DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant's election with traverse of Group I, claims 1-9 in the reply filed on April 17, 2026 is acknowledged. The traversal is on the ground(s) that the biomarker combination of the application consists of only four types of bacteria, said four types recited in claim 1, and that Osman et al. do not teach one of the bacteria, that is Bifidobacterium (page 5, Response) and Gueimonde et al. while teaching Bifidocaterial microbiota, do not teach the other bacteria (page 6, Response). This is not found persuasive as the claimed combination of bacteria markers are obvious as discussed in the below rejections.
The requirement is still deemed proper and is therefore made FINAL.
Claims 10-13 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected invention, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on April 17, 2026.
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Information Disclosure Statement
The IDS received on November 14, 2023, September 25, 2025, and June 24, 2026 are proper and are being considered by the Examiner.
Specification
The specification is objected to for disclosing nucleotide sequences which are embraced by 37 CFR 1.821-1.825 (i.e., Sequence Rules), but without their corresponding SEQ ID Numbers.
Applicants must comply with the rules for their amendment to be deemed fully responsive.
Objection – New Matter
The amendment filed November 14, 2023 is objected to under 35 U.S.C. 132(a) because it introduces new matter into the disclosure. 35 U.S.C. 132(a) states that no amendment shall introduce new matter into the disclosure of the invention. The added material which is not supported by the original disclosure is as follows:
PNG
media_image1.png
183
843
media_image1.png
Greyscale
In the Amendment received on November 14, 2023, a preliminary amendment has been filed that introduces the step of relative content calculation and its formula:
However, there is no support for such an amendment because instant application has been filed as a National Phase under 371. Absent that such support was found in the PCT counterpart, the amendment made to the instant specification is objected to as the national phase must be the same application as that which was filed in the PCT international application.
Applicant is required to cancel the new matter in the reply to this Office Action.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1-9 are rejected under 35 U.S.C. 101 because the claimed invention is directed to the natural phenomenon (i.e., product of nature) without significantly more. The claims recite a combination of biomarkers from naturally existing bacteria, and a kit comprising reagents for the detection of the same. This judicial exception is not integrated into a practical application because the claimed combination of markers embrace a collection of naturally existing nucleic acid sequences that are found in nature which are considered a judicial exception, and a kit comprising additional reagents that do not collectively add more than the judicial exceptions.
The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception based on the analysis under the current Patent Eligibility Guidelines (herein, “PEG”) as discussed below.
Step 1 Inquiry under PEG
Step 1 inquiry under Patent Eligibility Guidelines (herein, “PEG”) determines whether or not the claimed invention is drawn to one of the recognized statutory classes of invention. Claims 1-9 satisfy the present inquiry as being drawn to a product in the form of a collection of biological markers, and a kit comprising said markers.
Step 2A Inquiry under PEG
A recently revised PEG now performs step 2A inquiry under a 2-prong analysis, and the subject claims analyzed accordingly as follows:
Prong 1:
Prong-1 inquiry under step 2A determines whether the claim(s) recites an abstract idea, a law of nature, or a natural phenomenon. As stated above, a “biomarker combination” that are from the recited bacteria embrace a combination of nucleic acid sequences or other biological markers of the bacteria, that exist in nature. As well, a kit comprising reagents for the detection of these biomarker combination embraces a nucleic acid sequence that are complementary to these sequences, which are deemed judicial exceptions.
Prong 2:
Prong-2 inquiry under step 2A determines whether or not the claims recite additional elements that integrate the judicial exception into a practical application in a manner that imposes a meaningful limit on the judicial exception.
Claim 1 does not recite any additional feature except that the judicial exceptions are claimed as a “combination,” that is, a collection of a naturally existing nucleic acid sequence of from of the recited bacteria (of the combination). However, combination of judicial exceptions does not render the combination patent eligible.
Claims 2, 3, and 8 recite additional features in the form of a kit, wherein the kit comprises an assay reagent for the quantification of the biomarker combination, such as quantitative PCR. However, the addition of the assay reagent is generically recited and does not intimately tie the assay reagent to the judicial exception, as reagent for quantification can be a label, a dye (intercalator), a buffer, which can be widely applied to any quantification assay, and therefore, does not add significantly more to the judicial exception.
Claims 4 and 6 further recite that a pair of primers are additionally comprised by the kit, each pair being directed to amplifying a component of the biomarker of the recited bacteria or total bacteria. However, a primer sequence is simply a complementary base sequence, which is also found in nature. Therefore, the recitation of primers is simply inclusion of additional judicial exception, which together do not amount to significantly more.
Claims 5 and 7 recite an actual nucleotide sequence of the primers in the form of their SEQ ID Numbers. However, these are sequences which are found in a naturally existing sequence of bacteria and therefore judicial exceptions and as discussed before, do not add significantly more to than the judicial exceptions themselves.
Claim 9 recites that the kit further comprises an occult blood test reagent in feces. However, the inclusion of the test reagent is widely applicable to any fecal test of any types, and not necessarily limited to the recited biomarkers. Therefore, the additional element does not meaningfully apply the judicial exception.
As explained by the Supreme Court, in order to transform a judicial exception into a patent-eligible application, the additional element or combination of elements must do ‘more than simply stat[e] the [judicial exception] while adding the words ‘apply it’”. Alice Corp. v. CLS Bank, 573 U.S. __, 134 S. Ct. 2347, 2357, 110 USPQ2d 1976, 1982-83 (2014) (quoting Mayo Collaborative Servs. V. Prometheus Labs., Inc., 566 U.S. 66, 72, 101 USPQ2d 1961, 1965). Thus, for example, claims that amount to nothing more than an instruction to apply the abstract idea using a generic computer do not render an abstract idea eligible. Alice Corp., 134 S. Ct. at 2358, 110 USPQ2d at 1983. See also 134 S. Ct. at 2389, 110 USPQ2d at 1984 (warning against a § 101 analysis that turns on “the draftsman’s art”) (MPEP 2106.05(f))
Step 2B Inquiry under PEG
Step 2B inquiry of the PEG determines whether or not additional elements are provided and whether such elements amount to significantly more than the judicial exception in the claims.
Presently, the additional elements which are provided in the claims that recite that the judicial exceptions are claimed as kit and the inclusion of buffers and nucleotides fail to further add more than the judicial exception because inclusion of such reagents do not specifically limit the presently recited judicial exception as they are widely applicable and routinely included in diagnostic kits in the field of molecular diagnostics.
Therefore, these elements are not deemed significantly more than inclusion of that are commonly used, routine and conventional.
Therefore, the present claims lack patent eligibility.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-4 and 9 are rejected under 35 U.S.C. 103 as being unpatentable over Baxter et al. (Genome Medicine, 2016, vol. 8, pages 1-10; IDS ref) in view of Mizutani et al. (Cancer Science, January 7, 2020, vol. 111, pages 766-773), and Chen et al. (Int. J. Cancer, 2019, vol. 145, pages 2021-2031).
With regard to claim 1, Baxter et al. teach a microbiota-based model for the detection of colonic lesions, wherein the artisans, “identified bacterial populations that could distinguish healthy individuals from those with adenomas or carcinomas … confirm[ing] previously observed associations of certain bacterial taxa with CRC” (page 2, 1st column, bottom paragraph).
Baxter et al. teach that, “bacteria most strongly associated with CRC belonged to taxa commonly associated with periodontal disease … includ[ing] OTUs associated with … Fusobacterium nucleatum … Parvimonas micra … Peptostreptococus stomatis” (page 3, 2nd column, bottom paragraph).
Baxter et al. also teach the test of stool sample via FIT that is known to test for hemoglobin in the stool sample (see page 3, 1st column, bottom paragraph).
Baxter et al. do not teach Bifidobacterium.
Baxter et al. do not teach a kit comprising reagents for detecting the presence of these combination of bacteria (claim 2), detection reagent being for quantitative PCR (claims 3 and 4), or occult blood test reagent (claim 9).
Mizutani et al. teach that butyrate producers (i.e., Lachnospira multipara and Eubacterium eligens) and Bifidobacterium were “depleted in several CRC stages” (page 768, 2nd column).
As well, Chen et al. also teach that Bifidobacterium was, “diminished … in stool samples from patients with CRC vs. healthy individuals.” (page 2025, 2nd column, 1st paragraph).
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Baxter et al., Mizutani et al., and Chen et al., thereby arriving at the invention as claimed for the following reasons.
As discussed above, Baxter et al. already teach that bacteria combination of Fusobacterium nucleatum, Parvimonas micra, and Peptostreptococus stomatis were associated with CRC. While Baxter et al. did not list additional bacteria known to be associated with CRC, one of ordinary skill in the art would have been motivated to combine other known bacteria associated with the same phenotype as doing so would have provided a better diagnostic.
Indeed, such a knowledge was already evidenced by Mizutani et al. who also teach that P. stomatis and P. micra were associated with stage I/II and stage III/IV CRCs, with the additional suggestion that Bifidobacterium were depleted in CRC stages, which was also found by Chen et al. that taught the diminished amount of Bifidobacterium in CRC samples when compared against healthy samples.
Also, in In re Kerkhoven, the court expressed that, “[i]t is prima facie obvious to combine two compositions each of which is taught by the prior art to be useful for the same purpose, in order to form a third composition to be used for the very same purpose…[T]he idea of combining them flows logically from their having been individually taught in the prior art.” In re Kerkhoven 626 F.2d 846, 850, 205 USPQ 1069, 1072 (CCPA 1980).
As to the packaging of the reagent for the detection of these bacteria via means such as real-time PCR into a kit, because the sequences of these bacteria have already been well-characterized1, arriving at a primer pair to from each of the bacteria and packaging them into a kit with reagents such as dyes, labels, and buffers would have been an obvious application in view of the maturation of the molecular diagnostic discipline and availability of tools available to the ordinarily skilled in the art.
Therefore, the invention as claimed is deemed prima facie obvious over the cited references.
Claims 5-8 are rejected under 35 U.S.C. 103 as being unpatentable over Baxter et al. (Genome Medicine, 2016, vol. 8, pages 1-10; IDS ref) in view of Mizutani et al. (Cancer Science, January 7, 2020, vol. 111, pages 766-773), and Chen et al. (Int. J. Cancer, 2019, vol. 145, pages 2021-2031), as applied to claims 1-4 and 9 above, and further in view of GenBank Accession No. KF933775 (publicly available June 2015) and Lee et al. (US 2016/0220619 A1, published August 2016).
The teachings of Baxter et al., Mizutani et al. and Chen et al. have already been discussed above.
While the artisans teach that the bacteria combination of Fusobacterium nucleatum, Parvimonas micra, Peptostreptococus stomatis, Bifidobacterium are associated with CRC, the artisans do not teach a pair of primers which amplify each of the bacteria for quantification via PCR or quantitative PCR. Consequently, the artisans do not teach the primer pair for each of the four bacteria in the form of SEQ ID NO: 1-8, or the primer pair directed to amplifying a total amount of bacteria in sample as SEQ ID NO: 9 and 10.
GenBank Accession No. KF933775 provides a prima facie showing that each of the bacteria sequences were known:
SEQ ID NO: 1 1 AAGTGTTAGCGGTATAGGATG 21
|||||||||||||||||||||
KF933775 232 AAGTGTTAGCGGTATAGGATG 252
Lee et al. teach a pair of primer which are utilized to amplify total amount of bacteria:
Instant SEQ ID NO: 9 1 GCAGGCCTAACACATGCAAGTC 22
||||||||||||||||||||||
Lee et al. (SEQ ID NO: 1) 1 GCAGGCCTAACACATGCAAGTC 22
Instant SEQ ID NO: 10 1 CTGCTGCCTCCCGTAGGAGT 20
||||||||||||||||||||
Lee et al. (SEQ ID NO: 2) 1 CTGCTGCCTCCCGTAGGAGT 20
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Baxter et al., Mizutani et al., and Chen et al. with the teachings of Lee et al. and the publicly available nucleotide databases, such as GenBank, thereby arriving at the invention as claimed for the following reasons.
With regard to arriving at the pair of primers for each of the bacterium associated with CRC as taught and suggested by Baxter et al., Mizutani et al. and Chen et al., doing so would have been well-within the purview of the ordinarily skilled artisan as the nucleic acid sequence of each of the bacteria were well-characterized and publicly available, as evidenced by GenBank Accession No. KF933775 showing that instant primer of SEQ ID NO: 1 is entirely found within the sequence belonging to P. stomatis sequence publicly available on GenBank. Deriving a pair of primers based on a known target nucleic acid sequence would have required one of ordinary skill in the art to employ any of commercially available primer/probe design software with routinely optimized parameters such as non-cross reactivity, reduction in dimer formation, melting temperature and G/C contents, and empirically testing the generated candidates, all of which is deemed well-within the purview of the ordinarily skilled artisan, absent secondary evidence of the claimed set of primers.
As well, with regard to the use of prior art known primer pairs for determining total amount of bacteria in a sample, because Lee et al. already taught an identical primer pair, packaging them together with the primer pairs as discussed above would have been an obvious application in view of the conventionality of kits in the analytical arts for the advantages of convenience, cost-effectiveness, matched and/or pre-weighed components, etc.
Therefore, the invention as claimed is deemed prima facie obvious over the cited references.
Conclusion
No claims are allowed.
Inquiries
Any inquiry concerning this communication or earlier communications from the Examiner should be directed to Young J. Kim whose telephone number is (571) 272-0785. The Examiner can best be reached from 7:30 a.m. to 4:00 p.m (M-F). The Examiner can also be reached via e-mail to Young.Kim@uspto.gov. However, the office cannot guarantee security through the e-mail system nor should official papers be transmitted through this route.
If attempts to reach the Examiner by telephone are unsuccessful, the Examiner's supervisor, Gary Benzion, can be reached at (571) 272-0782.
Papers related to this application may be submitted to Art Unit 1681 by facsimile transmission. The faxing of such papers must conform with the notice published in the Official Gazette, 1156 OG 61 (November 16, 1993) and 1157 OG 94 (December 28, 1993) (see 37 CFR 1.6(d)). NOTE: If applicant does submit a paper by FAX, the original copy should be retained by applicant or applicant’s representative. NO DUPLICATE COPIES SHOULD BE SUBMITTED, so as to avoid the processing of duplicate papers in the Office. All official documents must be sent to the Official Tech Center Fax number: (571) 273-8300. Any inquiry of a general nature or relating to the status of this application should be directed to the Group receptionist whose telephone number is (571) 272-1600.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/YOUNG J KIM/Primary Examiner
Art Unit 1637 June 26, 2026
/YJK/
1 Baxter et al., at page 3; Mizutani et al., at page 768, evidence the knowledge of the sequences relevant to the detected bacteria.
Prosecution Insights