DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 11/16/2023 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Status of Claims
This office action is in response to Applicant's Response to Election / Restriction and Amendment filed on June 30, 2026.
Claims 1-15 are pending, with claims 7-15 withdrawn.
Claims 1-6 are under examination. This is the first action on the merits.
Election/Restrictions
Applicant’s election without traverse of Group I (claims 1-6, a sequencing method using adaptor comprising barcode 3' of sequencing primer site) in the reply filed on June 30, 2026 is acknowledged 1.
Claims 7-15 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention.
Examination on the merits commences on claims 1-6.
Priority
The priority date of the instant claims 1-6 is May 19, 2021, filling date of the EP Patent Application Number 21174771.2, to which the present application claims priority.
Claim Interpretation
In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111.
For the purpose of applying prior art, claim 1 recites a "method for real-time sequence analysis of DNA fragments" in the preamble, the claim language "for real-time sequence analysis" is interpreted as descriptive language that does not distinguish the claimed method from prior art methods that disclose all the claimed steps.
MPEP§ 2111.04 states: "Claim scope is not limited by claim language that suggests or makes optional but does not require steps to be performed, or by claim language that does not limit a claim to a particular structure."
Here, the claim body does not include any step of performing "real-time sequence analysis." In fact, the body does not requires any analysis step. In other words, the preamble at most states the intended purpose of the claimed method and makes no manipulative difference.
Claim 2 similarly recites the method is "for parallel real-time analysis," which is also interpreted as descriptive language that does not distinguish the claimed method from prior art methods that disclose all the claimed steps. The term "parallel real-time analysis" is not a commonly-understood term in the art with clearly defined steps, this description does not clearly require any additional step or modify any step of the claimed method.
For the purpose of applying prior art, claim 4 recites "real-time data analysis," the application's disclosure does not provide an express definition for this term.
Under BRI and in view of the commonly understood meaning of "real-time" in the art, such as in real-time PCR 2, "real-time data analysis" is interpreted to mean data analysis performed during, or simultaneously with, the process in which the data is being collected. This interpretation aligns with the claim reciting “real-time data analysis during the sequencing process.”
For the purpose of applying prior art, claim 1 recites "adapter oligonucleotides," which is defined in the specification as follows:
"As used herein, an “adapter oligonucleotide” to an oligonucleotide or oligo, which is a nucleic acid molecule, which is a polymer of nucleotides, either deoxyribonucleotides or ribonucleotides (DNA or RNA oligos), of a relative short length, wherein the nucleotides are joined together by a phosphodiester linkage between 5′ and 3′ carbon atoms." (page 31, lines 5-8)
Accordingly, "adapter oligonucleotides" is interpreted to encompass any polynucleotides that comprise nucleotides joined together by phosphodiester linkage between 5′ and 3′ carbon atoms, including DNA and RNA.
For the purpose of applying prior art, claim 1 recites the terms "flow cell binding sequence," "read 1 sequencing primer site," "read 2 sequencing primer site," and "sample-specific barcoding sequence" ꟷ these terms are not expressly defined by any structural features in the claims or the specification. Accordingly, under the broadest reasonable interpretation, they encompass any polynucleotide sequences.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 2 and 5-6 are rejected under 35 U.S.C. 112(b), as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
A) Regarding claim 2, the phrase “such as” renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
B) Regarding claim 5, it recites "preferably" in the following claim languages:
"the assignment of (preferably all) sequencing reads in the flow cell to the corresponding sample of DNA fragments based on the detected sample-specific barcoding-sequence" ;
"wherein preferably the data analysis is performed by a computer program."
The term "preferably" suggests subjectivity and does not clearly delineate whether the feature is a requirement of the claim or merely an illustrative example. This uncertainly prevents determination of the scope with reasonable certainly.
C) Regarding claim 5, the use of parenthetical language in "(preferably all)" and "(i.e., results being reported before the end of the sequencing process)" makes it unclear whether the claim language within the parentheses represent a limitation of the claim, or merely a suggestion.
D) Regarding claim 5, it recites:
"provision of sample-specific data analysis results during the sequencing process, for example with respect to the presence of one or more specific DNA sequences in the sample"
"editing of the raw sequencing data, e.g. correcting detected sequencing errors and/or removing human reads from the raw sequencing data, for example to comply with data protection standards"
the phrases “for example” and "e.g." renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
E) Regarding claim 6, the phrase “such as” in "such as an infection and related antimicrobial resistances" renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. See MPEP § 2173.05(d).
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-6 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Shiroguchi (K. Shiroguchi et al. , Digital RNA sequencing minimizes sequence-dependent bias and amplification noise with optimized single-molecule barcodes, Proc. Natl. Acad. Sci. U.S.A. 109 (4) 1347-1352, doi.org/10.1073/pnas.1118018109 (2012); with supplementary information), as evidenced by
Illumina Data Analysis (Sequencing Data Analysis Solutions; www .illumina.com/informatics/sequencing-data-analysis.html; Archived Apr 14, 2020 on WaybackMachine); and
EcSeq Bioinformatics (How are base qualities calculated and stored?; www .ecseq.com/support/ngs/how-are-base-qualities-calculated-and-stored; February 28, 2018).
Shiroguchi teaches methods comprising optimized barcoding for RNA sequencing on the Illumina platform (abstract; Fig.1).
Regarding claim 1, Shiroguchi teaches a method comprising:
providing at least one sample of DNA fragments for sequence analysis (Fig. 1A, sample containing cDNA fragments),
connecting one kind of first and second adapter oligonucleotides to the 5′ and 3′ ends of a DNA strand of the DNA fragments of the sample (Fig. 1B), respectively, wherein:
a first adapter oligonucleotide (Fig. 1B, Y-Adaptor comprising Barcode 1, top strand; for example see Supporting Dataset S1, Barcode ID 0, seq A) comprises from 5′ to 3′:
a first flow cell binding sequence (Supporting Dataset S1, Barcode ID 0, Y adaptor sequence A that does not hybridize to seq B, “ACACTCTTTCCCTACACGA”, as shown in bold italics text in modified Fig below ”),
a read 1 sequencing primer site (Supporting Dataset S1, Barcode ID 0, Y adaptor sequence A, “CGCTCTTCCGATCT”, as shown in underlined italics text in modified Fig below ”),
a sample-specific barcoding sequence (Supporting Dataset S1, Barcode ID 0, Y adaptor sequence A, “TTCATATGTCTTGTCTCAGGC”, as shown in bold text in modified Fig below ”), and
a second adapter oligonucleotide (Fig. 1B, Y-Adaptor comprising Barcode 1, bottom strand; for example see Supporting Dataset S1, Barcode ID 0, seq B) comprises from 5′ to 3′:
a sequence complementary to the sample-specific barcoding sequence of the first adapter oligonucleotide (Supporting Dataset S1, Barcode ID 0, Y adaptor sequence B, “3-AAGTATACAGAACAGAGTCCG-5”, as shown in bold text in modified Fig below ”),
a read 2 sequencing primer site (Supporting Dataset S1, Barcode ID 0, Y adaptor sequence B, “GCGAGAAGGCTAGA”, as shown in underlined italics text in modified Fig below ”), and
a second flow cell binding sequence (Supporting Dataset S1, Barcode ID 0, Y adaptor sequence B that does not hybridize to seq A, “3 – GAGCCGTAAGGACGACTTG-5”, as shown in bold italics text in modified Fig below ”),,
wherein first and second adapter oligonucleotides of one kind have complementary barcoding sequences (Fig. 1B ; Supporting Dataset S1), and
sequencing of the DNA fragments comprising the connected adapter oligonucleotides in a sequencing by synthesis (SBS) process (Fig. 1, Illumina sequencing, which is sequencing by synthesis as identified in the present specification, see “BACKGROUND OF THE INVENTION”).
PNG
media_image1.png
468
818
media_image1.png
Greyscale
Regarding claim 2, Shiroguchi teaches at least two samples (Fig. 1A, at least two cDNAs are processed and sequenced in parallel using Illumina sequencing),
at least two samples of DNA fragments are provided (Fig. 1A, cDNA 1 and cDNA 2 molecules are at least 2), and for each sample a different kind of first and second adapter oligonucleotides are connected to the 5′ and 3′ ends of a DNA strand of the DNA fragments (Fig. 1B),
wherein different kinds of adapter oligonucleotides have different barcoding sequences (Fig. 1; Supporting Dataset S1) , and
wherein the DNA fragments from the at least two samples comprising the connected first and second adapter oligonucleotides are sequenced in one reaction vessel (Fig. 1A; see also p.5, left-hand col, lines 23-25 “Samples with barcoded adapters were sequenced on an Illumina HiSeq 2000 with 2 × 100 (for the first sequencing run) and 2 × 50 (for the second) base paired-end reads in one lane” ).
Regarding claim 3, Shiroguchi teaches the connecting of the adapter oligonucleotides via ligation (Fig. 1B).
Regarding claim 4, Shiroguchi teaches Illumina sequencing, which has built-in real-time data analysis during sequencing, as evidenced by Illumina Data Analysis.
See Illumina Data Analysis:
"Primary Data Analysis
Real-Time Analysis (RTA) software operates during cycles of sequencing chemistry and imaging, providing base calls and associated quality scores representing the primary structure of DNA or RNA strands. This built-in software performs primary data analysis on Illumina sequencing systems automatically." (page 1)
Regarding claim 5, Shiroguchi teaches Illumina sequencing, which has built-in real-time data analysis during sequencing using Real-Time Analysis (RTA) software operates during cycles of sequencing chemistry and imaging, comprising evaluation of the reliability and completeness of real-time analysis results using algorithmic and statistical methods, as evidenced by Illumina Data Analysis (p. 1) and EcSeq Bioinformatic (p.1).
Specifically, Illumina Data Analysis discloses the Real-Time Analysis (RTA) software operates during cycles of sequencing chemistry and imaging, providing base calls and associated quality scores representing the primary structure of DNA or RNA strands.
EcSeq Bioinformatics provides detailed teaching on Illumina base calls and associated quality scores. Base calling is the data analysis process of identifying each nucleotide base on a given sequence cluster on a flow cell based on image data, this is performed for every cluster, on every tile, for every sequencing cycle simultaneous with a sequencing run (ecSeq Bioinformatics, p.1.” How a quality score is born”).
Quality score reflects base calling error probabilities and is reported as precent accuracy for each base and across all bases in a given sequence (ecSeq Bioinformatics, Table 1). The calculation of quality score uses Phred algorithm that carries out statistical calibration (ecSeq Bioinformatics, p.1.” How a quality score is born”). Accordingly, a skilled artisan would readily understand that Illumina’s real-time data analysis comprising providing base calls and associated quality scores, involves evaluation of the reliability and completeness of real-time analysis results (i.e., a sequence comprising base calls with low quality score would have been considered as having low reliability and low completeness, as the low quality bases will not be useful for downstream analysis and need to be removed) using algorithmic and statistical methods.
Regarding claim 6, it is anticipated by Shiroguchi because it does not further limit the claimed method.
Claim 6 recites :
wherein the method is used for:
the diagnosis of a medical condition, such as an infection and related antimicrobial resistances,
determining microbial compositions of a sample,
diagnosis or prognosis of an autoimmune disease, a transplant rejection reaction, a genetic disorder, or cancer;
the detection of genetically modified organisms; or
a forensic or hygiene analysis.
Per MPEP 2111.04, a wherein clause can limit a method claim if it contributes meaning and purpose to the manipulative steps.
In this instant case, the wherein clause is interpreted as a statement of intended use or field of use that does not limit the claimed sequencing method. The claim does not recite any additional manipulative step required for diagnosis, determining microbial compositions, forensic analysis, or other listed uses; nor does the claim clearly requires modifying any step of the claimed method for each of the application.
As such, this clause merely describes alternative applications of the sequencing method, without modifying any step of the claimed method.
Therefore, this claim language is interpreted as descriptive statement without any associated active steps and does not distinguish the claims from the prior art.
Prior Art
Below are relevant prior art not used in rejection but pertinent to the claims or disclosure.
Barcoded sequencing adaptors are well-known in the art:
See Fig. 1 in Schmitt et al., Detection of ultra-rare mutations by next-generation sequencing. Proc Natl Acad Sci U S A. 2012 Sep 4;109(36):14508-13. doi: 10.1073/pnas.1208715109. Epub 2012 Aug 1. PMID: 22853953; PMCID: PMC3437896;
See Figure 1 in Wong et al., Multiplex Illumina sequencing using DNA barcoding. Curr Protoc Mol Biol. 2013;Chapter 7:Unit 7.11.. doi: 10.1002/0471142727.mb0711s101. PMID: 23288465;
See Fig. 1 in Atashpaz-Gargari, et al., , "OBGene: Optimal barcode generator for NGS experiments," Proceedings 2012 IEEE International Workshop on Genomic Signal Processing and Statistics (GENSIPS), Washington, DC, USA, 2012, pp. 90-94, doi: 10.1109/GENSIPS.2012.6507734.
Methods comprising real-time mapping of Illumina reads while sequencing are known in the art:
See Lindner et al., HiLive: real-time mapping of illumina reads while sequencing. Bioinformatics. 2017 Mar 15;33(6):917-319. doi: 10.1093/bioinformatics/btw659. PMID: 27794555;
See Loka et al. Reliable variant calling during runtime of Illumina sequencing. Sci Rep 9, 16502 (2019).; doi.org/10.1038/s41598-019-52991-z;
See Loka, T.P., 2020. Advanced Strategies for Alignment-based Real-time Analysis and Data Protection in Next-Generation Sequencing (Fortschrittliche Strategien für alignierungs-basierte Echtzeit-Analyse und Datenschutz in Next-Generation Sequencing) (Doctoral dissertation, FU Berlin, Germany); published 2020-02-21
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIAN NMN YU/Examiner , Art Unit 1681
1 Claims 7-15 are withdrawn as being drawn to non-elected groups II-III.
2 "A real-time polymerase chain reaction (real-time PCR), also known as quantitative Polymerase Chain Reaction (qPCR), is a laboratory technique of molecular biology based on the polymerase chain reaction (PCR). It monitors the amplification of a targeted DNA molecule during the PCR (i.e., in real time), not at its end, as in conventional PCR. "
Wikipedia (Real-time polymerase chain reaction - Wikipedia; Archived March 09, 2021 on WaybackMachine)
Prosecution Insights