CTNF 18/563,790 CTNF 100577 DETAILED ACTION Notice of Pre-AIA or AIA Status 07-03-aia AIA 15-10-aia The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. Claims 1-11, 14, 17-20, 23, 26-27, and 52 are pending and under consideration. Priority Applicant’s claim for the benefit of provisional application 63/192,801 (filed 05/25/2021) is acknowledged. The disclosure of provisional application 63/192,801 fails to provide support for instant claims 3-7, 9-11, 14, 19, 20, 26, and 52. Accordingly, instant claims 1-2, 8, 17-18, 23, and 27 are entitled to an effective filing date of 05/25/2021, while instant claims 3-7, 9-11, 14, 19, 20, 26, and 52 are entitled to an effective filing date of 05/24/2022, which is the filing date of PCT/US22/30680. Information Disclosure Statement Receipt of an information disclosure statement on 07/22/2024 is acknowledged. The signed and initialed PTO-1449 has been mailed with this action. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: ►Specific deficiency - The Incorporation by Reference paragraph required by 37 CFR 1.821(c)(1) is missing or incomplete. See item 1) a) or 1) b) above. Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required incorporation-by-reference paragraph, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. ►Specific deficiency – Nucleotide and/or amino acid sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). Sequence identifiers for nucleotide and/or amino acid sequences must appear either in the drawings or in the Brief Description of the Drawings. See Figures 1B, 6, 7, and 8A. Required response – Applicant must provide: Replacement and annotated drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers; AND/OR A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers into the Brief Description of the Drawings, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Claim Objections 07-29-01 AIA Claim s 1, 4-7, 18-20, and 23 are objected to because of the following informalities: Claim 1 recites “ s aCas9” (bolded and underlined emphasis added) rather than “ S aCas9” (bolded and underlined emphasis added), which is recited throughout the rest of the claim set. For purposes of internal consistency, it would be remedial to recite “ S aCas9” (bolded and underlined emphasis added) throughout the entire claim set. Claims 4-7 all recite the acronym “HF” without first defining said acronym. Prior to the first recitation of an acronym, it is proper to define said acronym for purposes of clarity. While the acronym “HF” is not defined in the instant claim set or in the instant specification, “HF” typically refers to “high fidelity” variants in the field. For purposes of clarity, it would be remedial to first define the acronym “HF” as “high fidelity.” Claims 18-20 recite AAV serotypes 9, rh10, and rh74, respectively. However, these recitations are not internally consistent. AAV9 is recited as “an AAV serotype 9 (AAV9) vector,” while AAVrh10 and AAVrh74 are recited as “an AAVrh10 vector” and “an AAVrh74 vector.” For purposes of internal consistency, it would be remedial to recite all AAV serotypes in a consistent manner. With further regard to claim 18, there is a mark preceding “an AAV serotype 9 (AAV9) vector,” which may be a strikethrough removing an extra space or a dash. If the mark is a dash, it would be remedial to remove the dash. If the mark is a strikethrough removing an extra space, no correction is needed. Claim 23 recites “the composition comprises any one or more of the following promoters: U6, H1, and 7SK promoter ” (bolded emphasis added), which does not comport with standard grammatical and/or linguistic conventions. It would be remedial to amend the instant claim language to comport with standard grammatical and/or linguistic conventions, for example by reciting “the composition comprises any one or more of the following promoters: U6, H1, and 7SK.” This is merely an example set forth by the Examiner and is not intended to be limiting . Appropriate correction is required. Claim Rejections - 35 USC § 112(b) 07-34-01 Claims 8 and 9 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. With regard to claim 8, which recites “the method of claim 1, further comprising SaCas9 or a nucleic acid encoding the same,” it is noted that claim 1 recites a method, said method comprising delivering to a cell a composition comprising a nucleic acid encoding an SaCas9. Claim 8 does not recite any further limitations of the claimed method. Instead, claim 8 recites further limitations of a product. As set forth above, the method of claim 1 comprises two products: a cell and a composition. It is not clear from claim 8 whether the recited SaCas9 is a further limitation of the cell of the method of claim 1 or of the composition of claim 1, or even whether both the cell and the composition may comprise the recited SaCas9. It is noted that the composition of claim 1 is already recited to comprise a nucleic acid encoding an SaCas9. Thus, it is not clear whether the recited nucleic acid encoding SaCas9 of instant claim 8 is an additional nucleic acid encoding SaCas9 that is part of the claimed composition of the method of claim 1, a nucleic acid encoding SaCas9 that is part of the claimed cell, or even whether both the cell and the composition may comprise the nucleic acid encoding SaCas9 of instant claim 8. Instant claim 9 depends from instant claim 8 and does not resolve the basis of the indefiniteness rejection set forth above. Therefore, claim 9 is also rejected as being indefinite. It would be remedial to amend the instant claim language such that it is clear whether the claimed SaCas9 is a further limitation of the cell, the composition, or both of instant claim 1. One such recitation could be “the method of claim 1, wherein the cell further comprises SaCas9 or a nucleic acid encoding the same.” This is merely an example set forth by the Examiner for purposes of clarity. Applicant should ensure that there is sufficient support for any amendments to the instant claim language and that any amendments do not introduce new issues under 35 U.S.C. 112(d), as instant claim 1 already recites a nucleic acid encoding an SaCas9, as set forth above. Claim Rejections - 35 USC § 102 07-07-aia AIA 07-07 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – 07-08-aia AIA (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. 07-12-aia AIA (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. 07-15 AIA Claim s 1, 8, 17, 18, 20, and 23 are rejected under 35 U.S.C. 102( a)(1) and 35 U.S.C. 102(a)(2 ) as being anticipated by WO 2020/214613 A1 (hereinafter Gersbach) . With regard to claim 1, which recites “a method of gene editing comprising delivering to a cell a composition comprising a nucleic acid encoding an [S]aCas9, an sgRNA or multiple copies of the same sgRNA, and an adeno-associated virus (AAV) vector,” Gersbach discloses AAV vectors encoding a CRISPR/Cas-based genome editing system, said composition encoding Staphylococcus aureus Cas9 and an sgRNA targeting a fragment of a mutant dystrophin gene (paragraphs [0005], [00027], and [00079]). These compositions are disclosed to be for purposes of restoring dystrophin function by delivering the AAV vector set forth above to a host cell (paragraphs [00085], [00086], [00098], and [000101]). Thus, Gersbach discloses each and every limitation of instant claim 1. With regard to claim 8, which recites “the method of claim 1, further compris[es] SaCas9 or a nucleic acid encoding the same,” as set forth above, Gersbach discloses AAV vectors encoding a CRISPR/Cas-based genome editing system, said composition encoding Staphylococcus aureus Cas9 and an sgRNA targeting a fragment of a mutant dystrophin gene (paragraphs [0005], [00027], and [00079]). Thus, Gersbach discloses each and every limitation of instant claim 8. With regard to claim 17, which recites “the adeno-associated virus (AAV) vector [of the method of claim 1] is an…AAVrh74, or AAV9 vector, wherein the number following AAV indicates the AAV serotype,” Gersbach discloses that the AAV vector taught therein may be an AAV9 or an AAVrh.74 vector (paragraph [0005]). Thus, Gersbach discloses each and every limitation of instant claim 17. With regard to claim 18, which recites “the AAV vector [of the method of claim 17] is an AAV serotype 9 (AAV9) vector,” as set forth above, Gersbach discloses that the AAV vector taught therein may be an AAV9 or an AAVrh.74 vector (paragraph [0005]). Thus, Gersbach discloses each and every limitation of instant claim 18. With regard to claim 20, which recites “the AAV vector [of the method of claim 17] is an AAVrh74 vector,” as set forth above, Gersbach discloses that the AAV vector taught therein may be an AAV9 or an AAVrh.74 vector (paragraph [0005]). Thus, Gersbach discloses each and every limitation of instant claim 20. With regard to claim 23, which recites “the composition [of the method of claim 1] comprises any one or more of the following promoters: U6, H1, and 7SK…”, Gersbach discloses that the guide RNAs taught therein are controlled under a U6 promoter (Examples 1-3), as instantly claimed. Thus, Gersbach discloses each and every limitation of instant claim 23 . 07-15 AIA Claim s 26 and 52 are rejected under 35 U.S.C. 102( a)(1) and 35 U.S.C. 102(a)(2 ) as being anticipated by WO 2022/020107 A1 (hereinafter Subramanian) . With regard to claim 26, which recites “a composition comprising a single-molecule guide RNA (sgRNA) comprising a spacer sequence, or a nucleic acid encoding the sgRNA, wherein…the spacer sequence comprises ACTCTGGTGACACAACCTGTG (SEQ ID NO: 37)…” Subramanian discloses oligonucleotide-based molecular payloads targeted to muscle cells for purposes of treating dystrophinopathies such as Duchenne muscular dystrophy (paragraph [0004]), said oligonucleotides including guide RNAs that exist as a single molecule (i.e. sgRNA) and comprise a spacer portion that defines the DNA target sequence to which the gRNA binds (abstract; paragraphs [0005], and [000418]-[000420]). These oligonucleotide-based molecular payloads are disclosed to comprise any one of SEQ ID NOs: 437-1241 (paragraph [00016]). As shown in the alignment below, SEQ ID NO: 523 of Subramanian comprises instant SEQ ID NO: 37. PNG media_image1.png 155 623 media_image1.png Greyscale Thus, it is considered that Subramanian discloses each and every limitation of instant claim 26. PNG media_image1.png 155 623 media_image1.png Greyscale Similarly, with regard to claim 52, which recites “a method of treating Duchenne Muscular Dystrophy (DMD), the method comprising delivering to a cell a composition comprising a single-molecule guide RNA (sgRNA) comprising a spacer sequence, or a nucleic acid encoding the sgRNA, wherein:…the spacer sequence comprises ACTCTGGTGACACAACCTGTG (SEQ ID NO: 37)…”, as set forth above, Subramanian discloses oligonucleotide-based molecular payloads targeted to muscle cells for purposes of treating dystrophinopathies such as Duchenne muscular dystrophy (paragraph [0004]), said oligonucleotides including guide RNAs that exist as a single molecule (i.e. sgRNA) and comprise a spacer portion that defines the DNA target sequence to which the gRNA binds (abstract; paragraphs [0005], and [000418]-[000420]). These oligonucleotide-based molecular payloads are disclosed to comprise any one of SEQ ID NOs: 437-1241 (paragraph [00016]). As shown in the alignment below, SEQ ID NO: 523 of Subramanian comprises instant SEQ ID NO: 37. Thus, it is considered that Subramanian discloses each and every limitation of instant claim 52 . Claim Rejections - 35 USC § 103 07-20-aia AIA The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 07-22-aia AIA Claim s 2-9 are rejected under 35 U.S.C. 103 as being unpatentable over WO 2020/214613 A1 (hereinafter Gersbach) as applied to claim s 1 and 8 above, and further in view of Tan et al., 2019 (hereinafter Tan), WO 2022/056000A1 (hereinafter Gromada; as cited in the IDS filed 07/22/2024), and WO 2019/213776 A1 (hereinafter Doyon) . The disclosure of Gersbach is described above and applied as before (see section Claim Rejections - 35 USC § 102 ). However, this disclosure does not teach the SaCas9 variants and sequences thereof of instant claims 2-9. With regard to claim 2, which recites “the SaCas9 [of the composition of the method of claim 1] is a KKH variant,” as set forth above, Gersbach anticipates the composition of the method of claim 1. However, Gersbach does not disclose that the Staphylococcus aureus Cas9 taught therein is a KKH variant, as instantly claimed. This deficiency is cured by Tan, which discloses high-fidelity KKH SaCas9 variants (abstract). Tan discloses that the KKH SaCas9 variant has a wider PAM recognition range, facilitating targeting of more sequences (abstract). Thus, Tan discloses each and every additional limitation of instant claim 2. With regard to claim 3, which recites “the KKH variant of SaCas9 [of claim 2] comprises the amino acid sequence of SEQ ID NO: 41,” as set forth above, Tan discloses that the KKH SaCas9 variant has a wider PAM recognition range, facilitating targeting of more sequences (abstract). However, Tan does not disclose that the KKH variant taught therein comprises the sequence of SEQ ID NO: 41. This deficiency is cured by Gromada, which discloses that SEQ ID NO: 715 taught therein is a KKH SaCas9 variant (paragraph [00141] and [00162]). As shown in the alignment of Appendix I , SEQ ID NO: 715 of Gromada comprises instant SEQ ID NO: 41. Thus, Gromada discloses each and every additional limitation of instant claim 3. With regard to claim 4, which recites “the SaCas9 [of the composition of the method of claim 1] is a HF variant,” as set forth above, Tan discloses high-fidelity KKH SaCas9 variants (abstract). Tan further discloses that the high-fidelity KKH SaCas9 variants taught therein reduced off-target editing and increased on- to off-target editing ratios, thereby facilitating exceptional genome-wide editing precision (abstract). Thus, Tan discloses each and every additional limitation of instant claim 4. With regard to claim 5, which recites “the HF variant of SaCas9 [of claim 4] comprises the amino acid sequence of SEQ ID NO: 42,” as set forth above, Tan discloses that the high-fidelity SaCas9 variants taught therein increase on- to off-target editing ratios, thereby facilitating exceptional genome-wide editing precision (abstract). However, Tan does not disclose that the high-fidelity variant taught therein comprises the sequence of SEQ ID NO: 42. This deficiency is cured by Gromada, which discloses that SEQ ID NO: 716 taught therein is a high-fidelity SaCas9 variant (paragraph [00163]). As shown in the alignment of Appendix II , SEQ ID NO: 716 of Gromada comprises instant SEQ ID NO: 42. Thus, Gromada discloses each and every additional limitation of instant claim 5. With regard to claim 6, which recites “the SaCas9 [of the composition of the method of claim 1] is a KKH-HF variant,” as set forth above, Tan discloses high-fidelity KKH SaCas9 variants (abstract). Tan discloses that the KKH SaCas9 variant has a wider PAM recognition range, facilitating targeting of more sequences (abstract). Tan further discloses that the high-fidelity KKH SaCas9 variants taught therein reduced off-target editing and increased on- to off- target editing ratios, thereby facilitating exceptional genome-wide editing precision (abstract). Thus, Tan discloses each and every additional limitation of instant claim 6. With regard to claim 7, which recites “the KKH-HF variant of SaCas9 [of claim 5] comprises the amino acid sequence of SEQ ID NO: 43,” as set forth above, Tan discloses that the high-fidelity KKH SaCas9 variants taught therein increase on- to off-target editing ratios, thereby facilitating exceptional genome-wide editing precision (abstract). However, Tan does not disclose that the high-fidelity variant taught therein comprises the sequence of SEQ ID NO: 43. This deficiency is cured by Gromada, which discloses that SEQ ID NO: 717 taught therein is a high-fidelity KKH SaCas9 variant (paragraph [00164]). As shown in the alignment of Appendix III , SEQ ID NO: 717 of Gromada comprises instant SEQ ID NO: 43. Thus, Gromada discloses each and every additional limitation of instant claim 7. With regard to claim 9, which recites “the SaCas9 [of the method of claim 8] comprises the amino acid sequence of SEQ ID NO: 40,” as set forth above, Gersbach anticipates each and every limitation of instant claim 8. However, Gersbach does not disclose that the SaCas9 taught therein comprises the amino acid sequence of instant SEQ ID NO: 40. This deficiency is cured by Doyon, which discloses that SEQ ID NO: 15 taught therein corresponds to Cas9 derived from Staphylococcus aureus (page 13: description of Figure 9). As shown in the alignment of Appendix IV , SEQ ID NO: 15 of Doyon comprises instant SEQ ID NO: 40. Thus, Doyon discloses each and every additional limitation of instant claim 9. Given that Gersbach discloses the method of claim 1 (as set forth above), said method comprising a composition comprising a nucleic acid encoding an SaCas9, and that: Tan discloses high-fidelity KKH SaCas9 variants that reduce off-target editing and increase on- to off-target editing ratios, thereby facilitating exceptional genome-wide editing precision; Gromada discloses SEQ ID NOs: 715-717, corresponding to a KKH SaCas9 variant, a high-fidelity SaCas9 variant, and a high-fidelity SaCas9 variant, respectively; and Doyon discloses SEQ ID NO: 3, corresponding to SaCas9, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to encode SaCas9 (as disclosed in Gersbach and Doyon) or high-fidelity and/or KKH variants thereof (as disclosed in Tan and Gromada) to predictably target a wide range of genomic sites with a high level of precision. One would have been motivated to make such a modification in order to receive the expected benefit of targeting a wide range of genomic sites with a high level of precision . 07-22-aia AIA Claim s 10, 11, and 14 are rejected under 35 U.S.C. 103 as being unpatentable over WO 2020/214613 A1 (hereinafter Gersbach) as applied to claim 1 above, and further in view of Basila et al., 2017 (hereinafter Basila) . The disclosure of Gersbach is described above and applied as before (see section Claim Rejections - 35 USC § 102 ). However, this disclosure does not teach the sgRNA modifications of instant claims 10, 11, and 14. With regard to claim 10, which recites “the sgRNA [of the composition of the method of claim 1] is modified,” as set forth above, Gersbach discloses the composition of the method of claim 1. However, Gersbach does not disclose the instantly claimed sgRNA modifications. This deficiency is cured by Basila, which discloses that chemical modifications to sgRNAs, such as 2’-O-methyl modifications and 3’ phosphorothioate linkages can be beneficial to CRISPR-Cas9 gene editing by improving stability of the sgRNA and increasing gene editing efficiency (abstract). Thus, Basila discloses each and every additional limitation of instant claim 10. With regard to claim 11, which recites “the modification [of the method of claim 10] alters one or more 2’ positions and/or phosphodiester linkages,” as set forth above, Basila discloses that chemical modifications to sgRNAs, such as 2’-O-methyl modifications and 3’ phosphorothioate linkages can be beneficial to CRISPR-Cas9 gene editing by improving stability of the sgRNA and increasing gene editing efficiency (abstract). Thus, Basila discloses each and every additional limitation of instant claim 11. With regard to claim 14, which recites “the modification [of the method of claim 10] comprises one or more of a phosphorothioate modification, a 2’-OMe modification, a 2’-O-MOE modification, a 2’-F modification, a 2’-O-methine-4’ bridge modification, a 3’-thiophosphonoacetate modification, or a 2’-deoxy modification,” as set forth above, Basila discloses that chemical modifications to sgRNAs, such as 2’-O-methyl modifications and 3’ phosphorothioate linkages can be beneficial to CRISPR-Cas9 gene editing by improving stability of the sgRNA and increasing gene editing efficiency (abstract). Thus, Basila discloses each and every additional limitation of instant claim 14. Given that Gersbach discloses the method of claim 1 (as set forth above), said method comprising a composition comprising a nucleic acid encoding an SaCas9 and one or more sgRNAs, and that Basila discloses that chemical modifications to sgRNAs, such as 2’-O-methyl modifications and 3’ phosphorothioate linkages can be beneficial to CRISPR-Cas9 gene editing by improving stability of the sgRNA and increasing Cas9-mediated gene editing efficiency, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to modify the sgRNA of Gersbach to comprise 2’-O-methyl modifications and 3’ phosphorothioate linkages (as disclosed in Basil) to predictably improve sgRNA stability and increase Cas9-mediated gene editing efficiency. One would have been motivated to make such a modification in order to receive the expected benefit of improving sgRNA stability and increasing Cas9-mediated gene editing efficiency . 07-22-aia AIA Claim 27 is rejected under 35 U.S.C. 103 as being unpatentable over WO 2022/020107 A1 (hereinafter Subramanian) as applied to claim 26 above, and further in view of Tan et al., 2019 (hereinafter Tan) . The disclosure of Subramanian is described above and applied as before (see section Claim Rejections - 35 USC § 102 ). However, this disclosure does not teach the KKH SaCas9 variant of instant claim 27. With regard to claim 27, which recites “the composition of claim 26, further compris[es] a KKH variant of SaCas9 or a nucleic acid encoding the same,” as set forth above, Subramanian discloses delivery of sgRNAs for purposes of treating DMD via CRISPR-Cas9 editing. However, Subramanian does not disclose that said editing is accomplished by the KKH SaCas9 variant. This deficiency is cured by Tan. Tan discloses high-fidelity KKH SaCas9 variants having a wider PAM recognition range, thereby facilitating targeting of more sequences (abstract). The KKH SaCas9 variants taught in Tan are disclosed to facilitate exceptional genome-wide editing precision (abstract). Thus, Tan discloses each and every additional limitation of instant claim 27. Given that Subramanian discloses the composition of claim 26 (as set forth above), and that Tan discloses high-fidelity KKH SaCas9 variants that reduce off-target editing and increase on- to off-target editing ratios, thereby facilitating exceptional genome-wide editing precision, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to treat DMD via CRISPR-Cas9 editing (as disclosed in Subramanian) via the KKH SaCas9 variant (as disclosed in Tan) to predictably target a wide range of genomic sites, including the dystrophin gene (as in Subramanian), with a high level of precision. One would have been motivated to make such a modification in order to receive the expected benefit of targeting a wide range of genomic sites with a high level of precision. Conclusion No claims are allowed. Claims 1, 4-7, 18-20, and 23 are objected to. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Sarah E Allen whose telephone number is (571)272-0408. The examiner can normally be reached M-Th 8-5, F 8-12. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /SARAH E ALLEN/ Examiner, Art Unit 1637 /J. E. ANGELL/ Primary Examiner, Art Unit 1637 Application/Control Number: 18/563,790 Page 2 Art Unit: 1637 Application/Control Number: 18/563,790 Page 3 Art Unit: 1637 Application/Control Number: 18/563,790 Page 4 Art Unit: 1637 Application/Control Number: 18/563,790 Page 5 Art Unit: 1637 Application/Control Number: 18/563,790 Page 6 Art Unit: 1637 Application/Control Number: 18/563,790 Page 7 Art Unit: 1637 Application/Control Number: 18/563,790 Page 8 Art Unit: 1637 Application/Control Number: 18/563,790 Page 9 Art Unit: 1637 Application/Control Number: 18/563,790 Page 10 Art Unit: 1637 Application/Control Number: 18/563,790 Page 11 Art Unit: 1637 Application/Control Number: 18/563,790 Page 12 Art Unit: 1637 Application/Control Number: 18/563,790 Page 13 Art Unit: 1637 Application/Control Number: 18/563,790 Page 14 Art Unit: 1637 Application/Control Number: 18/563,790 Page 15 Art Unit: 1637 Application/Control Number: 18/563,790 Page 16 Art Unit: 1637
Prosecution Insights