Prosecution Insights
Last updated: July 17, 2026
Application No. 18/560,548

GUIDE RNA FOR DETECTING ONCOGENIC MUTANT GENE AND USE THEREOF

Non-Final OA §101§102§112
Filed
Nov 13, 2023
Priority
May 11, 2021 — RE 10-2021-0061037 +1 more
Examiner
YU, TIAN NMN
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Aima Co. Ltd.
OA Round
1 (Non-Final)
56%
Grant Probability
Moderate
1-2
OA Rounds
1y 2m
Est. Remaining
70%
With Interview

Examiner Intelligence

Grants 56% of resolved cases
56%
Career Allowance Rate
46 granted / 82 resolved
-3.9% vs TC avg
Moderate +14% lift
Without
With
+13.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
68 currently pending
Career history
141
Total Applications
across all art units

Statute-Specific Performance

§101
3.0%
-37.0% vs TC avg
§103
53.2%
+13.2% vs TC avg
§102
10.7%
-29.3% vs TC avg
§112
10.0%
-30.0% vs TC avg
Black line = Tech Center average estimate • Based on career data from 82 resolved cases

Office Action

§101 §102 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Objection to Specification The disclosure is objected to because of the following informalities: - The specification on pages 14-15 refers to colored markings in Table 1, such as "the corresponding nucleotide mutations are shown in red (lower case)," "the PAM sequences are shown in blue (italic)," "transversion mutations are shown in green, " while the table as filed is only in black and white. - The specification on page 16, line 6 refers to "red arrows" in describing electrophoresis result. However, it is unclear which figure this reference pertains to, and the submitted drawings are only black and white. Thus, the referenced "red arrows" cannot be identified from the present disclosure. Appropriate correction is required. Objections to Drawings The drawings are objected to because the specification describes FIGS. 4a and 4b as including "red arrows" (page 15, line 15), but the submitted drawing is only in black and white. Appropriate correction is required. Applicant is advised to submit corrected drawings and amend the specification to identify the referenced feature using markings visible in black-and-white reproduction. Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Information Disclosure Statement The information disclosure statements (IDS) submitted on 11/13/2023, 01/28/2025, 07/25/2025, 01/15/2026 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Status of Claims This office action is in response to Applicant's Response to Election / Restriction filed on May 04, 2026. No claims amendment are made in the response filed on 05/04/2026. Claims 1-15 and 17 are currently pending, with claim 17 withdrawn. Claims 1-15 are under examination. This is the first action on the merits. Election/Restrictions The species election requirement for "Species of guide RNA sequence," set forth in the office action mailed on March 02, 2026 has been withdrawn. Applicant’s election without traverse of Group I (claims 1-15) in the reply filed on May 04, 2026 is acknowledged. Claim 17 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention. Examination on the merits commences on claims 1-15. Priority The effective filling date of the instant claims 1-15 is 11/13/2023, the filling date of the instant U.S. nonprovisional application. Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Specifically, Applicant's claim to domestic priority is acknowledged as a 371 national stage entry of PCT/KR2022/006665. Applicant's claim to foreign priority to REPUBLIC OF KOREA Application 10-2021-0061037 is also acknowledged. However, neither of the submitted document is in English, and English translations have not been submitted. The domestic benefit date may be the effective filing date of the claimed invention if: • the earlier application to which domestic benefit is claimed supports the claimed invention under 35 U.S.C. 112(a). The foreign priority date may be the effective filing date of the claimed invention if: • the foreign application supports the claimed invention under 35 U.S.C. 112(a), AND • the applicant has perfected the right of priority by providing a certified copy of the priority application, and a translation of the certified copy (if not in English) along with a statement that the translation of the certified copy is accurate. See MPEP 213.04 and 216; See also MPEP 2304.01(c) In this instant case, the priority documents submitted are not in English, without a translation; without a English translation, the examiner is unable to verify whether the earlier applications provide written description support for the claimed invention under 35 U.S.C. 112(a). Thus, since an English translation of the priority application has not been filed, the effective filing date (EFD) of the claimed invention is the filing date of the application. However, if applicant perfects the right of priority by providing an certified English translation of the priority application that supports the claimed invention under 35 U.S.C. 112(a), the effective filing date will be the filing date of the foreign application. Claim Interpretation In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111. For the purpose of applying prior art, claim 1 recites "[a] guide RNA, which is a guide RNA used in the CRISPR/Cas9 system, wherein the guide RNA cleaves wild-type cell-free DNA. " Thus, the claimed guide RNA is characterized only by functional languages that outline intended use, without specifying any structural feature of the guide RNA or its target. In the absence of any specific structures in the guide RNA that directly support or relate to these functional language. The recited intended uses do not distinguish the claimed guide RNA over the prior art guide RNA. See MPEP § 2111.05. Accordingly, the guide RNA in claim 1 is interpreted under BRI to encompass any guide RNA comprising any sequence. For the purpose of applying prior art, claims 3 and 12 recites "trunk region, semi- seed region and seed region of the guide RNA." These sequence regions are defined in FIG. 3a in the present application, reproduced below: PNG media_image1.png 396 1260 media_image1.png Greyscale Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claims 1-15 are rejected under 35 U.S.C. 112(b), as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 1, it recites "the CRISPR/Cas9 system," which lacks antecedent basis. Claims 2-15 are rejected for depending from claim 1 and not remedying the indefiniteness. Claim Rejections - 35 USC § 112(a) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claims 1-15 are rejected under 35 U.S.C. 112(a) as failing to comply with the written description requirement. The claims contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. A) Claim 1 recites: A guide RNA, which is a guide RNA used in the CRISPR/Cas9 system, wherein the guide RNA cleaves wild-type cell-free DNA. Therefore, the claim recites a guide RNA, defined solely by its function of "cleaves wild-type cell-free DNA." This claim lacks sufficient written description support. By attempting to claim any and all guide RNAs with the function of "cleaves wild-type cell-free DNA," without identifying any specific, shared structural characteristics among all species in this genus, the claim constitutes a reach-through claim. Such language improperly seeks to claim all guide RNAs with the described function, both known and unknown at the time of the invention, thus failing to meet the written description requirement of 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph. Claims 2-15 are rejected because they depend from claim 1 and inherit the deficiencies of the base claim. B) Regarding claim 12, which depends from claim 11, reciting a guide RNA comprising "at least any one nucleotide sequence selected from the group consisting of SEQ ID NOs: 1 to 17." Claim 12 further requires that the guide RNA comprises a "transversion mutation" in "at least any one region selected from the group consisting of the trunk region, semi-seed region and seed region of the guide RNA." This lacks sufficient written description support because, according to the specification, only SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 9 and SEQ ID NO: 13 comprise transversion mutations in the recited regions (see Table 1). Accordingly, the disclosure does not support guide RNAs comprising SEQ ID NOs: 1, 3, 5-8, 10-12 and 14-17 as comprising transversion mutations in the recited regions. Therefore, the claims encompass subject matters that extend beyond the content disclosed in the application, failing to meet the written description requirement of 35 U.S.C. 112(a) Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1-15 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. Regarding claims 1 and 11, they are directed to guide RNAs. Following the analysis below the claims are not patent eligible under 35 U.S.C. 101. Step 1 - Whether the Claim is to a Statutory Category : YES. The claims are drawn to a guide RNA and a kit comprising guide RNA, therefore to one of the four statutory categories. Step 2A According to MPEP § 2106, Step 2A is a two-prong inquiry, in which examiners determine in Prong One whether a claim recites a judicial exception, and if so, then determine in Prong Two if the recited judicial exception is integrated into a practical application of that exception. Together, these prongs represent the first part of the Alice/Mayo test, which determines whether a claim is directed to a judicial exception. Step 2A Prong 1 - Whether the Claim Recite an Abstract idea, Law of Nature, or Natural Phenomenon: Yes. The claims recite nucleic acid sequences without specifying any unique, markedly different characteristics compared to what occurs in nature. As stated in MPEP 2106.04(b)(I), laws of nature and natural phenomena, as identified by the courts, include naturally occurring principles/relations and nature-based products that are naturally occurring or that do not have markedly different characteristics compared to what occurs in nature. Here, the claimed guide RNAs comprise sequences that are found in nature, for example in SEQ ID No: 13. DEFINITION IL5-GN0179-201000-185-f06 GN0179 Homo sapiens cDNA, mRNA sequence. ACCESSION BF989329 VERSION BF989329.1 SOURCE Homo sapiens (human) ORGANISM Homo sapiens Qy 1 TTTTGTGCTGGCCAAACTGCTGG 23 (SEQ ID NO: 13) ||||||||||||||||||||||| Db 275 TTTTGTGCTGGCCAAACTGCTGG 297 (ACCESSION BF989329) In conclusion, the claims recite nature-based products. Step 2A Prong 2 - Whether the Claim Recite Additional Elements that Integrate the Judicial Exception into a Practical Application: No. The claim as a whole do not integrates the exception into a practical application of that exception. For a claim reciting a judicial exception to be eligible, the additional elements (if any) in the claim must “transform the nature of the claim” into a patent-eligible application of the judicial exception, Alice Corp., 573 U.S. at 217, 110 USPQ2d at 1981. While the claims recite CRISPR/Cas9, the recitations constitute intended use that do not limit the claims, thus this element does not transform the claimed nature-based products to something that are markedly different than their naturally occurring counterparts in their natural state, nor does it integrate the recited judicial exception into a practical application of the exception. Further, the CRISPR/Cas9 system is also naturally occurring. See Wikipedia (CRISPR - Wikipedia; Archived March 06, 2020 on WaybackMachine). Mere combination of natural elements does not affect a change to any of the natural elements from their natural functions. See Funk Bros. Seed v. Kalo Inoculant Co., 333 U.S. 127 (1948). Claim 11 recites a kit comprising guide RNA "for diagnosing cancer or predicting cancer prognosis." The courts have repeatedly held that diagnostic claims based on naturally occurring correlations, without additional elements that impose meaningful limits on the judicial exception, are ineligible under 35 U.S.C. 101. See Athena Diagnostics, Inc. v. Mayo Collaborative Servs., LLC, 927 F.3d 1333, 1352 (Fed. Cir. 2019) (en banc) (Moore, J., dissenting) (expressing that the current interpretation of Section 101 eliminated diagnostic testing as patentable subject matter). Diagnostic testing claims fail because the novel step across the claims involves the mental step of reading the results and comparing them to a known relationship, or otherwise observing a natural law. See id. at 1336 (Lourie, J., concurring) (acknowledging that the only consistent interpretation of Supreme Court decisions resolving issues of patentable subject matter requires invalidating patents for diagnostic tests that merely observe natural laws); Roche Molecular Sys., Inc. v. CEPHEID, 905 F.3d 1363, 1372 (Fed. Cir. 2018) (explaining that observation of the relationship between the sample and known phenomena does not involve an inventive concept). It is now well settled under Federal Circuit case law that the use of conventional techniques in a standard way to observe nucleic acids in a biological sample is not eligible for patentability under 35 U.S.C. § 101. CareDx, Inc. v. Natera, Inc., 40 F.4th 1371, 1377 (Fed. Cir. 2022). Step 2B - Whether a Claim Amounts to Significantly More: No. According to MPEP§ 2106.05, The second part of the Alice/Mayo test is often referred to as a search for an inventive concept. Alice Corp. Pty. Ltd. v. CLS Bank Int'l, 573 U.S. 208, 217, 110 USPQ2d 1976, 1981 (2014) (citing Mayo Collaborative Servs. v. Prometheus Labs., Inc., 566 U.S. 66, 71-72, 101 USPQ2d 1961, 1966 (2012)). An “inventive concept” is furnished by an element or combination of elements that is recited in the claim in addition to (beyond) the judicial exception, and is sufficient to ensure that the claim as a whole amounts to significantly more than the judicial exception itself. Alice Corp., 573 U.S. at 27-18, 110 USPQ2d at 1981 (citing Mayo, 566 U.S. at 72-73, 101 USPQ2d at 1966). In this instant case, the claims, when considered as a whole, do not recite any inventive concept with additional elements that amount to significantly more than the judicial exception. The claims do not appear to add markedly different characteristics that significantly modify or use the naturally occurring oligonucleotides in a manner that is not naturally occurring. The dependent claims do not recite additional elements that amount to significantly more than the judicial exception, as they represent mere general linkage of the judicial exception to the additional elements in the claims (MPEP § 2106.05(h)). In conclusion, the claims are not patent eligible under 35 U.S.C. 101. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1-3, 5-11 and 13-15 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Sung (US20200283841A1 - Mutant cell-free dna isolation kit and mutant cell-free dna isolation method using the same; Published 2020-09-10). Regarding claim 1, Sung teaches a guide RNA ([00070-0071], guide RNA comprising mismatches added to the seed region, to recognize the wild-type DNA selectively). Regarding claim 2, Sung teaches guide RNA comprises SEQ ID NO: 10 ([0083]; SEQ ID NO: 8 “aaacttgtggtagttggagctgg” is identical to SEQ ID NO: 10 in this application). Regarding claim 3, it is anticipated by Sung because its limitation regarding "transversion mutation" does not further distinguish the claimed guide RNA from prior art guide RNA. Base claim 1 broadly encompasses any guide RNA having any target sequence, and claim 3 does not specify any reference sequence for the supposed mutation. As a mutation is defined relative to a prior or reference sequence, without a defined reference sequence, any sequence can be considered a mutation from another variable sequence. Accordingly, the recitation regarding "transversion mutation" does not impart any meaningful structural limitation to the claimed guide RNA. Regarding claims 5 and 8, Sung teaches the guide RNA is capable of detecting KRAS mutation, comprises the nucleotide sequence of SEQ ID NO: 10 ([0083]; SEQ ID NO: 8 “aaacttgtggtagttggagctgg” is identical to SEQ ID NO: 10 in this application). Regarding claims 6-7 and 9-10, they are also anticipated by Sung because they recite alternative conditional limitations stemming from base claim 5, which requires only that at least one of the recited conditions be satisfied (e.g., guide RNA is capable of detecting KRAS mutation). Since Sung teaches the required "at least any one cancer-related mutation" condition of claim 5 by anticipating claim 8, as discussed above, the alternative conditions recited in claims 6-7 and 9-10 are not required to be met. Regarding claim 11, Sung teaches a guide RNA of CRISPR/Cas9 comprises the nucleotide sequence of SEQ ID NO: 10 ([0083]; SEQ ID NO: 8 “aaacttgtggtagttggagctgg” is identical to SEQ ID NO: 10 in this application). Regarding claim 13, Sung teaches the guide RNA is capable of detecting KRAS mutation, comprises the nucleotide sequence of SEQ ID NO: 10 ([0083]; SEQ ID NO: 8 “aaacttgtggtagttggagctgg” is identical to SEQ ID NO: 10 in this application). Regarding claim 14, Sung teaches the guide RNA cleaves wild-type cell-free DNA ([0071] "The guide RNA used in the present disclosure is designed so as to recognize the wild-type DNA selectively." ). Regarding claim 15, it is anticipated by Sung because it does not recite any structural features applicable to the claimed kit. Claim 15 merely recites types of cancer, which does not distinguish the claimed kit from any prior art kit having the same structure. See MPEP 2114: “A claim containing a “recitation with respect to the manner in which a claimed apparatus is intended to be employed does not differentiate the claimed apparatus from a prior art apparatus” if the prior art apparatus teaches all the structural limitations of the claim. Ex parte Masham, 2 USPQ2d 1647 (Bd. Pat. App. & Inter. 1987)” Prior Art Below are relevant prior art not used in rejection but pertinent to the claims or disclosure. Huston (Huston et al., Identification of Guide-Intrinsic Determinants of Cas9 Specificity. CRISPR J. 2019 Jun;2(3):172-185. doi: 10.1089/crispr.2019.0009. PMID: 31225747; PMCID: PMC6694761) teaches guide RNA comprising transversion mutations that cleaves wild-type targets. See FIG. 2. The concept of using CRISPR/Cas9 to enrich cell-free DNA targets with guide RNA that selectively cleaves non-targets, is well-known in the art: See Malekshoar (Malekshoar et al., CRISPR-Cas9 Targeted Enrichment and Next-Generation Sequencing for Mutation Detection. J Mol Diagn. 2023 May;25(5):249-262. doi: 10.1016/j.jmoldx.2023.01.010. Epub 2023 Feb 24. PMID: 36841425); pages 258-259. Guide RNA transversion mutation reduces CRISPR-Cas9 system on-target residence time to a greater extent than the transition mutation, is known in the art. See Ma (Ma et al. CRISPR-Cas9 nuclear dynamics and target recognition in living cells. J Cell Biol. 2016 Aug 29;214(5):529-37. doi: 10.1083/jcb.201604115. Epub 2016 Aug 22. PMID: 27551060; PMCID: PMC5004447; Fu (Fu et al. Distinct patterns of Cas9 mismatch tolerance in vitro and in vivo. Nucleic Acids Res. 2016 Jun 20;44(11):5365-77. doi: 10.1093/nar/gkw417. Epub 2016 May 19. PMID: 27198218; PMCID: PMC4914125). Subject Matter Not Taught/Suggested in Prior Art No references were found teaching or suggesting claim 4, but it is rejected for reasons given above. The claim would be allowable if rewritten to overcome the rejections under 35 U.S.C. 112(b), 35 U.S.C. 112(a), and 35 USC § 101 set forth in this Office action and to include all of the limitations of the base claim and any intervening claims. No prior art teach of suggest an guide RNA comprising nucleotide sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, SEQ ID NO: 9 and SEQ ID NO: 13, as required by claim 4. In addition, no naturally occurring sequence is found to comprise SEQ ID NO: 2, SEQ ID NO: 4, or SEQ ID NO: 9. Therefore, if the independent claims 1 and 11 are amended to require guide RNA comprising SEQ ID NO: 2, SEQ ID NO: 4, and/or SEQ ID NO: 9, that would overcome the rejections under 35 U.S.C. 101 and 35 U.S.C. 102 in this Office Action. Conclusion This Office Action contains objections to the specification and drawings. No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /TIAN NMN YU/Examiner , Art Unit 1681 /AARON A PRIEST/Primary Examiner, Art Unit 1681
Read full office action

Prosecution Timeline

Nov 13, 2023
Application Filed
May 28, 2026
Non-Final Rejection mailed — §101, §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12662702
SEQUENCING POLYNUCLEOTIDES USING NANOPORES
3y 9m to grant Granted Jun 23, 2026
Patent 12644150
MEMBRANE-BASED, IN-GEL LOOP-MEDIATED ISOTHERMAL AMPLIFICATION (LAMP) SYSTEM AND METHOD FOR DETECTING MICROBES
4y 7m to grant Granted Jun 02, 2026
Patent 12630884
METHOD OF SELECTING RUMINATING ANIMALS FOR A DESIRABLE HEREDITABLE TRAIT
6y 3m to grant Granted May 19, 2026
Patent 12630870
Partition-free digital PCR (dPCR) system
6y 3m to grant Granted May 19, 2026
Patent 12618101
SHERLOCK ASSAYS FOR TICK-BORNE DISEASES
4y 7m to grant Granted May 05, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
56%
Grant Probability
70%
With Interview (+13.6%)
3y 10m (~1y 2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 82 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month