Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. DETAILED ACTION Acknowledgement is hereby made of receipt and entry of the communication filed on Nov. 13, 2023 . Claims 1-20 are pending and currently examined. Claim Objections Claims 5 and 6 are objected to because of the following informalities: claims 5 and 6 recite “ (Accession No. NC_012532.1) ” , which is an improper incorporation by reference, since the information required to describe and enable the required sequences is found in the NCBI database, extraneous to the application. Furthermore, since the NCBI sequences are not irrevocably fixed but are corrected and updated as additional sequence information becomes available, the NCBI accession numbers may refer to sequences which change after the application filing date. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claims 1-20 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, claims 1, 6-7 and 15-16 recite a broad range together with a narrow range in the same claim. The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. C laims 5 and 6 recite “SEQ ID NO: 45 (Accession No. NC_012532.1) ”. Since Accession No. NC_012532.1 is extraneous to the application and may subject to change , it is not clear what the relationship between SEQ ID NO: 45 and Accession No. NC_012532.1 is. Since SEQ ID NO: 45 stands alone by itself, Applicant may consider removing the accession number. Claim 13 recites “e.g., SEQ ID NO: 32 (F2A)”. By using the word “e.g.”, it is not clear if SEQ ID NO: 32 is required. Claim 15 recites the limitation “wherein the one or more coronavirus sequences encodes……” which does not have antecedent basis since claim 1 from which claim 15 depends from does not recite a coronavirus sequence. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1 , 4-7 and 17 are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. A claim directed to a judicial exception must be analyzed to determine whether the elements of the claim, considered both individually and as an ordered combination, are sufficient to ensure that the claim as a whole amounts to significantly more than the exception itself. To be patent-eligible, a claim that is directed to a judicial exception must include additional features to ensure that the claim describes a process or product that applies the exception in a meaningful way, such that it is more than a drafting effort designed to monopolize the exception. These claims are directed to a nucleic acid construct comprising a Zika vector having at least 90% sequence identity to SEQ ID NO: 44 or SEQ ID NO: 43 and lacking sequences encoding functional Zika virus capsid, matrix, and envelope proteins. The claimed nucleic acid construct reads on a fragment of naturally occurring Zika virus genome. E.g., GenBank: KX377337.1 discloses the Zika virus strain PRVABC-59 that comprises a genome having a sequence that is about 97% identical to SEQ ID NO: 43. Therefore, the claimed nucleic acid construct reads on a sequence in a naturally occurring product which is a judicial exception (JE) . Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention. Claims 1, 4, 7-8, 11-14 and 17 are rejected under 35 U.S.C. 102(a)( 1 ) as being anticipated by Xie et al. (EBioMedicine 12 (2016) 156–160) as evidenced by GenBank: KU955593.1 (Zika virus isolate Zika virus/H.sapiens-tc/KHM/2010/FSS13025, complete genome. Dated May 24, 2016). These claims are directed to a nucleic acid construct comprising a Zika Vector having 90%, 91%, 92%,93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% sequence identity to SEQ ID NO: 44 or SEQ ID NO: 43 and lacking sequences encoding functional Zika virus capsid, matrix, and envelope proteins. Here, the claimed nucleic acid construct reads on a Zika virus replicon, with functions of the structural proteins (C, PrM and E) abolished. Xie teaches that Zika virus (ZIKV) is a mosquito-borne member of the genus flavivirus within the family Flaviviridae, and that many flaviviruses, such as the four serotypes of dengue virus (DENV-1 to -4), yellow fever (YFV), West Nile virus (WNV), Japanese encephalitis virus (JEV), and tick-borne encephalitis virus (TBEV), cause significant human diseases. See page 156, left column, para 1. Xie teaches that compared with the infectious cDNA clone, replicon systems allow analyzing viral replication events (i.e., viral translation and RNA synthesis) in the absence of virus entry or virion assembly. Due to the lack of viral structural genes, the replicon system is non-infectious, thus reducing the biosafety concern when used to screen large compound libraries. See page 156, right column, para 2. Fig. 1 of Xie shows plasmid constructs including the whole Zika genome sequence (pFLZIKV) or replicons with structural gene sequences replaced with a heterologous luciferase reporter gene Rluc2A (pZIKV Rep WT and Rep-NS5 D GDD). See Fig. 1. In Fig. 1A, C38 and E30 represent DNA sequences encoding the first 38 amino acids of C protein and the last 30 amino acid of E protein. Xie teaches that the Renilla luciferase (Rluc) replicon plasmid was constructed from an infectious clone pFLZIKV that contains a T7 promoter and hepatitis delta virus ribozyme sequence (HDVr) at the 5′ and 3′ end of the cDNA sequence of Cambodian strain (FSS13025), respectively (Shan et al., 2016b). Standard overlap PCR was performed to amplify the DNA fragment between unique restriction enzyme sites NotI and SphI. This DNA fragment contains the T7 promoter, 5′UTR, and a DNA cassette (C38-Rluc2A-E30) in-frame fused with the ORF (Fig. 1). The C38-Rluc2A-E30 cassette encodes the N-terminal 38 amino acids of C protein (C38), Rluc reporter, foot-and-mouth disease virus (FMDV) 2A protease, and the C-terminal 30 amino acids of the E protein (E30). The codons of C38 contain the flavivirus-conserved cyclization sequence required for viral RNA replication (Hahn et al., 1987; Khromykh et al., 2001). The E30 serves as a signal peptide for proper translocation of NS1 into the endoplasmic reticulum (ER) lumen. See page 157, right column, para 2. GenBank: KU955593.1 discloses the genomic nucleic acid sequence of Zika virus isolate Zika virus/H.sapiens-tc/KHM/2010/FSS13025. It is also designated as having a “geo_loc_name” of Cambodia. Therefore, GenBank: KU955593.1 is considered as disclosing the complete genomic sequence of the Cambodian strain (FSS13025) used in the Xie study. Alignment between SEQ ID NO: 43 and GenBank: KU955593.1 is shown below: Range 1: 2401 to 10807GraphicsNext MatchPrevious Match Alignment statistics for match #1 Score Expect Identities Gaps Strand 14698 bits(7959) 0.0 8258/8407(98%) 1/8407(0%) Plus/Plus SEQ43 191 TGGG-CTGAACACAAAGAATGGATCTATTTCCCTTATGTGCTTGGCCTTAGGGGGAGTGT 249 |||| ||||| ||||||||||||||||||||||||||||||||||||||||||||||||| KU’93 2401 TGGGTCTGAATACAAAGAATGGATCTATTTCCCTTATGTGCTTGGCCTTAGGGGGAGTGT 2460 SEQ43 250 TGATCTTCTTATCCACAGCCGTCTCTGCTGATGTGGGGTGCTCGGTGGACTTCTCAAAGA 309 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| KU’93 2461 TGATCTTCTTATCCACAGCCGTCTCTGCTGATGTGGGGTGCTCGGTGGACTTCTCAAAGA 2520 ---------------------------------------------- skip ----------------------- SEQ43 8530 CACCACGCTGGCCGCCAGGCACAGATCGCCGAATAGCGGCGGCCGGTGTGGGGAAATCCA 8589 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| KU’93 10741 CACCACGCTGGCCGCCAGGCACAGATCGCCGAATAGCGGCGGCCGGTGTGGGGAAATCCA 10800 SEQ43 8590 TGGGTCT 8596 ||||||| KU’93 10801 TGGGTCT 10807 Range 2: 1 to 183GraphicsNext MatchPrevious MatchFirst Match Alignment statistics for match #2 Score Expect Identities Gaps Strand 333 bits(180) 4e-93 182/183(99%) 0/183(0%) Plus/Plus SEQ43 1 AGTTGTTGATCTGTGTGAATCAGACTGCGACAGTTCGAGTTTGAAGCGAAAGCTAGCAAC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| KU’93 1 AGTTGTTGATCTGTGTGAATCAGACTGCGACAGTTCGAGTTTGAAGCGAAAGCTAGCAAC 60 SEQ43 61 AGTATCAACAGGTTTTATTTTGGATTTGGAAACGAGAGTTTCTGGTCATGAAAAACCCAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| KU’93 61 AGTATCAACAGGTTTTATTTTGGATTTGGAAACGAGAGTTTCTGGTCATGAAAAACCCAA 120 SEQ43 121 AAAAGAAATCCGGAGGATTCCGGATTGTCAATATGCTAAAACGCGGAGTAGCCCGTGTGA 180 | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| KU’93 121 AGAAGAAATCCGGAGGATTCCGGATTGTCAATATGCTAAAACGCGGAGTAGCCCGTGTGA 180 SEQ43 181 GCC 183 ||| KU’93 181 GCC 183 Considering C, PrM and E gene deletions (SEQ ID NO: 43 has the nts between about 18 4 -2400 the viral genome sequence deleted), the identity between SEQ ID NO: 43 and GenBank: KU955593.1 is about 98%. Accordingly, Xie teaches replicon constructs of Zika virus comprising a Zika virus genome sequence that lacks sequences encoding functional Zika virus capsid (C), matrix (PreM) and envelope (E) proteins (the C38 and E30 in the replicons are not considered function capsid and envelope proteins). Here, each of the replicons can be considered to consist of a Zika virus vector (the virus part) and a heterologous sequence encoding the reporter protein Rluc2A replacing the C, PrM and E gene sequences. Xie teaches that the Zika virus used in the study is the Cambodian strain (FSS13025). As evidenced by GenBank: KU955593.1, the replicons of Xie comprise vector nucleic acid sequences that are about 98% identical to SEQ ID NO: 43. Regarding claim 12, Xie is silent on if the plasmid vectors used to accommodate and express the replicon sequences comprise a pBR322 cloning vector sequence. Since most E. coli plasmids are derived from pBR322 or related plasmids, it is reasonable to consider that the plasmid vector(s) used in Xie comprises “a pBR322 cloning vector sequence”. Note, here, the claim does not specify how much of pBR322 vector sequence is comprised. Any “sequence” shared between pBR322 and the plasmid vector(s) used in Xie would suffice. Regarding claim 14, SEQ ID NO: 33 represents the Not I restriction site which is shown in the plasmid vector comprising the replicon of Xie. See Fig. 1 above. Therefore, Xie anticipates claims 1, 4, 7- 8 , 11 -1 4 and 17. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 2 , 3, 15 and 1 8 -20 are rejected under 35 U.S.C. 103 as being unpatentable over Xie et al. (EBioMedicine 12 (2016) 156–160) as evidenced by GenBank: KU955593.1 (Zika virus isolate Zika virus/H.sapiens-tc/KHM/2010/FSS13025, complete genome. Dated May 24, 2016) , as applied above, in view of Giel-Moloney et al. (Scientific Reports (2019) 9:20005) and K. Lundstrom (vacres. 2020; 7 (1):25-37) . These claims specify that the nucleic acid construct comprising a Zika virus vector and one or more coronavirus sequences. Relevance of Xie and GenBank: KU955593.1 is set forth above. However, they are silent on coronavirus sequences. Giel-Moloney teaches a study evaluating an alternative replication-defective flavivirus vector, RepliVax (RV) for the delivery of HIV-1 immunogens. Recombinant RV-HIV viruses were engineered to stably express clade C virus Gag and Env (gp120TM) proteins and propagated in Vero helper cells. In a pilot NHP study, immunogenicity of RV-HIV viruses used as a prime or boost for DNA or NYVAC candidates was compared to a DNA prime/NYVAC boost benchmark scheme when administered together with adjuvanted gp120 protein. The results demonstrate that RV vectors have the potential as novel HIV-1 vaccine components for use in combination with other promising candidates to develop new effective vaccination strategies. See Abstract. Giel-Moloney teaches that the RepliVax (RV) vaccine approach based on single-cycle flavivirus vectors attenuated by a deletion introduced in the gene(s) encoding viral structural proteins (C-prM-E) was initially applied to flavivirus targets, such as tick-borne encephalitis (TBE) virus, and subsequently to non-flavivirus targets. From the point of view of vaccine development, flaviviruses are of interest because flavivirus infection is known to elicit life-long homologous protective immunity, e.g., as exemplified by the characteristics of a prototype flavivirus live attenuated vaccine (LAV), yellow fever 17D (YF 17D) considered to be protective for life after single immunization. The single-cycle nature of RV vaccine constructs engineered for flavivirus targets are based on a capsid C gene deletion ensuring high attenuation in vivo of a vaccine candidate against flavivirus targets. Inside infected cells, RV replicate like full flaviviruses which is expected to induce robust innate and adaptive responses. See para spanning pages 1 and 2. Giel-Moloney teaches that RV vaccine candidates against non-flavivirus targets are engineered to express an appropriate pathogen-specific immunogen(s) in place of large prM-E or C-prM-E deletions and that they are propagated in helper cells expressing the C-prM-E cassette trans-complementing the vector deletion. The authors have expressed several immunogens from respiratory syncytial virus, influenza virus, and SIV in the West Nile (WN, NY99 strain) RV vector and demonstrated high attenuation and immunogenicity of the constructed recombinants in mice . A single dose of a similarly constructed vaccine candidate against rabies (RV-Rabies G) was shown to protect dogs from rabies challenge two years post-immunization. See page 2, para 2. Figure 1 shows the construct of a flavivirus replicon-based vaccine candidate with the viral C, prM and E structural gene sequences replaced by the heterologous target antigen sequence of gp120TM. See below: Lundstrom reviews the potential of RNA vaccines for infectious diseases and COVID-19. RNA-based vaccines have proven attractive. In addition to mRNA-based vaccines, RNA replication mechanism provided by self-amplifying RNA (saRNA) viruses has been utilized. Enhanced immune responses with reduced doses required for immunization has been obtained in comparison to conventional mRNA administration. The rapid spread and destruction caused by the COVID-19 pandemic has substantially accelerated the demand for the development of robust and efficient vaccines against SARS-CoV-2. Both mRNA- and saRNA-based COVID-19 vaccine candidates are currently in human clinical trials. See Abstract. Lundstrom teaches that RNA replicons and DNA plasmids have been engineered for Kunjin virus (KUN), a member of flaviviruses. In the case of KUN, foreign genes are introduced between the C20 core protein and the E22 envelope protein for expression as a large polyprotein, which will be processed into individual proteins (Fig. 2). Introduction of an FMDV-2A protease sequence in the KUN vector will allow removal of remaining KUN flanking regions from the recombinant product. Virus production from KUN vectors has been facilitated by the engineering of a packaging cell line. Other flaviviruses have also been subjected to the engineering of expression systems including West Nile virus, yellow fever virus, dengue virus and tick-borne encephalitis. See para bridging pages 26 and 27. Lundstrom teaches that outbreaks of SARS and Middle East Respiratory Syndrome (MERS) triggered the application of saRNA vectors (Table 2). Table 2 is presented below: Lundstrum teaches that immunization with a VEE saRNA vector expressing the SARS-CoV-2 spike (S) protein encapsulated in LNPs elicited remarkably high dose-dependent SARS-CoV-2 specific antibody titers in mice. Robust neutralizing antibodies against both pseudo-virus and wildtype virus were elicited. Furthermore, the neutralization was proportional to specific IgG quantities and superior to what has been seen in recovered COVID-19 patients. See page 32, left column, para 1. Accordingly, teachings of Giel-Moloney and Lundstrom indicate that vaccine candidates based on flavivirus replicons with the sequences of viral structural genes C, prM and E replaced by heterologous vaccine target gene have been developed with promising results. Lundstrom further teaches self-amplifying RNA replicons (saRNA) from a series of single-stranded RNA viruses, including flavivirus Kun, as vaccine antigen carriers. Lundstrom teaches studies using saRNA derived from several single-stranded RNA viruses as vectors in the development of vaccine for coronavirus infections, by expression the spike proteins of SARS-CoV, MERS-CoV-2 and SARS-CoV-2. See Table 2 of Lundstrom. It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the current invention to combine the teachings of Xie, Giel-Moloney and Lundstrom to arrive at the invention as claimed. One would have been motivated to do so to develop a coronavirus vaccine candidate based on the Zika virus-based replicon disclosed in Xie. There is a reasonable expectation of success that a coronavirus target antigen sequence (such as the SARS-CoV-2 S gene disclosed in Lundstrom) can be introduced into a Zika virus replicon of Xie in place of the reporter gene sequence for the expression of the target antigen, based on the teachings of the cited references. Claims 5-6 are rejected under 35 U.S.C. 103 as being unpatentable over Xie et al. (EBioMedicine 12 (2016) 156–160) as evidenced by GenBank: KU955593.1 (Zika virus isolate Zika virus/H.sapiens-tc/KHM/2010/FSS13025, complete genome. Dated May 24, 2016), as applied above, in view of NC_012532.1 (Zika virus, complete genome, dated Aug. 1, 2019). Claims 5-6 specify SEQ ID NO: 45 which represent the genome sequence of the Zika virus strain known with the accession no. NC_012532.1. Relevance of Xie is set forth above . However, Xie is silent on a Zika virus genome sequence with the accession no. NC_012532.1, which is identical to SEQ ID NO: 45. NC_012532.1 discloses the Zika virus complete genome sequence of the accession no. NC_012532.1, indicating that the sequence specified in the claims are known at the time of invention. It would have been prima facie for one of ordinary skill in the art before the effective filing date of the current invention to substitute the Zika virus isolate Zika virus/H.sapiens-tc/KHM/2010/FSS13025 used in Xie with that disclosed in NC_012532.1 which is considered as an equivalent. Claims 9-10 are rejected under 35 U.S.C. 103 as being unpatentable over Xie et al. (EBioMedicine 12 (2016) 156–160) as evidenced by GenBank: KU955593.1 (Zika virus isolate Zika virus/H.sapiens-tc/KHM/2010/FSS13025, complete genome. Dated May 24, 2016), as applied above, in view of Huelsmann et al. (US 2016/0208284 A1, published on Jul. 21, 2016). These claims specify that the nucleic acid construct of claim 1 further comprises a sequence that encodes Bacteriophage T4 Fibritin foldon and/or a sequence that encodes an IgK signal peptide (claim 9), or a SV40 PolyA sequence. Relevance of Xia and GenBank: KU955593.1 is set forth above. However, they are silent on if the plasmid vectors used in the study further comprise a sequence that encodes Bacteriophage T4 Fibritin foldon and/or a sequence that encodes an IgK signal peptide (claim 9), or a SV40 PolyA sequence. Huelsmann teaches an invention relating to novel combinations of expression vector elements, such as promoter, polyA signal sequence, and transcription terminator, expression vector organizations, combinations thereof, as well as novel methods for the generation of production cell lines, such as novel transfection or selection methods, as well as the use of these expression vectors and production cell lines for the recombinant production of polypeptides of interest. See [0001]. Huelsmann teaches that for transient transfections the use of the human elongation factor 1 alpha promoter (with IntronA) provides for an enhanced productivity (in LC-HC-SM organization), the use of the bovine growth hormone poly A signal sequence provides for an enhanced productivity compared to use of the SV40 polyA signal sequence, the addition of the HGT to the bGH PolyA signal sequence results in an increased productivity in vectors containing the hCMV promoter and the vector organization LC(3'-5')-HC-SM results in improved expression. See Abstract. Huelsmann teaches that the transcription level of a gene can have a strong influence on its expression level and therefore determines the productivity of a cell. It is mainly influenced by three vector elements: by the promoter, the poly A signal sequence and (if present) by a transcription terminator. See [0002]. Huelsmann teaches that the nucleic acid encoding an antibody heavy chain (i.e., Ig K ) generally comprises a leader sequence (a signal sequence) (approximately 57 bp/19 aa), which is removed upon maturation of the protein, a variable region, VH (approximately 350 bp/115 aa), and the constant region, CH (approximately 990 bp/330 aa). The nucleic acid encoding an antibody light chain (i.e., Ig l ) is generally composed of a leader sequence (approximately 66 bp/22 aa) which is removed upon maturation of the protein. See [0003]. Accordingly, Huelsmann teaches the use of poly A sequences, including the SV40 poly A sequence, in the structure of expression vectors to facilitate efficient transcription of genes. Huelsmann teaches the existence antibody Ig K and Ig l leader sequences (also called signal peptides) that facilitate secretion of the antibody proteins. It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the current invention to introduce the expression vector elements disclosed in Huelsmann , including the SV40 poly A sequence and the IgK signal peptide sequence, as claimed, into the plasmid vector used in Xie to facilitate transcription of the Zika virus replicon and expression of the proteins encoded by the replicon. Claim 16 is rejected under 35 U.S.C. 103 as being unpatentable over Xie et al. (EBioMedicine 12 (2016) 156–160) as evidenced by GenBank: KU955593.1 (Zika virus isolate Zika virus/H.sapiens-tc/KHM/2010/FSS13025, complete genome. Dated May 24, 2016), in view of Giel-Moloney et al. (Scientific Reports (2019) 9:20005) and K. Lundstrom (vacres. 2020; 7 (1):25-37), as applied above, and further in view of GenBank: MN908947.3 (SARS-CoV-2 isolate Wuhan-Hu-1, complete genome; dated Mar. 18, 2020) . Claim 16 is the nucleic acid construct according to claim 1, wherein the nucleic acid construct has 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%,98%, 99%, or 100% sequence identity to SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 40. The recited sequences represent Zika virus-based replicons comprising heterologous nucleic acid sequences encoding SARS-CoV-2 antigens replacing the Zika virus structural gene sequences. Relevance of Xie , GenBank: KU955593.1 , Giel-Moloney and Lundstrom is set forth above. However, they are silent on the nucleic sequence of a Zika virus replicon containing a heterologous SARS-CoV-2 antigen encoding sequence, such as those in SEQ ID NO: 5, SEQ ID NO: 8, SEQ ID NO: 11, SEQ ID NO: 14, SEQ ID NO: 17, SEQ ID NO: 38, SEQ ID NO: 39, or SEQ ID NO: 40, as claimed. GenBank: MN908947.3 discloses the complete genome sequence of SARS-CoV-2 isolate Wuhan-Hu-1, indicating that SARS-CoV-2 nucleic acid and amino acid sequences are known at the time of invention. It would have been prima facie obvious for one of ordinary skill in the art before the effective filing date of the current invention to introducing a SARS-CoV-2 antigen coding sequence, disclosed in GenBank: MN908947.3, into the Zika virus replicon of Xie (replacing the reporter gene sequence) to construct a SARS-CoV-2 vaccine candidate. E.g., SEQ ID NO: 5 represents a Zika virus replicon comprising a heterologous sequence encoding aa 1-688 of SARS-CoV-2 spike protein (the bulk of the S1 domain of the spike protein) . Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to NIANXIANG (NICK) ZOU whose telephone number is (571)272-2850. The examiner can normally be reached on Monday - Friday, 8:30 am - 5:00 pm, EST. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, MICHAEL ALLEN, on (571) 270-3497, can be reached. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /NIANXIANG ZOU/ Primary Examiner, Art Unit 1671