DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant's election with traverse of Group II, claims 15-25, in the reply filed on 07/23/2026 is acknowledged. The traversal is on the ground(s) that there is no serious burden in examining all three groups together. This is not found persuasive because serious burden is not a consideration in 371 applications.
The requirement is still deemed proper and is therefore made FINAL.
Claims 1-14, 26-29, 31-36 are withdrawn from further consideration pursuant to 37 CFR 1.142(b), as being drawn to a nonelected Group, there being no allowable generic or linking claim. Applicant timely traversed the restriction (election) requirement in the reply filed on 07/23/2026.
Information Disclosure Statement
The information disclosure statement filed 12/20/2023 fails to comply with the provisions of 37 CFR 1.97, 1.98 and MPEP § 609 because US published patent application of numbers given do not exist. It has been placed in the application file, but the information referred to therein has not been considered as to the merits. Applicant is advised that the date of any re-submission of any item of information contained in this information disclosure statement or the submission of any missing element(s) will be the date of submission for purposes of determining compliance with the requirements based on the time of filing the statement, including all certification requirements for statements under 37 CFR 1.97(e). See MPEP § 609.05(a).
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 25 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 25 recites the limitation "the one or more costimulatory signaling regions" in the second line. There is insufficient antecedent basis for this limitation in the claim.
For the purpose of examination it will be considered that such regions are costimulatory domains of claim 22, but appropriate correction is required.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 15-17, 19-21 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Moriarity et al (WO 2017/023803, February 2017, cited from IDS).
Concerning claims 15, 19-21 Moriarity disclose methods of treating cancer (see Abstract) by administering an engineered immune T cell (lymphocyte) (see paragraphs [0007, 0049]), which comprises Cas9 and guide RNAs (gRNAs) (see paragraph [0032]), targeted at disrupting immune checkpoint genes (see Example 4, paragraph [0048]). Such gRNAs can target immune checkpoint genes such as Adora2a, Ctla4 (see Table 9 on page 128) and Pdcd-1 (see Table 9 on page 129). Moriarity disclose that such cell can comprise a chimeric antigen receptor (see paragraph [0046]).
Concerning claim 16 Cas9 and gRNAs can be introduced on the same or separate vectors (see paragraph [00342]).
Concerning claim 17 gRNA can be a single-molecule gRNA (see paragraph [00330]).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 15-21 is/are rejected under 35 U.S.C. 103 as being unpatentable over Moriarity, above, as applies to claims 15-17, 19-21, and in further view of Chen et al (WO 2020/028533, February 2020) and Welstead et al (WO 2020/168300, August 2020).
Teachings of Moriarity are discussed above.
Moriarity do not teach gRNAs of instant SEQ ID NOs: 1-3.
Chen teach a number of gRNAs targeting different genes, including gRNA targeting Pdcd1 of SEQ ID NO: 2447, identical to instant SEQ ID NO: 1 (see lines 1-10 on page 2, page 121 of Table 1, see also search result below):
mmSurf sgRNA library sequence mm12668_Pdcd1, SEQ ID 2447.
XX
KW autoimmune disease; breast tumor; cancer; cytostatic; glioblastoma;
KW immunosuppressive; sgRNA library; ss; therapeutic.
XX
OS Synthetic.
XX
CC PN WO2020028533-A1.
XX
CC PD 06-FEB-2020.
XX
CC PF 31-JUL-2019; 2019WO-US044424.
XX
PR 01-AUG-2018; 2018US-0713217P.
PR 14-FEB-2019; 2019US-0805585P.
XX
CC PA (UYYA ) UNIV YALE.
XX
CC PI Chen S, Ye L, Park J, Dong M, Chow RD;
XX
DR WPI; 2020-11022F/016.
XX
CC PT Non-naturally occurring or engineered sgRNA library (mmSurf) targeting
CC PT membrane-bound molecules for treating the cancer, comprises multiple of
CC PT nucleic acids comprising one nucleotide sequence.
XX
CC PS Claim 1; SEQ ID NO 2447; 330pp; English.
XX
CC The present invention relates to compositions and methods for the
CC identification of membrane targets for the enhancement of T-cell activity
CC against a disease, disorder or condition, preferably cancer, such as
CC glioblastoma or breast cancer, or an autoimmune disease, preferably an
CC immune system disorder. Also described are a non-naturally occurring or
CC engineered sgRNA library (mmSurf) targeting membrane-bound molecules,
CC comprising multiple nucleic acids with at least one nucleotide sequence
CC selected from SEQ ID NO:1-6,628 (see BHE94671-BHF01299), and a non-
CC naturally occurring or engineered sgRNA library (mSURFEOME2), targeting
CC membrane-bound molecules, comprising multiple nucleic acids with at least
CC one nucleotide sequence selected from SEQ ID NO:7,837-64,747 (see
CC BHF02508-BHF59418).
XX
SQ Sequence 20 BP; 3 A; 6 C; 6 G; 5 T; 0 U; 0 Other;
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CAGCTTGTCCAACTGGTCGG 20
||||||||||||||||||||
Db 1 CAGCTTGTCCAACTGGTCGG 20
Chen further teach gRNA targeting Ctla4 of SEQ ID NO: 482, identical to instant SEQ ID NO: 3 (see lines 1-10 on page 2, page 89 of Table 1, see also search result below):
mmSurf sgRNA library sequence mm02358_Ctla4, SEQ ID 482.
XX
KW autoimmune disease; breast tumor; cancer; cytostatic; glioblastoma;
KW immunosuppressive; sgRNA library; ss; therapeutic.
XX
OS Synthetic.
XX
CC PN WO2020028533-A1.
XX
CC PD 06-FEB-2020.
XX
CC PF 31-JUL-2019; 2019WO-US044424.
XX
PR 01-AUG-2018; 2018US-0713217P.
PR 14-FEB-2019; 2019US-0805585P.
XX
CC PA (UYYA ) UNIV YALE.
XX
CC PI Chen S, Ye L, Park J, Dong M, Chow RD;
XX
DR WPI; 2020-11022F/016.
XX
CC PT Non-naturally occurring or engineered sgRNA library (mmSurf) targeting
CC PT membrane-bound molecules for treating the cancer, comprises multiple of
CC PT nucleic acids comprising one nucleotide sequence.
XX
CC PS Claim 1; SEQ ID NO 482; 330pp; English.
XX
CC The present invention relates to compositions and methods for the
CC identification of membrane targets for the enhancement of T-cell activity
CC against a disease, disorder or condition, preferably cancer, such as
CC glioblastoma or breast cancer, or an autoimmune disease, preferably an
CC immune system disorder. Also described are a non-naturally occurring or
CC engineered sgRNA library (mmSurf) targeting membrane-bound molecules,
CC comprising multiple nucleic acids with at least one nucleotide sequence
CC selected from SEQ ID NO:1-6,628 (see BHE94671-BHF01299), and a non-
CC naturally occurring or engineered sgRNA library (mSURFEOME2), targeting
CC membrane-bound molecules, comprising multiple nucleic acids with at least
CC one nucleotide sequence selected from SEQ ID NO:7,837-64,747 (see
CC BHF02508-BHF59418).
XX
SQ Sequence 20 BP; 5 A; 4 C; 7 G; 4 T; 0 U; 0 Other;
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGACTGAGAGCTGTTGACAC 20
||||||||||||||||||||
Db 1 GGACTGAGAGCTGTTGACAC 20
Welstead teach gRNAs (see paragraph [137]) including gRNA targeting Adora2a of SEQ ID NO: 366 (see sequence listing and search result below):
Recombinant ADORA2a gene targeted gRNA targeting domain DNA, SEQ ID 366.
XX
KW ADORA2A gene; Adenosine A2a receptor; bladder cancer; breast tumor;
KW cell culture; cell differentiation; cell therapy; colorectal tumor;
KW cytostatic; gallbladder tumor; glioblastoma; head and neck tumor;
KW hematological neoplasm; hepatocellular carcinoma; immunotherapy;
KW lymphocyte; melanoma; neoplasm; pancreas tumor; papillomavirus infection;
KW prostate tumor; renal cell carcinoma; solid tumor; ss; stem cell;
KW stomach tumor; therapeutic; thyroid tumor.
XX
OS Unidentified.
XX
CC PN WO2020168300-A1.
XX
CC PD 20-AUG-2020.
XX
CC PF 14-FEB-2020; 2020WO-US018443.
XX
PR 15-FEB-2019; 2019US-0806457P.
PR 30-APR-2019; 2019US-0841066P.
PR 01-MAY-2019; 2019US-0841684P.
PR 04-DEC-2019; 2019US-0943649P.
XX
CC PA (EDIT-) EDITAS MEDICINE INC.
XX
CC PI Welstead GG, Borges C, Wong KK;
XX
DR WPI; 2020-79720T/073.
XX
CC PT New modified lymphocyte that does not express endogenous CD3, CD4, and/or
CC PT CD8, and expresses at least one endogenous gene, for treating subject
CC PT having, or diagnosed with proliferative disease, e.g. breast cancer, or
CC PT melanoma.
XX
CC PS Disclosure; SEQ ID NO 366; 191pp; English.
XX
CC The present invention relates to a novel modified lymphocyte, useful in
CC treating a subject having or diagnosed with proliferative diseases. The
CC modified lymphocyte (a) does not express endogenous CD3, CD4 and/or CD8,
CC and (b) expressing at least one endogenous gene encoding (1) CD56 (NCAM),
CC CD49 and/or CD45, (2) NK cell receptor immunoglobulin gamma Fc region
CC receptor III (Fc gamma RIII, CD16), (3) NKG2B, (4) CD69, (5) a natural
CC cytotoxicity receptor, or any combination of two or more thereof. The
CC invention also provides: a modified cell comprising (a) at least one
CC exogenous nucleic acid expression construct comprising a nucleic acid
CC sequence encoding CAR, a non-naturally occurring variant of Fcg RIII
CC (CD16), IL-15, IL-15R or its variant, IL-12, IL-12R or its variant, HLA-
CC G, HLA-E, CD47; or any combination, and/or (2) exhibiting a loss of
CC function of at least one of TGF beta R2, ADORA2A, TIGIT, B2M, PD-1, CISH,
CC CIITA, natural killer group 2A, two or more HLA class II
CC histocompatibility antigen a chain genes, and/or two or more HLA class II
CC histocompatibility antigen beta chain genes, CD32B, FCGR2B, TRAC, or any
CC combination; a population of cells comprising the modified lymphocyte or
CC the modified cell; a pharmaceutical composition comprising the population
CC of cells; an isolated population of lymphocytes; a method for treating a
CC subject by administering the lymphocyte, the modified cell, the
CC population of cells, the pharmaceutical composition, or the isolated in
CC vitro population of lymphocytes to a subject; a method for generating the
CC lymphocyte, the modified cell, the population of cells, or the isolated
CC in vitro population of lymphocytes; a method for differentiating a
CC reprogrammed donor cell into a lymphocyte; a method for differentiating a
CC genetically modified pluripotent stem cell into lymphocytes; and a method
CC for administering the modified lymphocyte, the modified cell, or the
CC population of cells to a subject. The proliferative disease is cancer
CC such as breast cancer, colorectal cancer, gastric cancer, renal cell
CC carcinoma (RCC), or non-small cell lung cancer (NSCLC), solid tumors,
CC bladder cancer, hepatocellular carcinoma, prostate cancer,
CC ovarian/uterine cancer, pancreatic cancer, mesothelioma, melanoma,
CC glioblastoma, human papillomavirus (HPV) associated and/or HPV+ cancers
CC such as cervical and HPV+ head and neck cancer, oral cavity cancer,
CC cancer of the pharynx, thyroid cancer, gallbladder cancer, soft tissue
CC sarcomas, and hematological cancers. The cells and cell populations are
CC characterized by one or more modifications that enhance their efficacy in
CC immunotherapeutic approaches.
XX
SQ Sequence 20 BP; 7 A; 8 C; 3 G; 2 T; 0 U; 0 Other;
Query Match 100.0%; Score 20; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 AGCACACAAGCACGTTACCC 20
||||||||||||||||||||
Db 1 AGCACACAAGCACGTTACCC 20
It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to use gRNAs taught by Chen and Welstead in methods of Moriarity, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so, because Moriarity teach using gRNAs targeting Pdcd1, Adora2a and Ctla4, and Chen and Walstead teach effective gRNAs targeting those genes.
Claim(s) 15-17, 19-25 is/are rejected under 35 U.S.C. 103 as being unpatentable over Moriarity, above, as applied to claims 15-17, 19-21, and in further view of Wu et al (WO 2016/0185862, June 2016).
Teachings of Moriarity are discussed above. Moriarity teach that engineered T cells can comprise a chimeric antigen receptor (see paragraph [0046]).
Moriarity do not teach that chimeric antigen receptor comprises an antigen binding domain, a transmembrane domain, one or more costimulatory domain such as CD28, and a cytoplasmic domain such as CD247 or comprising an immunoreceptor tyrosine-based activation motif (ITAM) or polynucleotide encoding such chimeric antigen receptor.
Wu teach structures of chimeric antigen receptors and polynucleotides encoding them (see paragraph [0005]), such chimeric antigen receptor comprising an antigen binding domain, a transmembrane domain, a costimulatory domain, and a cytoplasmic domain (see Figure 17). Such cytoplasmic domain can be immunoreceptor tyrosine-based activation motif (ITAM) (see paragraph [0069]). Co-stimulatory domain can be CD28 (see paragraph [0103]). Cytoplasmic domain can be CD247 (see paragraph [0178]). Such chimeric antigen receptors can be used for induction of tumor cell death (see paragraph [0004]).
It would have been obvious to one of the ordinary skill in the art before the effective filing date of the claimed invention to use chimeric antigen receptors taught by Wu in methods of Moriarity, arriving at instant invention. One of the ordinary skill in the art would be motivated to do so, because Moriarity teach using chimeric antigen receptors in methods of cancer treatment and Wu teach specific chimeric antigen receptors which can be used for the same purpose. It is obvious to combine things known separately to have same effect (In re Kerkhoven, MPEP 2144.06).
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to EKATERINA POLIAKOVA whose telephone number is (571)270-5257. The examiner can normally be reached Mon-Fri 8-5.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at (571)272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/EKATERINA POLIAKOVA-GEORGANTAS/Primary Examiner, Art Unit 1637
Prosecution Insights