Prosecution Insights
Last updated: April 19, 2026
Application No. 18/575,172

USE OF REAGENT FOR DETECTING PIR-HSA-120522 IN PLASMA IN PREPARATION OF LUNG CANCER SCREENING OR DIAGNOSIS KIT

Non-Final OA §101§102§103§112
Filed
Dec 28, 2023
Examiner
WOOLWINE, SAMUEL C
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
West China Hospital Sichuan University
OA Round
1 (Non-Final)
61%
Grant Probability
Moderate
1-2
OA Rounds
3y 9m
To Grant
81%
With Interview

Examiner Intelligence

Grants 61% of resolved cases
61%
Career Allow Rate
515 granted / 843 resolved
+1.1% vs TC avg
Strong +20% interview lift
Without
With
+19.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 9m
Avg Prosecution
54 currently pending
Career history
897
Total Applications
across all art units

Statute-Specific Performance

§101
5.3%
-34.7% vs TC avg
§103
36.1%
-3.9% vs TC avg
§102
17.4%
-22.6% vs TC avg
§112
28.2%
-11.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 843 resolved cases

Office Action

§101 §102 §103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA. Claim Objections Claim 1 is objected to because of the following informalities: the word “manufacturer” should be “manufacture”. Appropriate correction is required. Claims 5, 6, 9, 10 are objected to because of the following informalities: the periods used in the abbreviation “NO.” should be omitted, or replaced with a colon (:). Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b ) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the appl icant regards as his invention. Claim s 1-6 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. There are two separate issues under this rejection. First, there is no antecedent basis for “the reagent”. See MPEP 2173.05(e). Second, these claims are “use” claims which do not set forth any steps. See MPEP 2173.05(q). For purposes of examination over the prior art, any use of any reagent in a kit capable of detecting piR-hsa-120522 will be considered. Note that the language “for lung cancer and/or its precancerous lesions” is considered intended use of the manufactured kit. However, the claim is construed as manufacturing a kit with a reagent capable of detecting piR-h sa -120522. What is later done with the kit is not limited by the intended use language. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 11 and 12 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural phenomenon without significantly more. The claim(s) recite(s) a correlation between the level of expression of piR-h sa -120522 and lung cancer . This judicial exception is not integrated into a practical application because determining expression levels of a biomarker, and the comparison to controls, represent insignificant extra-solution activity. See MPEP 2106.05(g) . The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because determining expression levels of biomarkers and comparing to controls was well-known, routine and conventional . As to the use of kits, f or example, Polansky (US 2004/0023207) taught (paragraph [0919]): “ Well known advantages of commercial kits include convenience and reproducibility due to manufacturing standardization, quality control and validation procedures. ” As to measuring biomarkers and comparing to healthy controls, Goold (US 5,998,165) taught ( column 18, lines 40-45 ): “ Standard values obtained from normal samples may be compared with values obtained from samples from subjects potentially affected by a disorder or disease related to PANC1A and PANC1B expression. Deviation between standard and subject values establishes the presence of the disease state. ” Claims 7 and 8 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a natural phenomenon without significantly more. The claim(s) recite(s) a reagent for detecting piR-h sa -120522 . The claims are broad enough to encompass a fragment of genomic DNA from humans that encode piR-h sa -120522 which could be used as a capture probe for detecting piR-h sa -120522. Fragments of naturally-occurring polynucleotides are not patentable. See MPEP 2106.04(b)(I), examples i . (isolated DNA) and viii. (“primers”). This judicial exception is not integrated into a practical application because there are no additional claim elements recited other than the reagent for detecting piR-h sa -120522 . The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because there are no additional claim elements recited other than the reagent for detecting piR-h sa -120522 . The term “kit” is a generic term that does not further limit the reagent. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale , or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 1-4, 7, 8, 11 and 12 is/are rejected under 35 U.S.C. 102 (a)(1) as being anticipated by Mao (US 2018/0273941, cited on IDS) . Mao disclosed (paragraph [0015]): “ In some aspects, the invention relates to short non-coding protein regulatory RNAs ( sprRNAs ), variants, fragments and inhibitors thereof and their uses as markers in certain disease states such as cancer, in particular lung cancer. ” Mao disclosed (paragraph [0016]): “ In some embodiments, the sprRNA is at least 90% identical to any one of SEQ ID NOS:1-486, 489-494, or 560-2802. ” It is noted that Mao’s SEQ ID NOs 1002, 1223, 1429 and 2379 correspond to piR-hsa-120522 (i.e. they comprise the sequence of instant SEQ ID NO 1 , underlined ): Instant SEQ ID NO 1: ggcggcccgg gttcgactcc cggtgtggga ac Mao SEQ ID NO 1002: guuuucaccc a ggcggcccg gguucgacuc ccgguguggg aac c Mao SEQ ID NO 1223: uuuucaccca ggcggcccgg guucgacucc cgguguggga ac c Mao SEQ ID NO 1429: uuuucaccca ggcggcccgg guucgacucc cgguguggga ac Mao SEQ ID NO 2379: uuuucaccca ggcggcccgg guucgacucc cgguguggga ac ca Mao disclosed (paragraph [0028]): “ In another aspect, the invention provides an isolated probe or primer comprising a nucleic acid sequence that hybridizes to the sprRNAs or cDNAs of the invention. ” Note that a primer or probe is a reagent “for fluorescent quantitative PCR” as recited in claim 4. Mao disclosed (paragraph [0038]): “ In another aspect, the invention provides a method for diagnosing cancer or tumorigenesis in a subject comprising measuring the levels of one or more sprRNAs according to any one of SEQ ID NOS:1-486, 489-494, or 560-2802 in a subject's sample and comparing it to a control sample. ” Mao disclosed (paragraph [0090]): “… piRNA -Ls are differentially expressed between normal bronchial epithelial cells (HBEs) and non-small cell lung cancer (NSCLC) cells as well as between different NSCLC histology subtypes …”. Mao disclosed (paragraph [0152]): “ This invention also relates to the use of nucleic acids, antibodies or other binding reagents reactive specifically against the sprRNAs as diagnostic reagents. Detection of altered sprRNA (or cDNA) can provide a diagnostic tool that can add to or define a diagnosis of a disease or susceptibility to a disease which results from altered expression of the sprRNA . The detection of normal or altered levels of the sprRNA can direct the medical practitioner to set an appropriate course of treatment for the patient. ” Mao disclosed (paragraph [0153]): “ As a means to detect or diagnose neoplastic disorders, such as lung cancer, differences in the levels of sprRNA (or cDNA generated therefrom) between affected and unaffected individuals, or between normal and cancerous tissues can be determined. ” Mao disclosed (paragraph [0155]): “ The diagnostic assays offer a process for diagnosing or determining a susceptibility to a disease or condition, such as a neoplastic disorder, through detection of altered levels of one or more sprRNA by the methods described. Decreased or increased levels can be measured at the RNA level using any of the methods well known in the art for the quantitation of nucleic acids; for example, RT-PCR, RNase protection, Northern blotting, array analysis, and other hybridization methods may be utilized. ” Mao disclosed (paragraph [0157]): “ In some embodiments, the invention provides a method of detecting the presence or absence of one or more sprRNAs in a sample, comprising contacting the sample with a probe comprising a nucleic acid that hybridizes to one or more of the sprRNAs . In some embodiments, the sprRNAs comprise any one of SEQ ID NOS:1-486, 489-494 or 560-2802. In some embodiments, the method comprises contacting a sample from a subject with a probe comprising a nucleic acid that hybridizes to one or more of SEQ ID NOS:1-486, 489-494 or 560-2802. ” Mao disclosed (paragraph [0164]): “ In another embodiment, the invention provides a method for diagnosing cancer or tumorigenesis in a subject comprising measuring the levels of one or more sprRNAs according to any one of SEQ ID NOS:1-486, 489-494 or 560-2802 in a subject's sample and comparing it to a control sample. In some embodiments, the cancer is lung cancer. ” Mao disclosed (paragraph [0165]): “ The sprRNA can be subjected to semi-quantitative RT-PCR, quantitative RT-PCR, or real-time qRT -PCR to determine the levels of the sprRNA in the cells and compare the levels to control samples. In some embodiments, the control sample is from a noncancerous patient. In some embodiments, the sample is selected from the group consisting of cells, blood, plasma, serum saliva, sputum or urine. ” Mao disclosed (paragraph [0170]): “ In another embodiment the present invention relates to a kit for diagnosing cancer in a human subject comprising one or more detection reagents capable of detecting any one or more of the sprRNAs of SEQ ID NOS:1-486, 489-494, or 560-2802. ” Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness . Claim (s) 5, 6, 9 and 10 is/are rejected under 35 U.S.C. 103 as being unpatentable over Mao (US 2018/0273941, cited on IDS) in view of Chen ( CN103555724 A) . A machine translation has been provided for Chen, and all references will be made to this translation. The teachings of Mao have been discussed. Mao did not disclose primers corresponding to SEQ ID NOs 4-6. Chen disclosed a stem-loop-based reverse transcription-quantitative PCR technique for detecting miRNA biomarkers ( page 13, paragraph [0025]). The stem-loop reverse transcription primers for various miRNAs are disclosed beginning at paragraph [0071] on page 33. As can be seen, these primers are made up of a target-specific 3’ portion and a constant 5’ portion (underlined in the examples shown here from paragraph [0071]-[0074]) . It is noted that instant SEQ ID NO 4 follows a similar pattern: hsa-let-7i GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC AACAGC hsa-miR-122 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCAAACA hsa-miR-146a GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACAACCCA hsa-miR-186 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC AGCCC A SEQ ID NO 4 GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC GTTCCC Chen’s forward PCR primers corresponded to sequences of the respective targets (paragraphs [0083]-[0093]). It is noted that instant SEQ ID NO 5 follows a similar pattern; compare instant SEQ ID NO 5 with instant SEQ ID NO 1 (the sequence given for piR-hsa-120522): SEQ ID NO 5 TCGACTCCCGGTGTGGG SEQ ID NO 1 GGCGGCCCGGGT TCGACTCCCGGTGTGGG AAC Finally, Chen reverse PCR primer is universal (see paragraphs [0095]-[0102]) and corresponds to a segment of the constant portion of the stem-loop reverse transcription primers. It is also the same primer as instant SEQ ID NO 6: hsa-let-7i GTCGTATC CAGTGCAGGGTCCGAGGTAT TCGCACTGGATACGAC AACAG C Chen rev ; hsa-let-7i CAGTGCAGGGTCCGAGGTAT SEQ ID NO 6 CAGTGCAGGGTCCGAGGTAT It would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date of the application to use the stem-loop-based reverse transcription-quantitative PCR technique of Chen for quantifying the sprRNA markers of Mao, using the same approach to primer design for the assay based on each target, thereby arriving at primers corresponding to SEQ ID NOs 4-6 for Mao’s targets designated SEQ ID NOs 1002, 1223, 1429 and 2379 . This represents nothing more than using a known assay for quantifying short non-coding RNAs to quantify short non-coding RNAs. Conclusion No claims are free of the prior art. Any inquiry concerning this communication or earlier communications from the examiner should be directed to FILLIN "Examiner name" \* MERGEFORMAT SAMUEL C WOOLWINE whose telephone number is FILLIN "Phone number" \* MERGEFORMAT (571)272-1144 . The examiner can normally be reached FILLIN "Work Schedule?" \* MERGEFORMAT 9am-5:30pm . Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, FILLIN "SPE Name?" \* MERGEFORMAT GARY BENZION can be reached at FILLIN "SPE Phone?" \* MERGEFORMAT 571-272-0782 . The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /SAMUEL C WOOLWINE/ Primary Examiner, Art Unit 1681
Read full office action

Prosecution Timeline

Dec 28, 2023
Application Filed
Mar 22, 2026
Non-Final Rejection — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12595462
HIGH THROUGHPUT GENETIC BARCODING AND ANALYSIS METHODS
2y 5m to grant Granted Apr 07, 2026
Patent 12584167
METHOD FOR AMPLIFYING NUCLEOTIDE SEQUENCE AND SEQUENCE DETERMINATION
2y 5m to grant Granted Mar 24, 2026
Patent 12545951
SIMPLIFIED POLYNUCLEOTIDE SEQUENCE DETECTION METHOD
2y 5m to grant Granted Feb 10, 2026
Patent 12534569
FLOW CELLS
2y 5m to grant Granted Jan 27, 2026
Patent 12529097
DIGITAL ANALYTE ANALYSIS
2y 5m to grant Granted Jan 20, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
61%
Grant Probability
81%
With Interview (+19.8%)
3y 9m
Median Time to Grant
Low
PTA Risk
Based on 843 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month