EXAMINER'S AMENDMENT
Authorization for this examiner’s amendment was given in an interview with Christopher Baskerville on 8/24/26.
The application has been amended as follows:
Claim 1 has been amended as follows:
1. A ribonucleotide agent that decreases expression of serine/threonine-protein kinase 3 (RIOK3), wherein the ribonucleotide agent comprises:
(a) a short hairpin RNA (shRNA), a small interfering RNA (siRNA), or an asymmetrical iRNA (aiRNA) comprising;
a forward sequence comprising the nucleotide sequence of SEQ ID NO:3, or a reverse sequence comprising the nucleotide sequence of SEQ ID NO:4, or both [[,]]; or
(b) an antisense oligonucleotide, a microRNA, a miniRNA, a lncRNA, or a ribozyme, or any combination thereof, comprising an antisense strand that is complementary to the sense strand of the ribonucleotide sequence of SEQ ID NO:2, wherein the ribonucleotide agent targets the mRNA sequence of SEQ ID NO:1, or SEQ ID NO:2, or both.
DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application is being examined under the pre-AIA first to invent provisions.
Specification
The amendment filed on 7/23/26 has been entered.
Response to Arguments
Any rejection or objection not reiterated herein has been overcome by amendment.
Applicant’s arguments, see pages 9-12, filed 7/23/26, with respect to the rejection(s) of claim(s) 1, 12-14, 17, 20, 22, 25, and 32-40 under 112a have been fully considered and are persuasive. Therefore, the rejection has been withdrawn because of the amendment to claim 1 to remove the RNA agent comprising an antisense oligonucleotide that targets an antisense strand. However, upon further consideration, a new ground(s) of rejection is made in view of the amendment to claim 1.
Claim Interpretation
The claimed invention embraces a ribonucleotide agent that decreases expression of serine/threonine-protein kinase 3 (RIOK3) comprising
(a) a short hairpin RNA (shRNA), a small interfering RNA (siRNA), or an asymmetrical iRNA (aiRNA), or any combination thereof comprising a forward sequence comprising the nucleotide sequence of SEQ ID NO:3, or a reverse sequence comprising the nucleotide sequence of SEQ ID NO:4, or both; or
(b) an antisense oligonucleotide, a microRNA, a miniRNA, a lncRNA, or a ribozyme, or any combination thereof, comprising an antisense strand that is complementary to the sense strand of the ribonucleotide sequence of SEQ ID NO:2; wherein the ribonucleotide agent targets the mRNA sequence of SEQ ID NO:1, or SEQ ID NO:2, or both.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 12-14, 17, 22, 25, and 32-40 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claimed invention embraces a ribonucleotide agent that decreases expression of RIOK3, wherein the agent is (a) a shRNA, a siRNA, or an aiRNA, or any combination thereof comprising a forward sequence comprising the nucleotide sequence of SEQ ID NO:3, or a reverse sequence comprising the nucleotide sequence of SEQ ID NO:4, or both; or
SEQ ID NO: 2 is a 21-mer sequence of a RIOK3 nucleotide comprising SEQ ID NO: 1 (which is 3574 bps).
The specification of the instant disclosure provides written support for a dsRNA (shRNA, siRNA, aiRNA) having a sense strand comprising SEQ ID NO: 3 and/or an antisense strand comprising SEQ ID NO: 4 to reduce RIOK3 expression. In addition, the specification sufficiently describes antisense oligonucleotides comprising an antisense strand that is complementary to a nucleotide sequence set forth in SEQ ID NO: 2.
However, the specification does not contain written support for a minRNA, a ribozyme, a microRNA or lncRNA having a sequence that is complementary to a nucleotide sequence set forth in SEQ ID NO: 2 that can reduce RIOK3 expression.
The specification does not provide a definition of a miniRNA, but one of skill in the art would reasonably determine that the term embraces RNA that are less than several hundred nucleotides in length, including coding or non-coding RNAs. Therefore, miniRNAs embrace all of the other ribonucleotide agents listed in the instant claims.
Each ribonucleotide agent embraced by the claims has a different structure and/or mechanism of reducing expression of RIOK3. For example, ribozymes have a different structure and function than RNAi agents. While the specification contemplates a minRNA, a ribozyme, a microRNA or lncRNA having a sequence that is complementary to a nucleotide sequence set forth in SEQ ID NO: 2 that can reduce RIOK3 expression. The specification does not describe that these RNA agents would have the desired biological activity (decreased RIOK3 expression).
The art of record does not disclose a ribozyme comprising a sequence that is complementary to SEQ ID NO: 2 that reduces RIOK3 expression. Ribozymes are enzymes that cleave a nucleotide sequence and RNAi agents use an enzyme to cleave a target sequence thru the RNAi pathway. See LibreTexts Biology, Jakubowski et al. 6.7: Ribozymes-RNA enzymes, retrieved on-line 4/15/26, pages 1-19. In view of the prior art, a skilled artisan would understand that making a ribozyme for reducing expression of RIOK3 is not based on any method of making RNAi agents.
Pages 16-17 (paragraphs 82-83) of the specification describes prior art directed to ribozymes, hammerhead ribozyme and ribozyme inhibitors. While ribozymes that cleave mRNA at site-specific recognition sequences can be used to destroy particular mRNAs, the use of hammerhead ribozymes is preferred. The construction and ribozymes is well known in the art. The sole requirement is that the target mRNA have the following sequence of two bases: 5’-UG-3’. SEQ ID NO: 2 does contain a TG in the sequence. However, the clams are broader than targeting these two specific bases.
Ribozymes inhibitors may also include RNA endoribonucleases (“Cech-type ribozymes”) such as one found in nature in Tetrahymena thermophila (known as the IVS, or L-19 IVS RNA). The “Cech-type ribozymes” has an 8-basepair stretch comprises within SEQ ID NO: 1, preferably SEQ ID NO: 2 (paragraph 83). Other than reciting this limitation. The specification does not disclose any ribozyme having the desired biological activity. One of skill in the art would have to further experiment with any sequence that might be a potential ribozyme and determine if it possess the desired biological activity.
MicroRNAs are found in nature and comprise a seed sequences (6 to 8 nucleotides long) that targets at least one gene. The specification does not disclose any known miRNA comprising an antisense strand that is complementary to the sense strand of the ribonucleotide sequence of SEQ ID NO:2; wherein the ribonucleotide agent targets the mRNA sequence of SEQ ID NO:1, or SEQ ID NO:2, or both. Zhang et al. (Genes and Development 25:119-124, 2011, cited on an IDS) disclose that miR-191 targets RIOK3, the sequence for miR-191 does not comprise an antisense strand that is complementary to the sense strand of the ribonucleotide sequence of SEQ ID NO:2; wherein the ribonucleotide agent targets the mRNA sequence of SEQ ID NO:1, or SEQ ID NO:2, or both.
Other than the specification and claims contemplating miniRNA, the specification does not provide a definition of the term “miniRNA” or describe that a nucleotide sequence comprising an antisense strand that is complementary to the sense strand of the ribonucleotide sequence of SEQ ID NO:2; wherein the ribonucleotide agent targets the mRNA sequence of SEQ ID NO:1, or SEQ ID NO:2, or both and reduced RIOK3 expression.
The specification discloses that IncRNA are long noncoding RNA produced from the genome and are generally >200 nucleotides in length lacking a protein coding plasmid (page 18). There are over 16,000 annotated IncRNAs in the human genome. Neither the specification nor the prior art of record disclose IncRNA from the human genome that has an antisense strand that is complementary to the sense strand of the ribonucleotide sequence of SEQ ID NO:2; wherein the ribonucleotide agent targets the mRNA sequence of SEQ ID NO:1, or SEQ ID NO:2, or both and that reduces RIOK3 expression.
The specification and the art of record do not disclose that shRNA comprising SEQ ID NO: 3 and 4 is considered to be a representative species of the genus of RNA agents embraced by the instant claims. A shRNA is a double stranded RNA that inhibits expression of a mRNA or gene using the RNAi pathway in a cell. The shRNA has one sequence complementary to a target sequence and a second sequence that is complementary to the first sequence and a linker (nucleotide, non-nucleotide) connecting the first and second strand. The shRNA has to have SEQ ID NO: 3 and a sequence complementary to SEQ ID NO: 3, including SEQ ID NO: 4, because SEQ ID NO: 3 is the sequence that is complementary to the mRNA sequence of SEQ ID NO: 1, 2 or both.
The specification does not contain written support for a miniRNA, a ribozyme, a microRNA or lncRNA having a sequence that is complementary to a nucleotide sequence set forth in SEQ ID NO: 2 that can reduce RIOK3 expression.
In view of the foregoing, it is clear that the specification of the instant disclosure fails to convey to the skilled artisan that the applicant had possession of the claimed genus of ribonucleotide agent in claims 1, 12-14, 17, 20, 22, 25, and 32-40 as of the effective filing date.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1 and 14 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a fragment of a nucleic acid found in nature without significantly more. The claim recites an RNA sequence that reduces RIOK3 expression comprising an antisense oligonucleotide that is complementary to SEQ ID NO: 2, wherein the oligonucleotide targets SEQ ID NO: 1 or 2, or both. Because RNA agents are composed of matter, the antisense oligonucleotide is a composition of matter, which is a statutory category of invention. Page 9, table 1 of the as-filed specification disclose that SEQ ID NO: 2 is a homo sapiens RIO kinase 3 transcript variant 1, mRNA (3’ UTR sequence). See MPEP 2106.04(b) Products of Nature. The courts have identified the following product as examples of laws of nature or natural phenomena:
viii. single-stranded DNA fragments known as “primers”, University of Utah Research Foundation v. Ambry Genetics Corp., 774 F.3d 755, 761, 113 USPQ2d 1241, 1244 (Fed. Cir. 2014).
The broadest reasonable interpretation of the antisense oligonucleotide is any oligonucleotide that is complementary to SEQ ID NO: 2. The limitation “A ribonucleotide agent that decreases expression of RIOK3” in the pre-amble of the claim does not add any patentable weight to the claim because any antisense oligonucleotide that is complementary SEQ ID NO: 2 would inherently possess this function. This judicial exception is not integrated into a practical application because a sequence search of publicly available databases indicates that several oligonucleotides would read on probes or primers of a nucleic acid found in nature. For example, SEQ ID NO: 13977 in US 6821724 is directed to a probe/PCR primer for a mouse gene and is embraced by the claimed product. A search of the prior art does not indicate that there are any known microRNA or lncRNA found in nature that comprise a sequence that is complementary to SEQ ID NO: 2. When comparing the claimed antisense oligonucleotide to the probe/PCR primer, the comparison indicates that there is no differences in structure, function or other characteristics. The claim does not include additional elements that are sufficient to amount to significantly more than the judicial exception because other than reciting a function of the oligonucleotide, there are no additional structures to distinguish the claimed product from a nucleic acid found in nature.
With respect to claim 14 directed to a composition comprising the antisense oligonucleotide, the composition is recited in generic terms and is considered an insignificant extra-solution (see also MPEP 2106.05(d) or (g)). Pages 21-22 of the specification states that pharmaceutically acceptable carriers are well known in the art. Because the oligonucleotide must be placed in a composition in order to store or use it, merely reciting a generic “composition” thus fails to meaningfully limit the claim because it is at best the equivalent of merely adding the words “apply it” to the judicial exception. Thus, the composition does not integrate the recited judicial exception into a practical application.
Instant claims 1 and 14 are not patent eligible.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of pre-AIA 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1 and 14 are rejected under pre-AIA 35 U.S.C. 102(a)(1) as being anticipated by The Brigham and Women’s Hospital, Inc. (WO 2009099991).
The broadest reasonable interpretation of the limitation “antisense oligonucleotide” in amended claim 1 embraces single stranded and double stranded RNA molecules comprising an antisense oligonucleotide. In view of the BRI, a dsRNA molecule that comprises an antisense oligonucleotide that is complementary to SEQ ID NO: 2 would read on the claimed product.
‘991 teaches shRNA 22-mer screened in a cell line. See SEQ ID NO: 4353 in table 9, pages 113-329. SEQ ID NO: 4353 in table 9 is part of a shRNA molecule and has 20 nucleotides that are complementary to instant SEQ ID NO: 2.
Qy is SEQ ID NO: 2 and SEQ ID NO: 4353 (3924)) (Db).
Qy 1 GCTCAGCATTGAGAGAATAA 20
Db 20 GCTCAGCATTGAGAGAATAA 1
Although ‘991 is silent with respect to the limitations in the preamble (decreases expression RIOK3) of the instant claims, ‘991 anticipates all of the claimed structural limitations, so the functional effects of the claimed product are considered to be inherent in the product taught by ‘991. Where, as here, the claimed and prior art products are identical or substantially identical, or are produced by identical or substantially identical processes, the PTO can require an applicant to prove that the prior art products do not necessarily or inherently possess the characteristics of his claimed product. See In re Ludtke 441 F.2d 660, 169 USPQ 563 (CCPA 1971). Whether the rejection is based on "inherency" under 35 USC 102, or "prima facie obviousness" under 35 USC 103, jointly or alternatively, the burden of proof is the same, and its fairness is evidenced by the PTO's inability to manufacture products or to obtain and compare prior art products. In re Best, Bolton, and Shaw, 195 USPQ 430, 433 (CCPA 1977) citing In re Brown, 59 CCPA 1036, 459 F.2d 531, 173 USPQ 685 (1972).
Claim 1 is rejected under pre-AIA 35 U.S.C. 102(a)(1) as being anticipated by Bentwich et al. (US 20060003322). Bentwich et al. teach a nucleotide sequence having 24 nucleotides in length, wherein 21 nucleotides of the sequence is complementary to instant SEQ ID NO: 2 (Qy). See SEQ ID NO: 382872 (Db).
Qy 1 GCTCAGCATTGAGAGAATAAA 21
Db 24 GCTCAGCATTGAGAGAATAAA 4
Although Bentwich is silent with respect to the limitations in the preamble (decreases expression RIOK3) of the instant claim, Bentwich anticipates all of the claimed structural limitations, so the functional effects of the claimed product are considered to be inherent in the product taught by Bentwich.
Claims 1 and 14 are rejected under pre-AIA 35 U.S.C. 102(a)(1) as being anticipated by Wyeth (WO 2005001092).
The broadest reasonable interpretation of the limitation “antisense oligonucleotide” in amended claim 1 embraces single stranded and double stranded RNA molecules comprising an antisense oligonucleotide. In view of the BRI, a dsRNA molecule that comprises an antisense oligonucleotide that is complementary to SEQ ID NO: 2 would read on the claimed product.
‘092 teaches siRNA 21-mer. See SEQ ID NO: 2212 in table 3, page 30 and page 65, claim 3. SEQ ID NO: 2212 in table 3 is part of a siRNA molecule and has an antisense strand that is complementary to instant SEQ ID NO: 2. The siRNA would target a C20orf103 sequence.
See SEQ ID NO: 2212, claim 3 of ‘092.
Qy 4 CAGCATTGAGAGAATAA 20
Db 20 CAGCATGGAGAGAATAA 4
Although ‘092 is silent with respect to the limitations in the preamble (decreases expression RIOK3) of the instant claims, ‘092 anticipates all of the claimed structural limitations, so the functional effects of the claimed product are considered to be inherent in the product taught by ‘092.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 17, 20, 22, 25, and 32-33 are rejected under 35 U.S.C. 103 as being unpatentable over Wyeth (WO 2005001092) as applied to claims 1 and 14 above.
‘092 teaches making vectors, including expression vectors and gene delivery vectors (such as viral vectors). See pages 25-26, 46 and 65-67. The gene delivery vector can be a retroviral, lentiviral, adenoviral, adeno-associated viral, herpes viral and alphavirus. The delivery of the polynucleotide can be employed such as liposome complexes and particles (pages 48-49). A pharmaceutical composition can be used to administer the sequences to a cell (pages 55-59).
However, ‘092 does not specifically an expression vector comprising a siRNA comprising SEQ ID NO:2212.
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to express the siRNA from vectors to stably express siRNA in cells or transgenic animals. One of ordinary skill in the art would have been motivated to make a lentiviral vector comprising the siRNA to delivery to cells. In addition, one of ordinary skill in the can use a non-viral delivery vector, including a composition comprising microparticles to deliver the siRNA to cells. ‘092 teaches making microparticles for delivery of the polynucleotide.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Allowable Subject Matter
Claim 3, 52 and 56 are objected to as being dependent upon a rejected base claim, but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. The applicant surprisingly discovered that to increase fetal hemoglobin expression, knockdown of RIOK3 be directed to specific region of 3’ UTR of SEQ ID NO: 2 (page 10). The applicant found that targeting exons 6 or 10 or the 3’ UTR at different locations does not result in the fetal globin upregulation.
Conclusion
See attached PTO-326 for disposition of claims.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. US 20200216545 (cited on an IDS) contemplates RIOK3 inhibitors, including a siRNA, a microRNA, a lncRNA, and an antisense oligonucleotide. SEQ ID NO: 1 (1560 nts) in ‘545 is directed to a human RIOK3 mRNA sequence, which has a sequence that is complementary (46%) to instant SEQ ID NO: 2 (a homo sapiens RIO kinase 3 transcript variant 1, mRNA (3’ UTR sequence).
Qy 1 GCTCAGCATTGAGAGAATAAA 21
Db 1128 GCTCAATAGTGAAGAAATGAA 1148
However, ‘545 does not teach or suggest making an antisense oligonucleotide, miRNA, lncRNA comprising a sequence that targets SEQ ID NO: 2 and reduces RIOK3 expression. It would not have been obvious to use the teaching of ‘545 to try making an antisense oligonucleotide embraced by the claimed invention because there was no teaching or suggestion in ‘545 directing one of ordinary skill to target that specific region (nucleotides 1128-1148) of SEQ ID NO: 1 and there was not a finite number of predictable and identifiable antisense sequences in SEQ ID NO: 1 for one of ordinary skill in the art to arrive at the claimed invention for reducing RIOK3 expression.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636
