DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election without traverse of Group I, claims 1-4, 6-8, 10-11, 13, 15-16, 18, 20, 22, and 30-31 in the reply filed on 06/08/2026 is acknowledged.
Claims 24-26 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected group, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 06/08/2026.
Status of the Claims
Claims 1-4, 6-8, 10-11, 13, 15-16, 18, 20, 22, 24-26, and 30-31 are currently pending.
Claims 1-4, 6-8, 10, 15-16, 18, 20, 22, and 24-26 are amended.
Claims 24-26 have been withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected Invention, there being no allowable generic or linking claim.
Claims 5, 9, 12, 14, 17, 19, 21, 23, and 27-29 are cancelled.
New claims 30-31 have been added.
Claims 1-4, 6-8, 10-11, 13, 15-16, 18, 20, 22, and 30-31 have been considered on the merits.
Claim Objections
Claim 30 is objected to because of the following informalities: claim 30 contains the phrase “the microRNA 122 targeting sequence (miR-122T) comprises CAAACACCATTGTCACACACTCCA (SEQ ID NO: 21)” which is being objected for reciting a sequence and providing a SEQ ID NO in parenthesis. The claim needs to be amended to either recite the sequence or the SEQ ID NO and not both. Claim 30 contains 4 instances where this correction is applicable. Applicant is recommended to amend the claim to provide only the SEQ ID NO which, for example, would read as follows “the microRNA 122 targeting sequence (miR-122T) comprises SEQ ID NO: 21” or similar. Appropriate correction is required.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1-4, 6-8, 10-11, 13, 15, and 30-31 are rejected under 35 U.S.C. 103 as being unpatentable over Harding et al (US7186699 B2), in view of Geisler et al (World Journal of Experimental Medicine, 2016).
Regarding claim 1, Harding teaches an AAV vector (col. 2, para 2) comprising a target tissue-tropic capsid (col. 23, para 2) and an expression cassette (col. 2, para 9; description of Fig. 2). The expression cassette comprises from 5’ to 3’: a promoter that drives expression in cells of a target tissue, a coding sequence for a protein of interest, a polyA signal sequence (See Fig. 2).
Regarding claim 2, Harding teaches the use of the AAV-2 capsid vector (para spanning col. 5 to col. 6) and Harding teaches that AAV-2 is tissue tropic to the CNS (col. 30, lines 50-55 and col. 31, para 1).
Regarding claims 3-4, Harding teaches that the promoter can be a GFAP promoter which drives expression in the central nervous system (col. 27, para 1).
Regarding claim 6, Harding teaches that the promoter can be a ubiquitous promoter which is CAG (col. 27, para 1-2).
Regarding claim 7, Harding teaches that the vector further comprises an enhancer (col. 27, para 1-3).
Regarding claim 8, Harding teaches that the vector may further comprise a secretory signal peptide sequence (col. 16, para 3).
Regarding claim 11, Harding teaches wherein the protein of interest is a therapeutic protein, in this case an apoptotic protein (col. 29, para 1).
Regarding claim 13, Harding teaches wherein the therapeutic protein of interest is a suicide protein, an apoptotic protein (col. 29, para 1), and/or a toxin (Table 2).
Regarding claim 15, Harding teaches wherein the toxin is tumor necrosis factor-related apoptosis-inducing ligand (TRAIL) (Table 2; Table 4; Example 4).
Harding does not teach that the expression cassette also includes a 3’ untranslated region (UTR) comprising at least on microRNA targeting sequence selected from the group consisting of a microRNA 122 targeting sequence, a microRNA 124 targeting sequence, a microRNA 200c targeting sequence, and a microRNA 1 targeting sequence as required by claim 1. Harding does not teach that the vector of claim 1 comprises a plurality of microRNA targeting sequences separated by spacer sequences as required by claim 10. Harding does not teach wherein the microRNA 122 targeting sequence comprises SEQ ID NO: 21, the microRNA 124 targeting sequence comprises SEQ ID NO: 20, the microRNA 200c targeting sequence comprises SEQ ID NO: 22, and the microRNA 1 targeting sequence comprises SEQ ID NO: 24 as required by claim 30. Harding does not teach wherein the spacer sequences are between 1 and 50 nucleotides as required by claim 31.
However, Geisler teaches about microRNA regulated viral vectors for use in gene therapy (abstract). Geisler teaches “recently Kim et al62 discovered that expression of a therapeutic transgene can also be regulated by the passenger strand of a microRNA (miR-122) linked to the transgene, thereby eliminating the risk of affecting expression of endogenous microRNA guide strand-regulated genes” (pg. 39, col. 2, para 1).
Regarding claim 1, Geisler teaches the inclusion of a microRNA in the 3’ UTR of a transgene expression cassette (abstract). Geisler teaches “recently Kim et al62 discovered that expression of a therapeutic transgene can also be regulated by the passenger strand of a microRNA (miR-122) linked to the transgene, thereby eliminating the risk of affecting expression of endogenous microRNA guide strand-regulated genes” (pg. 39, col. 2, para 1). Geisler also teaches that the miR-122, also known as miR-122T (target) or miR-122TS (target sequence), can cause expression in various tissues including heart muscle, liver, CNS, and adipose tissue (see Table 1).
Regarding claims 10 and 31, Geisler teaches that the vector may contain 3-4 copies or up to 6-12 copies of the microRNA and in most studies 4-6 nucleotide long spacer sequence are sufficient to facilitate better repression (p g. 41, col. 1).
Regarding claim 30, Geisler teaches that the microRNA is miR-122T, which meets the limitations of the microRNA 122 comprising SEQ ID NO: 21 (Table 1 and pg. 39, col. 2, para 1-2).
One of ordinary skill in the art would find it obvious at the effective filling date of the instant invention to combine the AAV vector taught by Harding with the 3’ UTR microRNA taught by Geisler to arrive at the instant invention. One of ordinary skill in the art would be motivated to make this combination because Geisler teaches “recently Kim et al62 discovered that expression of a therapeutic transgene can also be regulated by the passenger strand of a microRNA (miR-122) linked to the transgene, thereby eliminating the risk of affecting expression of endogenous microRNA guide strand-regulated genes” (pg. 39, col. 2, para 1). One of ordinary skill in the art would have a reasonable expectation of success when combining Harding with Geisler because Harding teaches the necessary information to produce an AAV vector and Geisler teaches the necessary information to include a microRNA with an expectation of increasing vector specificity (abstract).
Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the effective time of filing of the invention, especially in the absence of evidence to the contrary.
Claims 16, 18, 20, and 22 are rejected under 35 U.S.C. 103 as being unpatentable over Harding et al (US7186699 B2), in view of Geisler et al (World Journal of Experimental Medicine, 2016), as applied to claims 1-4, 6-8, 10-11, 13, 15, and 30-31 above, and in further view of Fengfeng (WO2020014471 A1).
Regarding claims 16, 18, 20, and 22, the limitations of the independent claim are taught above.
Regarding claim 16, Harding teaches that an AAV-2 capsid vector (para spanning col. 5 to col. 6) and teaches that AAV-2 is tissue tropic to the CNS (col. 30, lines 50-55 and col. 31, para 1). Harding teaches that the promoter is a GFAP promoter (col. 27, para 1). Additionally, Geisler teaches the inclusion of the microRNA 122 (Table 1 and pg. 39, col. 2, para 1-2).
Regarding claim 18, Harding teaches that the vector targets the liver (Example 4, col. 40). Harding teaches that a liver specific promoter is LSP (Example 6). Additionally, Geisler teaches the inclusion of the microRNA 122 (Table 1 and pg. 39, col. 2, para 1-2).
Regarding claim 20, Harding teaches that the vector targets muscle cells (col. 5, para 3). Additionally, Geisler teaches that a promoter of MLC0.26, also known as MLC2v, is an efficient promoter for transgene suppression in using the miR-122 (pg. 43, col. 1, para 1). Geisler teaches the inclusion of the microRNA 122 (Table 1 and pg. 39, col. 2, para 1-2).
Harding and Geisler do not teach that the capsid is AAV.CPP.16 or AAV.CPP.21 as required by claim 16. Harding and Geisler do not teach that the capsid is AAV.CPP.16 or AAV9 as required by claim 18. Harding and Geisler do not teach that the capsid is AAV.CPP.16 as required by claim 20.
However, Fengfeng teaches about AAV development with artificial targeting sequences which enhance permeation of agents into cells (abstract).
Regarding claims 16, 18, and 20, Fengfeng teaches that in testing various capsid proteins that AAV.CPP.16 and AAV.CPP.21 were identified as top hits with their robust and widespread brain transduction (pg. 5, para 2). Further Fengfeng teaches the use of AAV9 capsid (Fig. 3D).
One of ordinary skill in the art would find it obvious at the effective filling date of the instant invention to combine the AAV vector taught by Harding and Geisler with the capsid taught by Fengfeng to arrive at the instant invention. One of ordinary skill in the art would be motivated to make this combination because Fengfeng teaches about AAV development with artificial targeting sequences which enhance permeation of agents into cells (abstract) and that AAV.CPP.16 and AAV.CPP.21 were identified as top hits with their robust and widespread brain transduction (pg. 5, para 2). One of ordinary skill in the art would have a reasonable expectation of success when combining Harding and Geisler with Fengfeng because Harding teaches the necessary information to produce an AAV vector, Geisler teaches the necessary information to include a microRNA with an expectation of increasing vector specificity (abstract), and Fengfeng teaches that the AAV.CPP.16 and AAV.CPP.21 were identified as top hits with their robust and widespread brain transduction (pg. 5, para 2).
Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the effective time of filing of the invention, especially in the absence of evidence to the contrary.
Claim 22 is rejected under 35 U.S.C. 103 as being unpatentable over Harding et al (US7186699 B2), in view of Geisler et al (World Journal of Experimental Medicine, 2016), and Fengfeng (WO2020014471 A1), as applied to claims 16, 18, and 20 above, and in further view of DeGiulio et al (Gene Ther., 2010).
Regarding claim 22, the limitations of the independent claim are taught above.
Regarding claim 22, Harding teaches that the vector targets lung cells (col. 5, para 3-4). Additionally, Geisler teaches the inclusion of the microRNA 122 (Table 1 and pg. 39, col. 2, para 1-2).
Harding and Geisler do not teach that the capsid is AAV.CPP.16 or AAV.CPP.21 as required by claim 22.
However, Fengfeng teaches about AAV development with artificial targeting sequences which enhance permeation of agents into cells (abstract).
Regarding claims 22, Fengfeng teaches that in testing various capsid proteins that AAV.CPP.16 and AAV.CPP.21 were identified as top hits with their robust and widespread brain transduction (pg. 5, para 2). Further Fengfeng teaches the use of AAV9 capsid (Fig. 3D).
One of ordinary skill in the art would find it obvious at the effective filling date of the instant invention to combine the AAV vector taught by Harding and Geisler with the capsid taught by Fengfeng to arrive at the instant invention. One of ordinary skill in the art would be motivated to make this combination because Fengfeng teaches about AAV development with artificial targeting sequences which enhance permeation of agents into cells (abstract) and that AAV.CPP.16 and AAV.CPP.21 were identified as top hits with their robust and widespread brain transduction (pg. 5, para 2). One of ordinary skill in the art would have a reasonable expectation of success when combining Harding and Geisler with Fengfeng because Harding teaches the necessary information to produce an AAV vector, Geisler teaches the necessary information to include a microRNA with an expectation of increasing vector specificity (abstract), and Fengfeng teaches that the AAV.CPP.16 and AAV.CPP.21 were identified as top hits with their robust and widespread brain transduction (pg. 5, para 2).
Harding, Geisler, and Fengfeng do not teach wherein the promoter is an SP-B or SP-C promoter as required by claim 22.
However, DeGiulio teaches about the use of the SP-C promoter in lung related gene expression (abstract).
Regarding claim 22, DeGiulio teaches that “we demonstrate that the SP-C promoter sequence will enhance gene expression specifically in ATII cells in mouse lung. This represents a novel activity for the SP-C promoter and thus ATII cell specific nuclear import of DNA may prove to be a safe and effective method for targeted and enhanced gene expression in ATII cells” (abstract).
One of ordinary skill in the art would find it obvious at the effective filling date of the instant invention to combine the AAV vector taught by Harding, Geisler, and Fengfeng with the SP-C promoter taught by Fengfeng to arrive at the instant invention. One of ordinary skill in the art would be motivated to make this combination because DeGiulio teaches that “we demonstrate that the SP-C promoter sequence will enhance gene expression specifically in ATII cells in mouse lung. This represents a novel activity for the SP-C promoter and thus ATII cell specific nuclear import of DNA may prove to be a safe and effective method for targeted and enhanced gene expression in ATII cells” (abstract). One of ordinary skill in the art would have a reasonable expectation of success when combining Harding, Geisler, and Fengfeng with DeGiulio because Harding teaches the necessary information to produce an AAV vector, Geisler teaches the necessary information to include a microRNA with an expectation of increasing vector specificity (abstract), Fengfeng teaches that the AAV.CPP.16 and AAV.CPP.21 were identified as top hits with their robust and widespread brain transduction (pg. 5, para 2), and DeGiulio teaches that “this represents a novel activity for the SP-C promoter and thus ATII cell specific nuclear import of DNA may prove to be a safe and effective method for targeted and enhanced gene expression in ATII cells” (abstract).
Therefore, the invention as a whole was prima facie obvious to one of ordinary skill in the art at the effective time of filing of the invention, especially in the absence of evidence to the contrary.
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to CONSTANTINA E STAVROU whose telephone number is (571)272-9899. The examiner can normally be reached M-F 8:00-5:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at 571-272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
CONSTANTINA E. STAVROU
Examiner
Art Unit 1632
/TITILAYO MOLOYE/Primary Examiner, Art Unit 1632
Prosecution Insights