CTNF 18/570,967 CTNF 101373 DETAILED ACTION Notice of Pre-AIA or AIA Status 07-03-aia AIA 15-10-aia The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. Application Status This action is written in response to applicant’s correspondence received on 06/18/2024 . Claims 1, 4, 6, 8, 10-12, 14, 16-23, 25, 29, 31, and 34-35 are currently pending. Information Disclosure Statement 06-49-06 AIA The listing of references in the specification (Pages: 25-28, 44-47) is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered. Priority This application is a 371 of PCT/US2022/033859 filed on 06/16/2022. Acknowledgment is made of applicant's claim for priority based on an application PRO 63/211,295 filed on 06/16/2021 is acknowledged. Drawings The drawings are objected to for the following reasons: 37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG."” In the current case, the view numbers for Figures 1A-20C are preceded by the word " Figure " instead of the abbreviation " FIG. ". 06-22 Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification 07-29-04 The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code on pages 28 and 46 . Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. The use of the terms: Amplex, TRIzol, Vetscan, Hibiclens, Abaxis, VetScan, Biolegend, Graphpad PRISM, StepOnePlus, ChemDoc, ImageLab, Bio-Rad, Sigma-Aldrich, Abcam, Sysmex, Invitrogen, Santa Cruz, Molecular Probes, Thermo Fisher Scientific or Thermo Fisher, Roche, SuperScript III, SYBR and derivatives like Power SYBR, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Rejections - 35 USC § 112 07-30-02 AIA The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 07-34-01 Claim 8 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 8 recites “ an antisense oligonucleotide or a guide RNA specific for both U32a and U35a ”. Furthermore, the specification or sequence listing does not teach an ASO or gRNA specific for both U32a and U35a as there is insufficient homology, i.e. short Box C(tgatgt), D’ (cgga), and D (ctga) motifs across the Rpl13a snoRNAs, between U32a and U35a to enable common individual ASO or gRNA sequences specific for both snoRNAs, as shown by Michel ( Small nucleolar RNAs U32a, U33, and U35a are critical mediators of metabolic stress. Cell Metab. 2011 Jul 6;14(1):33-44; Listed on the IDS M61G6MRCWFYGX62….pdf filed on 01/17/2025; Figure 3D, see below ) . The alignments between U32a and U35a across human and murine sequences are show further below. Although Zangemeister-Wittke ( A novel bispecific antisense oligonucleotide inhibiting both bcl-2 and bcl-xL expression efficiently induces apoptosis in tumor cells. Clin Cancer Res. 2000 Jun;6(6):2547-55 ) teaches bi-specific ASOs with capability to reduce or inhibit two different nucleic acid targets, substantial homology is required because “ the bcl-2 and bcl-xL mRNAs share a region of homology comprising nucleotides 605–624 and 687–706, respectively, which differs by only three nucleotides ” ( Page 2547, Abstract, lines 2-5 ). This creates ambiguity as to what is required in terms of “specificity”. PNG media_image1.png 200 400 media_image1.png Greyscale SEQ ID NO: 52 Mus musculus SNORD32a/U32a 81nt gagtccatgatgagcaaca ctcaccatctttcgtttgagtctcacgactgtgagatcaacccatgcaccgctctgagactc | ||||||| | ||||| || | | | || | || | |||| || || ggcacatgatgttcttattctcacgatggtcttcggatgccacagttagggcagtgccgataatgccaaaggctaagctgatgccagga SEQ ID NO: 55 Mus musculus SNORD35a/U35a 89nt SEQ ID NO: 49 Homo sapiens SNORD32a 82nt aggtcagtgatgagcaacattcaccatctttcgtttgagtctcacggccatgagat caacccca tg caccgctc tgagacct || ||||| | |||| || | | ||| | | | | ||| ||| || | ||| || ggcagatgatgtccttatctcacgatggtctgcggatgtccctgtgggaatggcgacaatgccaatggcttagctgatgccagga SEQ ID NO: 56 Homo sapiens SNORD35a 85nt 07-36 AIA The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. 07-36-01 AIA Claim 10 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Regarding claim 10, claim 1 , the independent claim that claim 10 depends from, already requires “ an antisense oligonucleotide or a guide RNA specific for U34 ”, which is inherently complementary to at least a portion of the snoRNA. Hence, claim 10 fails to further limit the scope of claim 1 . Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 112 Written Description 07-30-01 AIA The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. 07-31-01 AIA Claim s 8 , 16-18 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”. For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly , 119 F.3d at 1568, 43 USPQ2d at 1406. Claim 8 encompasses a broad genus of structures, not only traditional monovalent and monospecific antisense oligonucleotides or gRNA but also polyvalent variants, which do not require target homology as evidenced by Moeller ( US 2018 / 0127754 A1, Bivalent antisense oligonucleotides; Published on 05/10/2018; Filed on 11/10/2017 ), which teaches bi-valent ASOs that link two distinct ASOs using a linking moiety to inhibit or reduce non-homologous targets ( Page 108; claim 12 ), and Bagchi ( Polyvalent Guide RNAs for CRISPR AntiviralsbioRxiv 2021.02.25.430352 ), which teaches that polyvalent guide RNAs (pgRNAs) can target and degrade pairs of viral targets with significant sequence divergence ( up to 40% nucleotide differences; Page 1, Abstract, line 22 ) in higher plants. The broad genus also encompasses polyspecific, e.g. bispecific, variants (see Zangemeister-Wittke discussed above), which require target substantial homology. Since complementarity to the target(s) is a key structural limitation, claim 8 encompasses diverse structures. The instant specification discloses that “ The ASO used in the examples were 20 nucleotides in length and the full length was complementary to the targeted snoRNA, but the ASO can be as short as 15 nucleotides, or as long as the full length of the snoRNA or any length in between. The ASO need not be fully complementary to the snoRNA and can tolerate some mismatches especially if a longer ASO is used ” ( Page 14, Lines 20-24 ). Since the Rpl13a snoRNAs range from 66nt to 89nt ( SEQ ID NOs: 49-56 ) and all ASOs used in Examples exclusively have a length of 20nt, the examples do not represent most of the claimed species encompassed by the genus. The absence of any gRNAs in Examples further accentuate the lack of written description. Claim 16 encompasses a method of treating hemoglobinopathies in a subject in need thereof, the method comprising administering a therapeutically effective amount of a broad genus of “ a composition capable of reducing and/or inhibiting a Rpl13a snoRNA in a subject or cell ”. The recited “a composition” is not limited in terms of structure. However, the phrase “ capable of reducing and/or inhibiting a Rp113a snoRNA in a subject to cell ” is a functional limitation . Accordingly, the possession of the claimed method of treating requires possession of the genus of any composition that has this required function. Furthermore , this limitation does not require direct actions on the Rpl13a snoRNAs . Methods using compositions with indirect inhibitory effects on a Rpl13a snoRNA also read on the claim under the broadest reasonable interpretation (BRI). The specification only discloses limited embodiments of the claimed genus on page 13, lines 14-21: “ Rpll3a snoRNA may be decreased by any means known in the art. These include, but are not limited to, RNA-based RNA interference including siRNA, and shRNA, …, full or partial gene deletion or gene editing or mutation, non-homologous end joining or Transcription Activator-Like Effector Nucleases (TALENs). In some embodiments, an antisense oligonucleotide (ASO) is used to reduce or inhibit the activity of the snoRNA ” and 4 references of gRNAs by terminology only ( Page 20, lines 18-29 ). The rest of the specification focuses on ASOs Although Example II in the specification demonstrates the in vivo knockdown of snoRNAs in red blood cells by reciting “ in vivo knocking-down U34 and U35a (U34+U35a KD) in sickle mice with U34-ASO and U35a-ASO significantly down-regulated U34 and U35a expression in sickle RBCs… and lowered sickle RBC ROS generation by 71 % compared to sickle mice injected with the control GFP-ASO ” ( Page 51, lines 8-11 ), the guidance is generally prophetic regarding the broad genus of structures as claimed because there are no working examples for the claimed gRNAs , CRISPR associated nucleases , or TALENs , or those ASO species longer than 20nt in length, with imperfect complementarity, bispecific, or polyvalent . Hence, there is no correlation between function and the full scope of diverse structures. Given that claim 16 does not require direct actions on Rpl13a snoRNAs under BRI, state of the art indicates that there is a broad classes of agents that are capable of reducing or inhibiting a Rpl13a snoRNA. Holley ( Cytosolic accumulation of small nucleolar RNAs (snoRNAs) is dynamically regulated by NADPH oxidase. J Biol Chem. 2015 May 1;290(18):11741-8; Listed on the IDS M61G5HDVWFYGX53….pdf filed on 01/17/2025 ) teaches that small molecules, such as the superoxide scavenger Mn(III)TMPyP [MnT] or the Nox inhibitor DPI, could regulate Rpl13a snoRNAs by inhibiting their cytosolic accumulation ( Page 11744, left column, last ¶, lines 3-9; Figure 2A ). Holley (2015) further teaches that snoRNA-ribonucleoprotein complexes involving RNA-modifying enzymes such as fibrillarin or dyskerin are crucial for the RNA modifying functions of Rpl13a snoRNAs in the nucleus ( Page 11741, first ¶, lines 6-12 ). Any inhibitors for these proteins could inhibit Rpl13a snoRNAs indirectly. These observations indicate that highly variant structures could indirectly reduce or inhibit the distribution or activities of Rpl13a snoRNAs. This notion is further enhanced by Velagapudi ( Approved Anti-Cancer Drugs Target Oncogenic Non-Coding RNAs. Cell. Chem. Biol., 25 (2018), pp. 1086-1094.e7 ), which teaches that direct interactions between small molecule drugs and non-coding RNAs can be identified via microarray-based approach that allows for FDA approved drugs to be screened for interactions with RNA motif libraries in a massively parallel format. However, this approach suggests that the scope of the genus is broad and encompasses unpredictable structures because the interactions between small molecules and non-coding RNAs are not well understood, highly unpredictable, and largely unknown in the art. The disclosure of insufficient species of a broad genus, the high degree of variation in the art, and the failure to disclose correlation between structure in the specification and the claimed function led to the determination that claims 8 and 16 are overly broad with insufficient evidence of possession at the time of filing to one skilled in the art. Claims 17 and 18 depend from claim 16 , yet both fail to remedy the lack of written description therein. Therefore, claims 8, 16-18 do not meet the written description requirement . Claim Rejections - 35 USC § 103 07-06 AIA 15-10-15 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. 07-20-aia AIA The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. 07-23-aia AIA The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. 07-20-02-aia AIA This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. 07-21-aia AIA Claim s 1, 4, 6, 8, 10-12 are rejected under 35 U.S.C. 103 as being unpatentable over Michel ( 2011; full citation in §112b above ) in view of Holley (2015; full citation above in §112 rejection) . Michel (2011) teaches that a cocktail, i.e. a composition, of three ASOs targeting U32a, U33, and U35a, which are Rpl13a snoRNAs ( Page 33, Title and Abstract, lines 7-10 ), effectively and simultaneously knocked down, i.e. reduced, palmitate-induced expression of all three snoRNAs in murine myoblasts ( Page38, left column, first 4 lines; Figure 5A ) in the process to establish the roles of these snoRNAs as critical mediators of metabolic stress. Michel further teaches the Rpl13a snoRNA sequences of humans, mice, and hamsters ( Page 36, Figure 3D; Also shown in §112b rejection above ), laying out the strategies to design ASOs targeting all 4 Rpl13a snoRNAs, U32a, U33, U34, and U35a. Michel does not teach a U34 specific ASO in the composition because U34 was not observed to reach elevated or detectable levels in the cell type used for investigation ( Page 36, Figure 3E ). However, Holley (2015) teaches that U32a, U33, and U34 snoRNAs, which are Rpl13a snoRNAs, “ may orchestrate the response to environmental stress through molecular interactions outside of the nucleus ” ( Page 11741, Abstract, last sentence ) because they are increased in cytoplasm of rat H9c2 cardiomyoblasts under oxidative stress ( Page 11743, left column, first ¶, lines 10-13; Fig. 1B ), indicating a crucial role for all 4 snoRNAs. Holley’s observations would motivate persons of ordinary skill in the art (PHOSITAs) to follow the strategies of Michel to concoct a composition or cocktail of ASOs specific for targeting each of all 4 Rpl13a snoRNAs, including U34, in order to determine if such a strategy would also infer resistance to oxidative stress just like Michel did to confer resistance to lipotoxicity and oxidative stress (Page 33, Abstract, lines 7-12). Since Michel didn’t have a chance to knock down U34 due to low expression levels in the cell types used for investigation, Holley’s teaching provides strong motivation for PHOSITAs to design ASO specific for U34 based on the sequences taught by Michel (Page 36, Figure 3D) to concoct compositions comprising ASOs targeting U32a, U33, U34, U35a, or various combinations thereof, and would have arrived at the claimed invention. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have modified the composition of Michel (2011) by adding an ASO specific for U34, using the same ASO strategy taught by Michel but motivated by Holley (2015) in view of the sequences of the murine or human U34 snoRNA provided by Michel ( Page 36, Figure 3D ) such that a composition capable of reducing or inhibiting a Rpl13a snoRNA comprising an antisense oligonucleotide specific for U34 could have been prepared to investigate the potential roles of U34 and other snoRNAs in the development of resistance to oxidative stress, by attempting to reduce or inhibit the snoRNAs in cells showing abundant cytoplasmic accumulations of U34, U32a, U33, and/or U35a, and would have arrived at the claimed invention. The recitation “capable of reducing or inhibiting…” is intended use or outcome and does not recite structural distinctions over the prior art Michel (2011). It is also well understood in the art that antisense oligonucleotides are inherently capable of reducing or inhibiting a target RNA molecule with substantial complementarity therewith, as demonstrated successfully for U32a, U33, and U35a by Michel (2011). Given the success of Michel in ASO-based knockdown of U32a, U33, and U35, there is reasonable expectation of success in observing the reduction in U34 levels using specific ASOs as well. Regarding claim 1 , PHOSITAs could have combined the teachings, strategies, and motivations of Michel and Holley and have concocted a custom composition capable of reducing or inhibiting a Rpl13a snoRNAs in a cell and/or a subject, such that the composition can be used to investigate the potential roles of Rpl13a snoRNAs in the development of resistance to oxidative stress , wherein at least some embodiments of the composition would have comprised an antisense oligonucleotide or a guide RNA specific for U34, particularly given the lack of knock down information for U34 in the art. Regarding claim 4 , PHOSITAs could have combined the teachings, strategies, and motivations of Michel and Holley and could have concocted a custom composition capable of reducing or inhibiting a Rpl13a snoRNA in a cell and/or a subject to investigate the biological roles of Rpl13a snoRNAs in the development of resistance to oxidative stress, wherein at least some embodiments of the composition would have comprised an ASO or a gRNA specific for U35a, in addition to one or more specific for U34. Regarding claim 6 , PHOSITAs could have combined the teachings, strategies, and motivations of Michel and Holley and could have concocted a custom composition capable of reducing or inhibiting a Rpl13a snoRNA in a cell and/or a subject to investigate the potential roles of Rpl13a snoRNAs in the development of resistance to oxidative stress, wherein at least some embodiments of the composition would have comprised an ASO or a gRNA specific for U32a, in addition to one or more specific for U34. Regarding claim 8 , PHOSITAs could have combined the teachings, strategies, and motivations of Michel and Holley and could have concocted a custom composition capable of reducing or inhibiting a Rpl13a snoRNA in a cell and/or a subject to investigate the potential roles of Rpl13a snoRNAs in the development of resistance to oxidative stress, wherein at least some embodiments of the composition would have comprised an ASO or a gRNA specific for each of U35a, U32a, and U34. Regarding claim 10 , since complementarity with the target RNA is an inherent requirement for effective antisense oligonucleotide, hence the term “antisense” in the name, PHOSITAs could have combined the teachings, strategies, and motivations of Michel and Holley, and could have concocted an embodiment of claim 1 , wherein the ASO(s) is (are) complementary to a portion of the snoRNA. Regarding claim 11 , Michel further teaches that “ 2’-O-methyl-modified anti-sense oligos (ASOs) were designed to specifically target murine U32a, U33, U35a …” ( Page 42, right column, 2 nd ¶). Regarding claim 12 , Michel further teaches 20nt (>15nt) ASOs specific for U32a, U33, and U35a ( Page 13 of the supplemental information, while the main article is listed in one of the IDSs as indicated above, the supplemental information pdf is attached herein and listed in PTO-892 form ) . 07-21-aia AIA Claim s 14, 16-19, 21, 23, 25, 34, 35 are rejected under 35 U.S.C. 103 as being unpatentable over Collard ( US 2010/0280100 Al, Published on Nov. 10, 2010, filed on April 30, 2010 ) in view of NIH RePORTER ( Published in 2017; See NIH RePORTER_2017_Role of RBC Reactive Oxygen Species and Sickle Cell Disease.pdf attached and listed on PTO-892 ), further in view of Michel ( 2011; see full citation above ) in view of Holley ( 2015; full citation see above ) . Collard (2010) teaches a method of treating hemoglobinopathies (Page 29, claim 36) comprising administering a therapeutically effective amount of a composition, wherein the composition comprises at least one antisense oligonucleotide…( Page 28, claims 30-35 ). Collard does not teach targeting oxidative stress in red blood cells using antisense oligonucleotides specific for Rpl13a snoRNAs to treat hemoglobinopathies such as anemia (e.g., Fanconi's anemia), thalassemia (e.g., beta-thalassemia etc.), sickle cell disease, leukemia, etc. ( Page 29, claim 36 ). However, NIH RePORTER (2017) published the abstract and award information for the 1R01HL137930-01 award to one of the inventors, Dr. Rashima Zennadi, regarding her project titled “ Role of RBC Reactive Oxygen Species and Their Vicious Cycle in Sickle Vasculopathy ” ( See attached screen shot pdf attached and listed on PTO-892. The information can be independently verified by querying at https://reporter.nih.gov/ ). NIH RePORTER teaches that “ small nucleolar RNAs (snoRNAs) as regulators of RBC ROS. Specifically, these unusual regulators of cellular ROS are present in sickle RBCs at high levels that correspond to elevated ROS levels and RBC adhesion ” ( Page 2, lines 4-8 ) and “ silencing these snoRNAs in mice reduces ROS levels in normal and sickle RBCs ” ( Page 2, lines 19-20 ). NIH RePORTER further teaches that “ Our long-term goal is to identify remediable sickle RBC abnormalities to reduce oxidative damage and vasoocclusion ” ( Page 2, lines 32-25 ) and “ also lay the foundation for more rational approaches to therapies that better prevent oxidative damage and vasoocclusion in SCD ” ( Page 2, last 3 lines ), and finally “ development of new effective therapies to curtail painful vascular occlusion is critical to reducing the disease's morbidity ” (Page 3, lines 4-6 ). Since hemoglobinopathies include Sickle Cell Disease (SCD) involving sickle red blood cells (RBCs), this report provides motivation to silence snoRNAs to treat at least one type of hemoglobinopathies, SCD, or at least to explore the feasibilities. Neither Collard nor NIH RePORTER teaches the composition capable of reducing or inhibiting a Rpl13a snoRNA in a cell and/or a subject. However, Michel (2011) and Holley (2015) collectively teaches using a composition capable of reducing or inhibiting a Rpl13a snoRNA in a cell and/or a subject, wherein the composition comprises antisense oligonucleotides specific for a Rpl13a snoRNA, U34, U35a, U32a, and/or U33. See the teachings of Michel (2011) and Holley (2015) already discussed above. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have modified the composition of Collard (2010) by replacing ASOs specific for hemoglobin(HBF/HBG) using ASOs specific for U34, U32a, U35a, and/or U33 under the teachings and strategies of Michel (2011) and Holley (2015), based on the motivation provided by NIH RePORTER ’s report linking sickle RBCs to oxidative stress that has been demonstrated to be inhibited by silencing snoRNAs, thus would have arrived at the claimed invention. Regarding claim 14 , Collard further teaches a “ pharmaceutical composition ” ( Page 2, ¶[0015] ) with “ suitable pharmaceutically acceptable diluent or carrier ” ( Page 19, ¶[0184] ). Regarding claim 16 , PHOSITAs would have arrived at the claimed invention by combining the teachings, strategies, and motivations of Collard , NIH RePORTER , Michel , and Holley with a simple substitution and simple combination rationale. Regarding claim 17 , Collard claimed thalassemia (e.g., beta-thalassemia etc.), sickle cell disease ( Page 29, claim 36 ), and NIH RePORTER discussed Sickle cell Disease, and vascular occlusion, i.e. vasoocclusion (Page 2, last line). Regarding claim 18 , both Collard and NIH RePORTER discussed subjects in need of treatment for Sickle cell Disease (see citations above). Regarding claim 19, NIH RePORTER recites “ small nucleolar RNAs (snoRNAs) as regulators of RBC ROS. Specifically, these unusual regulators of cellular ROS are present in sickle RBCs at high levels that correspond to elevated ROS levels and RBC adhesion ” ( Page 2, lines 4-8 ) and “ silencing these snoRNAs in mice reduces ROS levels in normal and sickle RBCs ” ( Page 2, lines 19-20 ). However, the recitation “ decreases and/or inhibits ROS in sickle cell disease ” by claim 19 is intended use, thereby carrying no patentability weight. Regarding claim 21 , PHOSITAs would have arrived at the claimed invention by combining the teachings, strategies, and motivations of Collard , NIH RePORTER , Michel , and Holley with a simple substitution and simple combination rationale, and would have modified the composition of Collard (2010) by replacing ASOs specific for hemoglobin (HBF/HBG) using ASOs specific for U34, U32a, U33, and U35a, with at least one embodiment of a composition capable of reducing or inhibiting a Rpl12a snoRNA, wherein the composition comprises an antisense oligonucleotide specific for the Rpl13a snoRNA U34, which is the composition of claim 1 . Regarding claim 23 , PHOSITAs would have arrived at the claimed invention by combining the teachings, strategies, and motivations of Collard , NIH RePORTER , Michel , and Holley with a simple substitution and simple combination rationale, and would have modified the composition of Collard (2010) by replacing ASOs specific for hemoglobin (HBF/HBG) using ASOs specific for U34, U32a, U33, U35a, with at least one embodiment of a composition capable of reducing or inhibiting a Rpl12a snoRNA, wherein the composition comprises a cocktail of antisense oligonucleotides with at least one specific for each of the Rpl13a snoRNAs U34, U32a, U33, and U35a, which of course comprises at least one specific for U32a. Regarding claim 25 , PHOSITAs would have arrived at the claimed invention by combining the teachings, strategies, and motivations of Collard , NIH RePORTER , Michel , and Holley with a simple substitution and a simple combination rationales, and would have modified the composition of Collard (2010) by replacing ASOs specific for hemoglobin (HBF/HBG) using ASOs specific for U34, U32a, U33, and U35a, with at least one embodiment of a composition capable of reducing or inhibiting a Rpl12a snoRNA, wherein the composition comprises a cocktail of antisense oligonucleotides with at least one specific for each of the Rpl13a snoRNAs U34, U32a, U33, and U35a, which of course comprises at least one specific for U35a. Regarding claim 34 , PHOSITAs would have arrived at the claimed invention by combining the teachings, strategies, and motivations of Collard , NIH RePORTER , Michel , and Holley with a simple substitution and a simple combination rationales, and would have modified the composition of Collard (2010) by replacing ASOs specific for hemoglobin (HBF/HBG) using an ASO or ASOs specific for any of the Rpl13a snoRNAs, thus, at least one embodiment would have arrived at the claimed method in claim 16 , wherein the composition comprises an ASO. Regarding claim 35 , based on sequence listing, SEQ ID NOs: 49, 51, and 56 correspond to Homo sapiens Rpl13a snoRNAs U32a, U34, U35a, respectively. PHOSITAs would have arrived at the claimed inventions based on discussion above before the effective filing date by combining the teachings, strategies, and motivations of Collard , NIH RePORTER , Michel , and Holley with a simple substitution and a simple combination rationale. Since Michel (2011) lists these sequences (SEQ ID NOs: 49, 51, and 56) in Figure 3D (Page 36), Collard (2010) includes human homologs of all Rpl13a snoRNAs (Page 2, ¶[0026], first 5 lines), and NIH RePORTER (2017) recites relevance to human health (Page 3, first ¶), the collective teachings of prior arts would have led PHOSITAs to experimental on human cells and attempt to treat human hemoglobinopathies that would require using ASOs targeting human Rpl13a snoRNAs . 07-21-aia AIA Claim s 29 and 31 are rejected under 35 U.S.C. 103 as being unpatentable over Robitzski ( Robitzski_2021_There Are Now Two Pushes to Treat Sickle Cell Disease With CRISPR.pdf, attached and listed in PTO-892 form ; Source: https://crisprmedicinenews.com/news/there-are-now-two-pushes-to-treat-sickle-cell-disease-with-crispr/ ) in view of Filippova ( Are Small Nucleolar RNAs "CRISPRable"? A Report on Box C/D Small Nucleolar RNA Editing in Human Cells.Front Pharmacol. 2019 Nov 4;10:1246 ), further in view of NIH RePORTER ( 2017; full citation above ) and Schaffer ( Death by lipids: The role of small nucleolar RNAs in metabolic stress. J Biol Chem. 2020 Jun 19;295(25):8628-8635. ). Robitzski (2021 January) teaches a CRISPR/Cas9 gene-editing system composition for ex vivo gene editing of patient derived hematopoietic stem: a CRISPR nuclease, i.e. Cas9, and a guide RNA, i.e. gRNA ( Page 5, lines 8-10 ) to treat Sickle Cell Disease. Robitzski does not teach using a CRISPR-gRNA ribonucleoprotein complex (RNP) composition to reduce or inhibit a Rpl13a snoRNA, nor does it teach that CRISPR gene-editing involving a guide RNA targeting snoRNAs can be successful. However, Filippova (2019) teaches that “ Box C/D small nucleolar RNAs can be edited via CRISPR/Cas9-mediated cleavage at the regions near the conserved elements boxes C, C,’ D, and D,’ and specific downregulation of a target box C/D snoRNA can be achieved ” ( Page 14, Conclusions, first 4 lines ). Filippova further teaches how to design single guide RNAs (sgRNAs) to target snoRNAs ( Page 3, FIGURE 2 ). Neither Robitzski nor Filippova teaches that Sickle Cell Disease (SCD) can be treated by using CRISPR gene-editing system involving a guide RNA (gRNA) targeting Rpl13a snoRNAs. However, NIH RePORTER (2017) teaches that “ small nucleolarRNAs (snoRNAs) ” are shown in red blood cells (RBCs) as “ regulators of RBC ROS. Specifically, these unusual regulators of cellular ROS are present in sickle RBCs at high levels that correspond to elevated ROS levels and RBC adhesion” and that “ silencing these snoRNAs in mice reduces ROS levels in normal and sickle RBCs ”. NIH RePORTER does not teach how to silence snoRNA using CRISPR gene-editing system, or how to design gRNAs against which snoRNAs to reduce ROS in sickle RBCs. However, Schaffer (2020) teaches that the cytoplasmic accumulation of Rpl13a box C/D snoRNAs, U32a, U33, U34, and U35a are master regulators of oxidative stress involving ROS increase in various cell types, and knock-down or knock-out of these box C/D snoRNAs provide resistance to oxidative stress in various cell types, organs, and mice ( Page 8630, Rounding up new suspects; Page 8631, Questions and controversies; Page 8632, Figure 2 ). Schaffer concludes that “ The intriguing metabolic phenotypes of mice with loss of function of the Rpl13a snoRNAs suggest that altered snoRNA expression or function could contribute to metabolic health and disease… ” ( Page 8632, last 4 lines ). It would have been obvious for a PHOSITA before the effective filing date of the instant application to combine the teachings, strategies, and motivations of Robitzski (2021 January), Filippova (2019), NIH RePORTER (2017), and Schaffer (2020) to modify the composition of Robitzski with gRNAs against the Rpl13a box C/D snoRNAs designed with Filippova ’s teaching, substituting the snoRNAs of Filippova using human or murine Rpl13a snoRNA sequences, motivated by the early observation and hypothesis regarding the role of ROS and oxidative stress in SCD, taught by NIH RePORTER , as well as the knock-down/knock-out effects taught by Schaffer , also motivated by the FDA approval of Graphite Bio’s Investigational New Drug (IND) application to initiate clinical trial for CRISPR-based SCD therapies taught by Robitzski (Page 2, first ¶), to arrive at the claimed invention of a method for treating and/or preventing SCD in a subject in need thereof, the method comprising administering a therapeutically effective amount of a composition capable of reducing and/or inhibiting a Rp113a snoRNA in a subject or cell, wherein the composition comprises a gRNA. Regarding claim 29 , PHOSITAs would have arrived at the claimed invention based on a simple combination and a simple substitution rationale. Regarding claim 31 , both NIH RePORTER (2017) and Schaffer (2020) further teach the involvement of all 4 Rpl13a box C/D snoRNAs, i.e. U32a, U33, U34, U35a in the regulation of cellular oxidative stress in health and diseases in various cell types. Since the roles of each snoRNAs for RBC or sickles cells are known in the art, PHOSITAs would have been motivated to concoct different compositions comprising different single or combinations of gRNAs targeting any of the 3 Rpl13a snoRNAs. At least one embodiment of the various compositions would have comprised at least one of gRNAs specific for U32a and/or U35a as part of a routine laboratory optimization effort to identify the most effective recipe for the composition. Double Patenting 08-33 AIA The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg , 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman , 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi , 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum , 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel , 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington , 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA. A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA/25, or PTO/AIA/26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. US Application 18/861,505 Claims 1, 4, 6, 8, 10-12, 14, 34-35 are provisionally rejected on the ground of nonstatutory double patenting as being anticipated by claims 1-7 of the copending Application No. 18/861,505 . Claims 16-19, 21, 23, 25 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 8-9, 11-20, 22 of copending US Application 18/861,505 in view of NIH RePORTER ( 2017; full citation above ). Although the claims at issue are not identical, they are not patentably distinct from each other. US Application 18/861,505 teaches a composition or pharmaceutical composition comprising one or more antisense oligonucleotide(s) capable of binding at least one of an Rp113a snoRNA, U32a, U33, U34 or U35a, or at least one antisense oligonucleotide in the set capable of binding to each of U32a, U33, U34 or U35a, or combinations thereof (claims 1-7). The claimed antisense oligonucleotide sequences (SEQ ID NOs: 1-4, 17-84) confirm this based on sequence complementarity alignment analysis with human or murine Rpl13a snoRNAs target sequences claimed in the instant claim (instant SEQ ID NOs: 49, 51, 56, for human snoRNAs U32a, U34, U35a, respectively) or in the instant specification (SEQ ID NOs: 50, 52-55 for human snoRNA U33, murine snoRNAs U32a, U33, U34, U35a, respectively), see examples below: SEQ ID NO: 17 of US Application 18/861,505 Query 1 AGCGGTGCATGGGGTTGATC 20 |||||||||||||||||||| Sbjct 73 AGCGGTGCATGGGGTTGATC 54 Instant SEQ ID NO: 49 (Homo sapiens U32a or SNORD32A) SEQ ID NO: 1 of US Application 18/861,505 Query 1 GCGGTGCATGGGTTGATCTC 20 |||||||||||||||||||| Sbjct 71 GCGGTGCATGGGTTGATCTC 52 Instant SEQ ID NO: 52 (Mus musculus U32a or SNORD32a) SEQ ID NO: 2 of US Application 18/861,505 Query 1 TGGTAGTGCATGTAGAGTCA 20 |||||||||||||||||||| Sbjct 71 TGGTAGTGCATGTAGAGTCA 52 Instant SEQ ID NO: 53 (Mus musculus U33 or SNORD33) SEQ ID NO: 3 of US Application 18/861,505 Query 1 CAGTGCTGCTTTCATGAGGA 20 |||||||||||||||||||| Sbjct 56 CAGTGCTGCTTTCATGAGGA 37 Instant SEQ ID NO: 51 (Homo sapiens U34 or SNORD34) SEQ ID NO: 4 of US Application 18/861,505 Query 1 TTAGCCTTTGGCATTATCGG 20 |||||||||||||||||||| Sbjct 76 TTAGCCTTTGGCATTATCGG 57 Instant SEQ ID NO: 55 (Mus musculus U35a or SNORD35a) SEQ ID NO: 28 of US Application 18/861,505 Query 1 TCATGAGGATCAAACAATGT 20 |||||||||||||||||||| Sbjct 45 TCATGAGGATCAAACAATGT 26 Instant SEQ ID NO: 51 (Homo sapiens U34 or SNORD34) SEQ ID NO: 72 of US Application 18/861,505 Query 1 AGACCATCGTGAGATAAG 18 |||||||||||||||||| Sbjct 31 AGACCATCGTGAGATAAG 14 Instant SEQ ID NO: 56 (Homo sapiens U35a or SNORD35A) Regarding claim 1 , since some of these claimed ASO sequences in US Application 18/861,505 show 100% complementarity at a 20nt length to at least one of Rpl13a snoRNA target sequences comprising an antisense oligonucleotide or a guide RNA specific for U34 (e.g. SEQ ID NOs: 3 or 28) as claimed in claims 1-6 of US Application 18/861,505 , at least some embodiments of the claims 1-6 of US Application 18/861,505 anticipate the instant claim 1 . The clause “capable of reducing and/or inhibiting a Rp113a snoRNA in a cell and/or subject” is intended use, and carry no patentability weight as it imposes no structural limitation in a product claim. Regarding claim 4 , since some of these claimed ASO sequences in US Application 18/861,505 show 100% complementarity at a 20nt length to at least one of Rpl13a snoRNA target sequences comprising an antisense oligonucleotide or a guide RNA specific for U34 (e.g. SEQ ID NOs: 3 or 28), as discussed above, and at least one embodiment could also comprise an antisense oligonucleotide or a guide RNA specific for U35a (e.g. SEQ ID NOs: 4) in addition as claimed in claims 1-6 of US Application 18/861,505 , thus, at least one embodiment of the claims 1-6 of US Application 18/861,505 anticipate the instant claim 4 , i.e. a composition comprising an antisense oligonucleotide or a guide RNA specific for U34 in addition to an antisense oligonucleotide or a guide RNA specific for U35a. Regarding claim 6 , since some of these claimed ASO sequences in US Application 18/861,505 show 100% complementarity at a 20nt length to at least one of Rpl13a snoRNA target sequences comprising an antisense oligonucleotide or a guide RNA specific for U34 (e.g. SEQ ID NOs: 3 or 28), as discussed above, and at least one embodiment could also comprise an antisense oligonucleotide or a guide RNA specific for U32a (e.g. SEQ ID NOs: 1 or 17) in addition as claimed in claims 1-6 of US Application 18/861,505 , thus, at least one embodiment of the claims 1-6 of US Application 18/861,505 anticipate the instant claim 6 , i.e. a composition comprising an antisense oligonucleotide or a guide RNA specific for U34 in addition to an antisense oligonucleotide or a guide RNA specific for U32a. Regarding claim 8 , based on the interpretation that the claim requires a composition to comprise at least an antisense oligonucleotide or a guide RNA specific for each of U34, U35a, and U32a, i.e. 3 separate ASOs specific for each Rpl13a snoRNA, at least one embodiment claimed by claims 1-6 of US Application 18/861,505 anticipates the instant claim 6 because of the discussion above regarding instant claims 1, 4, 6 . Regarding claim 10 , at least some of embodiments of the claimed ASOs in claims 1-6 of US Application 18/861,5050 are complementary to at least a portion of the target snoRNA as evidenced by the sequence alignment examples above, therefore, the instant claim 10 is anticipated by claims 1-6 of US Application 18/861,505 . Regarding claim 11 , US Application 18/861,505 claims numerous ASO sequences with at least one 2'-MOE modification (SEQ ID NOs: 1-4, 33-74), thus, claims 1-6 of US Application 18/861,505 anticipates claim 11 . Regarding claim 12 , all ASOs sequences claimed by US Application 18/861,505 claims 1-6 are 20nt long, within the claimed range of >=15nt in length, and at least one embodiment of the claimed ASO sequences is specific to a Rpl13a snoRNA as discussed above, thus, claims 1-6 of US Application 18/861,505 anticipates claim 12 . Regarding claim 14 , claim 7 of US Application 18/861,505 teaches “ a pharmaceutical composition comprising the composition of claim 1 and a pharmaceutical acceptable excipient, carrier or diluent ”, thus it anticipates the instant claim 14 . Regarding claim 34 , claims 1-6 of US Application 18/861,505 teach antisense oligonucleotide(s) in the claimed composition. Regarding claim 35 , claims 1-6 teach human Rpl13a snoRNAs U32a, U34, U35a as targets based on SEQ ID NO alignment analysis for the claimed SEQ ID NOs (1-4, 17-76), and as discussed above, the instant SEQ ID NOs: 49, 51, 56 are sequences of human Rpl13a snoRNAs U32a, U34, U35a, e.g. SEQ ID NOs: 17, 28, 72 of US Application 18/861,505 show 100% complementarity to sequences of human Rpl13a snoRNAs U32a, U34, U35a (instant SEQ ID NOs: 49, 51, 56 respectively), see alignments above. The claims 8-9, 11-20, 22 of the copending US Application 18/861,505 teaches a method of treating and/or preventing cardiovascular disease in a subject in need thereof, the method comprising administering a therapeutically effective amount of an inhibitor of a Rp113a snoRNA. The claims 8-9, 11-20, 22 of the copending US Application 18/861,505 teaches that oxidative stress and reactive oxygen species (ROS) of radicals contribute to the development of cardiovascular diseases such as atherosclerosis (Pages 28-33, Example 1; FIGs 5, 6, 12 ), and that treatment with a composition by inhibiting Rpl13a snoRNAs using specific ASOs reduces inflammation and disease progression (Page 43-45, Example 2). These claims do not teach treating hemoglobinopathies, specifically SCD, using a composition capable of reducing or inhibiting a Rpl13a snoRNA. However, NIH RePORTER (2017) teaches that silencing snoRNAs reduces ROS production in sickle RBCs, and contemplated developing therapeutic strategies for SCD. It would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have simply substituted the cardiovascular diseases taught by the copending US Application 18/861,505 with SCD, a predominant type of hemoglobinopathies, taught by NIH RePORTER based on the shared etiology of increased ROS and oxidative or metabolic stress with the combined teachings, strategies, and motivations by both the copending US Application 18/861,505 and NIH RePORTER to have arrived at the claimed invention using the similar composition of inhibitors comprising ASO(s) specific for the Rpl13a snoRNAs. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DELPHINUS DOU YI YU/Examiner, Art Unit 1636 /NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636 Application/Control Number: 18/570,967 Page 2 Art Unit: 1636 Application/Control Number: 18/570,967 Page 3 Art Unit: 1636 Application/Control Number: 18/570,967 Page 4 Art Unit: 1636 Application/Control Number: 18/570,967 Page 5 Art Unit: 1636 Application/Control Number: 18/570,967 Page 6 Art Unit: 1636 Application/Control Number: 18/570,967 Page 7 Art Unit: 1636 Application/Control Number: 18/570,967 Page 8 Art Unit: 1636 Application/Control Number: 18/570,967 Page 9 Art Unit: 1636 Application/Control Number: 18/570,967 Page 10 Art Unit: 1636 Application/Control Number: 18/570,967 Page 11 Art Unit: 1636 Application/Control Number: 18/570,967 Page 13 Art Unit: 1636 Application/Control Number: 18/570,967 Page 14 Art Unit: 1636 Application/Control Number: 18/570,967 Page 15 Art Unit: 1636 Application/Control Number: 18/570,967 Page 17 Art Unit: 1636 Application/Control Number: 18/570,967 Page 18 Art Unit: 1636 Application/Control Number: 18/570,967 Page 19 Art Unit: 1636 Application/Control Number: 18/570,967 Page 20 Art Unit: 1636 Application/Control Number: 18/570,967 Page 21 Art Unit: 1636 Application/Control Number: 18/570,967 Page 22 Art Unit: 1636 Application/Control Number: 18/570,967 Page 23 Art Unit: 1636 Application/Control Number: 18/570,967 Page 24 Art Unit: 1636 Application/Control Number: 18/570,967 Page 25 Art Unit: 1636
Prosecution Insights