Prosecution Insights
Last updated: October 04, 2026
Application No. 18/572,482

DEOPTIMIZED YELLOW FEVER VIRUS AND METHODS AND USES THEREOF

Non-Final OA §102§112
Filed
Dec 20, 2023
Priority
Jul 07, 2021 — provisional 63/219,256 +2 more
Examiner
KINSEY WHITE, NICOLE ERIN
Art Unit
1672
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Codagenix Inc.
OA Round
1 (Non-Final)
58%
Grant Probability
Moderate
1-2
OA Rounds
5m
Est. Remaining
74%
With Interview

Examiner Intelligence

Grants 58% of resolved cases
58%
Career Allowance Rate
509 granted / 876 resolved
-1.9% vs TC avg
Strong +16% interview lift
Without
With
+16.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 3m
Avg Prosecution
36 currently pending
Career history
907
Total Applications
across all art units

Statute-Specific Performance

§101
3.6%
-36.4% vs TC avg
§103
33.0%
-7.0% vs TC avg
§102
15.9%
-24.1% vs TC avg
§112
30.9%
-9.1% vs TC avg
Black line = Tech Center average estimate • Based on career data from 876 resolved cases

Office Action

§102 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election of Group I in the reply filed on 8/13/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)). Priority The disclosure of the prior-filed application, Provisional Application No. 63/219256, fails to provide adequate support or enablement in the manner provided by the first paragraph of 35 U.S.C. 112 for one or more claims of this application. Specifically, the prior application does not disclose SEQ ID NOs: 3-9. Thus, claims reciting SEQ ID NOs: 3-9 will only be given a priority date of Provisional Application No. 63/339114, 5/6/2022. Claim Objections Claims 14 and 15 are objected to because of the following informalities: Claim 14 should recite “The deoptimized”. Claim 15 should recite “An immunogenic composition” and “the deoptimized”. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-3, 8-9, 12, 14 and 15 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 is directed to a polynucleotide comprising a polynucleotide encoding one or more viral proteins or one or more fragments thereof of a parent Yellow Fever virus (YFV): wherein the polynucleotide is recoded compared to its parent YFV, wherein the amino acid sequence of the one or more viral proteins, or one or more fragments thereof of the parent YFV encoded by the polynucleotide remains the same, or wherein the amino acid sequence of the one or more viral proteins or one or more fragments thereof of the parent YFV encoded by the polynucleotide comprises one or more amino acid substitutions, additions, or deletions. It is not clear how a polynucleotide is recoded compared to its parent when the polynucleotide already encodes one or more viral proteins (or fragments thereof) from the parent YFV. If applicant intended a variant polynucleotide comprising a polynucleotide encoding one or more Yellow Fever virus proteins or one or more fragments thereof, wherein the variant polynucleotide is recoded compared to its parent YFV protein or one or more fragments thereof, then the claims should be amended as such. This rejection affects claims that depend from claim 1. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 1-3 and 9 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Choi et al. (KR2015067801, published 6/19/2015). The instant claims are directed to a polynucleotide comprising a polynucleotide encoding one or more viral proteins or one or more fragments thereof of a parent Yellow Fever virus (YFV): wherein the polynucleotide is recoded compared to its parent YFV, wherein the amino acid sequence of the one or more viral proteins, or one or more fragments thereof of the parent YFV encoded by the polynucleotide remains the same, or wherein the amino acid sequence of the one or more viral proteins or one or more fragments thereof of the parent YFV encoded by the polynucleotide comprises one or more amino acid substitutions, additions, or deletions, where the viral protein is the E protein (claim 2), and where the E protein is a variant of any one of SEQ ID NOs: 3-9 (claim 3), and where the parent YFV is strain 17D or has at least 95% sequence identity to YFV 17D (claim 9). Choi et al. teaches SEQ ID NO: 2, which is a YFV 17D envelope (E) sequence, that has 82% sequence identity with instant SEQ ID NO: 3 (see the alignment below). The E protein polynucleotide sequence taught by Choi et al. contains one or more substitutions and is a “variant” of instant SEQ ID NO: 3. Query Match 82.0%; Score 1212.4; Length 1479; Best Local Similarity 88.8%; Matches 1312; Conservative 0; Mismatches 166; Indels 0; Gaps 0; Qy 1 GCTCACTGCATTGGAATTACTGACAGGGATTTCATTGAGGGGGTGCATGGAGGAACTTGG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 GCTCACTGCATTGGAATTACTGACAGGGATTTCATTGAGGGGGTGCATGGAGGAACTTGG 60 Qy 61 GTTTCAGCTACCCTGGAGCAAGACAAGTGTGTCACTGTTATGGCCCCTGACAAGCCTTCA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GTTTCAGCTACCCTGGAGCAAGACAAGTGTGTCACTGTTATGGCCCCTGACAAGCCTTCA 120 Qy 121 TTGGACATCTCACTAGAGACAGTAGCCATTGATAGACCTGCTGAGGTGAGGAAAGTGTGT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TTGGACATCTCACTAGAGACAGTAGCCATTGATAGACCTGCTGAGGTGAGGAAAGTGTGT 180 Qy 181 TACAATGCAGTTCTCACTCATGTGAAGATTAATGACAAGTGCCCCAGCACTGGAGAGGCC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TACAATGCAGTTCTCACTCATGTGAAGATTAATGACAAGTGCCCCAGCACTGGAGAGGCC 240 Qy 241 CACCTAGCTGAAGAGAACGAAGGGGACAATGCGTGCAAGCGCACTTATTCTGATAGAGGC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 CACCTAGCTGAAGAGAACGAAGGGGACAATGCGTGCAAGCGCACTTATTCTGATAGAGGC 300 Qy 301 TGGGGCAATGGCTGTGGCCTATTTGGGAAAGGGAGCATTGTGGCATGCGCCAAATTCACT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 TGGGGCAATGGCTGTGGCCTATTTGGGAAAGGGAGCATTGTGGCATGCGCCAAATTCACT 360 Qy 361 TGTGCCAAATCCATGAGTTTGTTTGAGGTTGATCAGACCAAAATTCAGTATGTCATCAGA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TGTGCCAAATCCATGAGTTTGTTTGAGGTTGATCAGACCAAAATTCAGTATGTCATCAGA 420 Qy 421 GCACAATTGCATGTAGGGGCCAAGCAGGAAAATTGGACTACCGACATTAAGACTCTCAAG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 GCACAATTGCATGTAGGGGCCAAGCAGGAAAATTGGACTACCGACATTAAGACTCTCAAG 480 Qy 481 TTTGATGCCCTGTCAGGCTCCCAGGAAGTCGAGTTCATTGGGTATGGAAAAGCTACACTG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 TTTGATGCCCTGTCAGGCTCCCAGGAAGTCGAGTTCATTGGGTATGGAAAAGCTACACTG 540 Qy 541 GAATGCCAGGTGCAAACTGCGGTGGACTTTGGTAACAGTTACATCGCTGAGATGGAAACA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GAATGCCAGGTGCAAACTGCGGTGGACTTTGGTAACAGTTACATCGCTGAGATGGAAACA 600 Qy 601 GAGAGCTGGATAGTGGACAGACAGTGGGCCCAGGACTTGACCCTGCCATGGCAGAGTGGA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 GAGAGCTGGATAGTGGACAGACAGTGGGCCCAGGACTTGACCCTGCCATGGCAGAGTGGA 660 Qy 661 AGTGGCGGGGTGTGGAGAGAGATGCATCATCTTGTCGAATTTGAACCTCCGCATGCCGCC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 AGTGGCGGGGTGTGGAGAGAGATGCATCATCTTGTCGAATTTGAACCTCCGCATGCCGCC 720 Qy 721 ACTATCAGAGTACTGGCCCTGGGAAACCAGGAAGGCTCCCTTAAAACCGCATTGACTGGC 780 ||||||||||||||||||||||||||||||||||||||| | ||||| || | |||||| Db 721 ACTATCAGAGTACTGGCCCTGGGAAACCAGGAAGGCTCCTTGAAAACAGCTCTTACTGGC 780 Qy 781 GCTATGCGCGTTACTAAGGACACTAACGACAATAACCTATACAAACTGCATGGGGGGCAT 840 || ||| | ||||| |||||||| || ||||| ||||| |||||||| ||||| || ||| Db 781 GCAATGAGGGTTACAAAGGACACAAATGACAACAACCTTTACAAACTACATGGTGGACAT 840 Qy 841 GTGTCTTGTAGAGTGAAATTGTCCGCCCTTACACTTAAGGGGACTAGCTATAAGATATGC 900 || ||||| |||||||||||||| || | ||||| |||||||| ||| || |||||| Db 841 GTTTCTTGCAGAGTGAAATTGTCAGCTTTGACACTCAAGGGGACATCCTACAAAATATGC 900 Qy 901 ACTGACAAAATGTTTTTCGTTAAAAACCCTACCGATACCGGACACGGAACAGTCGTTATG 960 ||||||||||||||||| || || ||||| || || || || || || || || || ||| Db 901 ACTGACAAAATGTTTTTTGTCAAGAACCCAACTGACACTGGCCATGGCACTGTTGTGATG 960 Qy 961 CAGGTGAAAGTGTCAAAAGGCGCACCATGTAGGATACCCGTAATCGTTGCCGACGATCTG 1020 |||||||||||||||||||| || || || ||||| || || || || || || ||||| Db 961 CAGGTGAAAGTGTCAAAAGGAGCCCCCTGCAGGATTCCAGTGATAGTAGCTGATGATCTT 1020 Qy 1021 ACTGCCGCAATCAATAAGGGGATACTCGTGACAGTGAACCCTATCGCTAGCACTAACGAC 1080 || || ||||||||||| || || | || ||||| ||||| ||||| || || || Db 1021 ACAGCGGCAATCAATAAAGGCATTTTGGTTACAGTTAACCCCATCGCCTCAACCAATGAT 1080 Qy 1081 GACGAAGTGTTGATCGAAGTGAATCCACCTTTTGGCGACTCATACATTATCGTAGGCAGA 1140 || |||||| |||| || ||||| ||||||||||| ||| ||||||||||| || ||| Db 1081 GATGAAGTGCTGATTGAGGTGAACCCACCTTTTGGAGACAGCTACATTATCGTTGGGAGA 1140 Qy 1141 GGCGATAGTAGACTGACATACCAATGGCATAAAGAGGGATCGTCAATCGGTAAGTTGTTT 1200 || ||| | || || ||||| ||||| ||||||||| ||||| || |||||||| Db 1141 GGAGATTCACGTCTCACTTACCAGTGGCACAAAGAGGGAAGCTCAATAGGAAAGTTGTTC 1200 Qy 1201 ACACAGACTATGAAAGGGGTGGAGAGATTGGCCGTTATGGGCGATACCGCTTGGGACTTT 1260 || ||||| |||||||| ||||| | ||||||| ||||| || ||||| ||||| || Db 1201 ACTCAGACCATGAAAGGCGTGGAACGCCTGGCCGTCATGGGAGACACCGCCTGGGATTTC 1260 Qy 1261 AGTTCCGCCGGAGGGTTTTTTACTAGCGTCGGAAAGGGGATACATACCGTATTCGGATCC 1320 || ||||| |||||||| || ||| || || || || || ||||| || || || || Db 1261 AGCTCCGCTGGAGGGTTCTTCACTTCGGTTGGGAAAGGAATTCATACGGTGTTTGGCTCT 1320 Qy 1321 GCTTTTCAGGGGTTGTTCGGCGGACTGAATTGGATTACGAAAGTGATTATGGGCGCCGTA 1380 || ||||||||| | || ||||| |||| ||||| || || || || ||||| || ||| Db 1321 GCCTTTCAGGGGCTATTTGGCGGCTTGAACTGGATAACAAAGGTCATCATGGGGGCGGTA 1380 Qy 1381 CTTATTTGGGTGGGGATTAACACTAGGAATATGACTATGTCTATGTCTATGATACTAGTC 1440 ||||| ||||| || || ||||| || || ||||| ||||| ||| ||||| | || Db 1381 CTTATATGGGTTGGCATCAACACAAGAAACATGACAATGTCCATGAGCATGATCTTGGTA 1440 Qy 1441 GGAGTGATTATGATGTTTCTGTCATTGGGCGTAGGCGC 1478 |||||||| ||||||||| |||| | || || || || Db 1441 GGAGTGATCATGATGTTTTTGTCTCTAGGAGTTGGGGC 1478 Claim(s) 1 and 9 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Palese et al. (WO2013138670, published 9/19/2013; cited by applicant). The instant claims are directed to a polynucleotide comprising a polynucleotide encoding one or more viral proteins or one or more fragments thereof of a parent Yellow Fever virus (YFV): wherein the polynucleotide is recoded compared to its parent YFV, wherein the amino acid sequence of the one or more viral proteins, or one or more fragments thereof of the parent YFV encoded by the polynucleotide remains the same, or wherein the amino acid sequence of the one or more viral proteins or one or more fragments thereof of the parent YFV encoded by the polynucleotide comprises one or more amino acid substitutions, additions, or deletions, and where the parent YFV is strain 17D or has at least 95% sequence identity to YFV 17D (claim 9). Palese et al. teaches an attenuated yellow fever viruses comprising a genome that encodes a mutated NS5 protein comprising a deletion of the first 10 amino acids or an amino acid substitution of another residue (e.g., arginine or alanine) for the first N-terminal lysine residue (see the abstract). Palese et al. further teaches that YFV NS5 is an IFN-I-signaling antagonist. Removing the first 10 amino acids or mutating a single residue (lysine 6) in NS5 prevents this protein from antagonizing IFN-I signaling in human and non-human primate cells. When a lysine to arginine change was introduced at amino acid 6 (K6R) of NS5 of the YFV-17D vaccine strain, the virus grew to wild-type levels in untreated Vero cells but had a replication defect in IFN-I-treated Vero cells (see paragraph [0011]). Claim(s) 1-2, 12 and 14-15 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Coleman et al. (WO2019172982, published 9/12/2019; cited by applicant). The instant claims are directed to a polynucleotide comprising a polynucleotide encoding one or more viral proteins or one or more fragments thereof of a parent Yellow Fever virus (YFV): wherein the polynucleotide is recoded compared to its parent YFV, wherein the amino acid sequence of the one or more viral proteins, or one or more fragments thereof of the parent YFV encoded by the polynucleotide remains the same, or wherein the amino acid sequence of the one or more viral proteins or one or more fragments thereof of the parent YFV encoded by the polynucleotide comprises one or more amino acid substitutions, additions, or deletions. Coleman et al. teaches a modified Flavivirus virus in which expression of viral proteins is reduced compared to a parent virus, wherein the reduction in expression is the result of recoding the prM, or envelope (E) region, or the nonstructural protein 3 (NS3) region or both the E and NS3 regions. The parent virus can be a Flavivirus selected from the group consisting of dengue fever virus, West Nile virus, yellow fever virus, Japanese encephalitis virus, Spondweni virus, Saint Louis encephalitis virus, and Powassan virus (see paragraphs [0025] and [0032]). Coleman et al. teaches a method of making a modified Flavivirus virus genome comprising: obtaining the nucleotide sequence encoding the envelope protein of a Flavivirus virus and the nucleotide sequence encoding the nonstructural 3 proteins of a Flavivirus virus; recoding the envelope encoding nucleotide sequence to reduce protein expression and recoding the nonstructural protein 3-encoding nucleotide sequence to reduce protein expression, and substituting a nucleic acid having the recoded envelope-encoding nucleotide sequence and a nucleic acid having the recoded nonstructural protein 3-encoding nucleotide sequence into a parent Flavivirus virus genome to make a modified Flavivirus virus genome; whereby expression of the recoded envelope-encoding nucleotide sequence and expression of the recoded nonstructural protein 3-encoding nucleotide sequence is reduced compared to the parent virus (see paragraph [0036]). Coleman et al. also teaches that full-length Flavivirus or Zika genome sequences or codon pair deoptimized sequences embedded in a wild-type Flavivirus or Zika genome sequence can include for example, constructing an infectious cDNA clone, using an overlap extension PCR strategy, or long PCR-based fusion strategy (see paragraph [0093]). Regarding claim 2, the nucleotide can encode the E protein. Regarding claim 12, Coleman et al. teaches a method of making a modified Flavivirus virus genome comprising a recoded the envelope encoding nucleotide sequence and Coleman et al. teaches Flavivirus or Zika codon pair deoptimized sequences embedded in a wild-type Flavivirus or Zika genome sequence. Regarding claim 14, Coleman et al. teaches a modified Flavivirus virus in which expression of viral proteins is reduced compared to a parent virus, wherein the reduction in expression is the result of recoding the prM, or envelope (E) region. Regarding claim 15, Coleman et al. teaches a Flavivirus vaccine composition for inducing a protective immune response in a subject, which comprises the disclosed modified virus (see paragraphs [0033] and [0034]). Conclusion No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Nicole Kinsey White whose telephone number is (571)272-9943. The examiner can normally be reached M to Th 6:30 am to 6:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Thomas Visone can be reached at 571-270-0684. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /NICOLE KINSEY WHITE/Primary Examiner, Art Unit 1672
Read full office action

Prosecution Timeline

Dec 20, 2023
Application Filed
Sep 17, 2026
Non-Final Rejection mailed — §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735752
Methods Of Identifying Subjects Having An Increased Risk Of Developing A Coronavirus Infection And Treatment Thereof
4y 9m to grant Granted Sep 15, 2026
Patent 12735755
COMPOSITION, KIT, AND METHOD FOR DETECTING AND TYPING CORONAVIRUSES
4y 0m to grant Granted Sep 15, 2026
Patent 12734235
AAV5-BASED VACCINE AGAINST SARS-COV-2
3y 6m to grant Granted Sep 15, 2026
Patent 12723261
A PROCESS FOR PRODUCING A PLURALITY OF NEDDYLATION SITE MODIFIED AAV VECTORS
5y 3m to grant Granted Sep 01, 2026
Patent 12724028
SELF-ASSEMBLING PROTEIN NANOCAGE DECORATED WITH ANTIBODIES (SAPNA) AND PARTS THEREOF
4y 10m to grant Granted Sep 01, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
58%
Grant Probability
74%
With Interview (+16.4%)
3y 3m (~5m remaining)
Median Time to Grant
Low
PTA Risk
Based on 876 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month