCTTTCAAATGAAGGACCAG 180
Qy 61 LeuAspAsnMetLeuLeuAsnGlySerLeuLeuGluAspPheLysGlyTyrLeuGlyCys 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 CTGGACAACATGTTGTTGAACGGGTCCCTGCTGGAGGACTTTAAGGGTTACCTGGGTTGC 240
Qy 81 GlnAlaLeuSerGluMetIleGlnPheTyrLeuGluGluValMetProGlnAlaGluAsn 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 CAAGCCTTGTCGGAGATGATCCAGTTTTACCTGGAGGAGGTGATGCCCCAGGCTGAGAAC 300
Qy 101 HisGlyProAspIleLysGluHisValAsnSerLeuGlyGluLysLeuLysThrLeuArg 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 CACGGCCCAGACATCAAGGAGCACGTGAACTCCCTGGGGGAAAAGCTGAAGACCCTCCGA 360
Qy 121 ValArgLeuArgArgCysHisArgPheLeuProCysGluAsnLysSerLysAlaValGlu 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 GTGAGGCTGCGGCGCTGTCATCGATTTCTGCCCTGTGAAAATAAGAGCAAGGCAGTGGAG 420
Qy 141 GlnValLysSerAlaPheSerLysLeuGlnGluLysGlyValTyrLysAlaMetSerGlu 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 CAGGTGAAGAGTGCCTTCAGTAAGCTCCAAGAGAAAGGTGTCTACAAAGCCATGAGTGAG 480
Qy 161 PheAspIlePheIleAsnTyrIleGluAlaTyrMetThrThrLysMetLysAsn 178
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 TTTGACATCTTCATCAACTACATAGAAGCCTATATGACAACGAAGATGAAAAAC 534
Sequence 4174,
Patent No. 10293058
OTHER INFORMATION: derived and/or modified sequence opt4 from
IL-10__Homo_sapiens__AAA63207
Query Match 79.9%; Score 426.8; Length 537;
Best Local Similarity 73.2%;
Matches 391; Conservative 76; Mismatches 67; Indels 0; Gaps 0;
Qy 1 ATGCACAGCTCCGCCCTGCTGTGCTACCTGGTGTTCCTGGCAGGAGTGGGAGCAAGCCGG 60
|:||||||| |||||:||:|:||: ||:||:| : |:| | || |:| |||| ||||
Db 1 AUGCACAGCAGCGCCCUGCUGUGCUGCCUGGUGCUGCUGACCGGCGUGAGAGCCAGCCCC 60
Qy 61 GACCGCGGCACCCAGAGCGAGAACTCCTGTACCCACTTCCCCACCAGCCTGCCTCACATG 120
| || |||||||||||||||||| |:| ||||||::|||| || ||:||| |||:|
Db 61 GGCCAGGGCACCCAGAGCGAGAACAGCUGCACCCACUUCCCCGGCAACCUGCCCAACAUG 120
Qy 121 CTGCACGAGCTGAGGGCAGCCTTCTCCAGGGTGAAGACCTTCTTCCAGATGAAGGACCAG 180
|:| || |:||| | |||::| ||| |:|||||||::|::|||||:||||||||||
Db 121 CUGAGAGACCUGAGAGACGCCUUCAGCAGAGUGAAGACCUUCUUCCAGAUGAAGGACCAG 180
Qy 181 CTGGACAACATGCTGCTGAACGGCAGCCTGCTGGAGGACTTCAAGGGATACCTGGGATGC 240
|:||||||| :||:||:||| | ||||:||:|||||||::|||||| :|||:||| :||
Db 181 CUGGACAACCUGCUGCUGAAGGAGAGCCUGCUGGAGGACUUCAAGGGCUACCUGGGCUGC 240
Qy 241 CAGGCCCTGTCCGAGATGATCCAGTTCTACCTGGAGGAAGTGATGCCACAGGCCGAGAAC 300
|||||||:| |||||:||:||||::|:|||:|||||| |:||:||| ||||||||||||
Db 241 CAGGCCCUGAGCGAGAUGAUCCAGUUCUACCUGGAGGAGGUGAUGCCCCAGGCCGAGAAC 300
Qy 301 CACGGCCCCGACATCAAGGAGCACGTGAACTCCCTGGGCGAGAAGCTGAAGACCCTGAGG 360
|| | ||||||||:||||| ||||:|||| ||:||||||||| |:||||||||:|||
Db 301 CAGGACCCCGACAUCAAGGCCCACGUGAACAGCCUGGGCGAGAACCUGAAGACCCUGAGA 360
Qy 361 GTGAGACTGAGGAGATGCCACAGGTTCCTGCCCTGTGAGAACAAGAGCAAGGCCGTGGAG 420
:|||||:||| |||:||||||| ::||:||||:| |||||||||||||||||||:||||
Db 361 CUGAGACUGAGAAGAUGCCACAGAUUCCUGCCCUGCGAGAACAAGAGCAAGGCCGUGGAG 420
Qy 421 CAGGTGAAGAGCGCCTTCTCCAAGCTGCAGGAGAAGGGCGTGTACAAGGCCATGTCCGAG 480
||||:||||| ||||::| |||||:||||||||||||| : :|||||||||:| ||||
Db 421 CAGGUGAAGAACGCCUUCAACAAGCUGCAGGAGAAGGGCAUCUACAAGGCCAUGAGCGAG 480
Qy 481 TTCGACATCTTCATCAACTACATCGAGGCCTACATGACCACCAAGATGAAGAAC 534
::|||||:|::||:||||:|||:|||||||:|||:||||| ||||: | |||
Db 481 UUCGACAUCUUCAUCAACUACAUCGAGGCCUACAUGACCAUGAAGAUCAGAAAC 534
Prosecution Insights