DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
Applicant’s amendment filed December 29, 2023 is acknowledged. Claims 1-5, 8-11, and 13 were amended. Claims 1-13 are pending and under consideration hereinafter.
Priority
Applicant’s priority claims to Application Nos. EP21305954.6 and PCT/EP2022/068936 are acknowledged. Claims 1-13 find support in Application No. EP21305954.6. The effective filing date of the claims under examination is July 9, 2021.
Nucleotide and/or Amino Acid Sequence Disclosures
Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures
37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted:
1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying:
a. the name of the XML file
b. the date of creation; and
c. the size of the XML file in bytes; or
2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying:
a. the name of the XML file;
b. the date of creation; and
c. the size of the XML file in bytes.
SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS:
Specific deficiency - The incorporation by reference paragraph required by 37 CFR 1.834(c)(1), 1.835(a)(2), or 1.835(b)(2) is defective. Specifically, USPTO records indicate that the size of the sequence listing filed August 19, 2024 is “4,674 bytes,” rather than “8,674 bytes” as indicated in the substitute specification also filed August 19, 2024.
Required response - Applicant must provide a substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation by reference paragraph, consisting of:
• A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
• A copy of the amended specification without markings (clean version); and
• A statement that the substitute specification contains no new matter.
Drawings
The drawings are objected to because of the following informalities:
The view numbers are preceded by the term “Figure.” 37 C.F.R. 1.84(u)(1) states that “view numbers must be preceded by the abbreviation "FIG."
The view numbers of Figs. 9B-C are not oriented in the same direction as the view so as to avoid having to rotate the sheet. 37 CFR 1.84(p)(1) states “Reference characters (numerals are preferred), sheet numbers, and view numbers must be plain and legible, and must not be used in association with brackets or inverted commas, or enclosed within outlines, e.g., encircled. They must be oriented in the same direction as the view so as to avoid having to rotate the sheet.”
Appropriate correction is required.
Specification
The specification is objected to because of the following informalities:
The use of terms which are trade names or marks used in commerce has been noted in this application, e.g., “lipofectamine” (at least pg. 16, line 3), “TrypLE” (pg. 20, line 29). Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. The terms, including the exemplary terms above, should be accompanied by the generic terminology; furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Appropriate correction is required.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-13 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites “improving striated muscle cell relaxation in a subject.” The phrase “improving striated muscle cell relaxation” is not defined by the claim. The specification provides that “improv[ing] striated muscle relaxation” “refers to an improvement… that can be at least about 10%... or more” in “striated muscle cell relaxation,” which is “a state when striated myocytes have a low resting tension” (pg. 4). This definition, however, does not provide a standard for ascertaining the requisite degree of “improving straited muscle cell relaxation” because the definition itself contains relative language that lacks a standard for ascertaining the requisite degree (i.e., “about,” and “low resting tension”) and does not clearly provide what would constitute an “improvement,” e.g., a difference in the duration or intensity of contraction, or in viscoelastic forces, or in a subject’s perceived striated muscle relaxation, etc. The specification provides various causes which can lead to “abnormal relaxation state[s],” and exemplary means through which relaxation may be assessed (e.g., “impulse elastography, myostretching or atomic force microscopy”), but these also do not provide a clear standard for ascertaining the requisite degree of “improving straited muscle cell relaxation” at least because the causes introduce additional relative language (e.g., “abnormal,” “dysfunctional,” “shorter” “stiffer,” “high resting tension”), the means have vastly different outputs, and the speciifcation does not provide any metrics for ascertaining what would be considered “improv[ed] relaxation” in even the exemplary means (pg. 4).
Claims 2-12 are rejected for depending from claim 1 and failing to remedy the indefiniteness.
Claim 2 recites that “a nucleotide sequence of miR-548u and miR-548v is at least about 80%... or more identical to a nucleotide sequence of miR-548u or miR-548v.” The scope of nucleotide sequences encompassed by the claim is unclear due to the phrase “at least about.” For example, a nucleotide sequence that is 79% identical would not be considered “at least… 80%,” but could be considered “about 80%.”
Claim 5 recites the term “striated muscle stiffness.” The term “striated muscle cell stiffness” is not defined by the claim. The term is also not explicitly defined in the specification. The specification appears to define striated muscle stiffness as an opposing state to “striated muscle relaxation” (pg. 4). This does not provide a standard for ascertaining the requisite degree of “straited muscle stiffness” because the scope of a term cannot be reasonably ascertained when it is defined only by what it is not (i.e., not “relaxation”), when what it is not (i.e., “striated muscle relaxation”) lacks a standard for ascertaining the requisite degree for the reasons described above.
Claims 6-9 are rejected for depending from claim 5 and failing to remedy the indefiniteness.
Claim 13 recites the phrase “a form that is suitable for administration to a subject in need of improved striated muscle relaxation.” The specification, while describing various “pharmaceutically acceptable” composition forms (pg. 11-13), does not appear to describe any composition forms which are specifically “suitable for administration to a subject in need of improved straited muscle relaxation.” It is not clear which of the many forms known in the art would be “suitable for administration to a subject in need of improved striated muscle relaxation,” or if any form which would be considered pharmaceutically acceptable would be suitable. The skilled artisan would not be reasonably apprised of the forms which are encompassed/excluded by the claim, which renders the claim indefinite.
Claim Rejections - 35 USC § 112(a) – Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, and 5-13 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention for the reasons that follow.
MPEP 2163.II.A3.(a).(i) states the following:
“The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the inventor was in possession of the claimed genus.”
“Satisfactory disclosure of a "representative number" depends on whether one of skill in the art would recognize that the inventor was in possession of the necessary common attributes or features possessed by the members of the genus in view of the species disclosed. For inventions in an unpredictable art, adequate written description of a genus which embraces widely variant species cannot be achieved by disclosing only one species within the genus. See, e.g., Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406. Instead, the disclosure must adequately reflect the structural diversity of the claimed genus, either through the disclosure of sufficient species that are "representative of the full variety or scope of the genus," or by the establishment of "a reasonable structure-function correlation." Such correlations may be established "by the inventor as described in the specification," or they may be "known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1300-01, 111 USPQ2d 1780, 1790-91 (Fed. Cir. 2014).”
Species Encompassed
Claims 1-2, and 5-13 encompass “miR-548u and miR-548v” which are interpreted as referring to a mature miR-548u or miR-548v sequence, or homologs, variants, and isoforms thereof (pg. 6-7). For example, various primate species miR-548u or miR-548v (pg. 25), or sequences comprising at least 80% identity to a miR-548u or miR-548v sequence (pg. 7). The specification provides that “miR-548u” and “miR-548v” denote miRNAs able to improve straited myocyte relaxation (pg. 6-7). This is also the outcome required of the instant claims. In view of the indefiniteness described above, the phrases “improv[ing] striated myocyte relaxation,” or “improving striated muscle cell relaxation” are interpreted as “improving” to any degree, and by any metric, some aspect of striated muscle cell “relaxation,” which is interpreted as a state of comparatively reduced cellular tension.
Accordingly, the claims encompass a genus of miR-548u and miR-548v, e.g., known miR-548u and miR-548v sequences, and variants, homologs, and isoforms thereof, which have the function of improving striated myocyte relaxation. The specification has not sufficiently described the genus of miR-548u and miR-548v which achieve this function.
Species Disclosed in the Specification
The specification describes commercially-available human miR-548v and miR-548u mimics, which are chemically modified double-stranded RNAs (see ThermoFisher product information for miRVana miRNA mimics covering miRBase v. 21, available 21 July 2019, and 18 August 2019, as evidenced by the WayBack Machine). The specification demonstrates that the mimics achieve the functions of improving striated myocyte relaxation as interpreted herein (see Examples 1-2, further described in detail below). The specification also describes the unmodified mature sequences of human miR-548v and miR-548u, and the precursor sequences thereof (see SEQ ID NOs: 1-4, pg. 7-8). The skilled artisan would predict that these sequences would have the same functions as the mimics owing to their conserved structure. The specification, while generically describing variants of miR-548u and miR-548v (pg. 7), and describing that the miRNAs are part of a “primate-specific” family (pg. 25), does not actually describe any variants, homologs, or isoforms of the human miR-548v and miR-548u sequences, or provide any data which would guide the skilled artisan to species which would have the function of improving striated myocyte relaxation.
Guidance in the Art
The prior art also describes the sequences of human precursor miR-548v and miR-548u (Butler et al., WO 2014/012081 A2, published 16 January 2014, SEQ ID NOs: 1218-1219), as well as the mature sequences of human miR-548v and miR-548u (Wang et al., WO 2012/009508 A2, published 19 January 2012, SEQ ID NOs: 51-52). The prior art generally describes various chemically-modified and sequence-modified miRNA variants (see, for example, [001061]-[001066] of Butler, pgs. 24-27 of Wang). The prior art also describes the specific chemically-modified mimics of human miR-548u and miR-548v described in the specification (see ThermoFisher product information for miRVana miRNA mimics covering miRBase v. 21, available 21 July 2019, and 18 August 2019 as evidenced by the WayBack Machine). The prior art describes a single homolog for each of human miR-548v and miR-548u (see miRBase entries for “Stem-loop cja-miR-548v,” and Stem-loop cja-miR-548u,” accessed 6 June 2026). The prior art does not attribute any myocyte relaxation improving-function to any of the aforementioned species.
The prior art teaches that the miR-548 family is “poorly conserved” (see Liang et al., 2012, Journal of Biomedicine and Biotechnology, pg. 1-8). The prior art teaches that the seed sequence of a miRNA dictates its target(s) and biological role(s), and observes frequent “seed-shifting” within the miR-548 family that “led to shift… of target mRNAs, even generated [] new target mRNAs” (Liang, pg. 6, right col.; Abstract). The prior art teaches that targets of miRNAs can be predicted based on sequence (Liang, pg. 2-4), but also provides that the biological networks downstream of miR-548 family members are complex and remain uncharacterized functionally (“it is quite necessary to further study its evolutionary and functional relationship by systematic analysis,” pg. 2, left col.; “the primate-specific gene family might contribute to dynamic expression profiles and regulatory networks,” Abstract). Indeed, the prior art teaches that “[r]esearch of miRNA target genes has proved to be more complicated than predictable… [a]ll candidate miRNA targets must be experimentally validated to verify their role” (Riolo et al., 2020, Methods and Protocols, 4, 1, pg. 1-20; pg. 16).
Taken together, the prior art provides additional species within the genus, i.e., a single homolog for each of miR-548v and miR-548u (see miRBase entries for “Stem-loop cja-miR-548v,” and Stem-loop cja-miR-548u,” accessed 6 June 2026). However, the prior art provides significant uncertainty that any other species’ miR-548v or miR-548u sequences, or homologs, variants, or isoforms of any miR-548u or miR-548v sequences, would have the same function as the human miR-548v and miR-548u sequences or human miR-548v and miR-548u mimics described in the specification, because differences in miRNA sequence result in differences in function, and the functional effects of sequence changes in the miR-548 family, or miRNAs in general, are not predictable or well characterized.
Conclusion
Considering the large variation in the genus, the small percentage of species described in the specification, and the lack of predictability provided by the art for the full scope of the claimed genus, it is reasonable to conclude that Applicant did not possess the invention as claimed at the time of filing.
Claim Rejections - 35 USC § 112(a) – Enablement
Claims 1-12 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention for the reasons that follow.
The test of enablement is whether one skilled in the art could make or use the claimed invention from the disclosures in the specification coupled with information known in the art without undue experimentation (United States v. Telectronics Inc., 857 F.2d 778, 785, 8 USPQ2d 1217, 1223 (Fed. Cir. 1988)). Whether undue experimentation is needed is not based upon a single factor, but rather is a conclusion reached by weighing many factors. These factors were outlined in In re Wands, 858 F.2d 731, 737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988), and the most relevant factors are indicated below:
Nature of the Invention and Breadth of the Claims
Claim 1 recites a “method for improving striated muscle cell relaxation in a subject in need thereof comprising administering to the subject a therapeutically effective amount of at least one miRNA selected from the group consisting of miR-548u and miR-548v.” In view of the indefiniteness described above, the phrase “improving striated muscle cell relaxation in a subject” is interpreted as a method which “improves” to any degree, and by any metric, some aspect of striated muscle cell “relaxation,” which is interpreted as a state of comparatively reduced cellular tension. The terms “miR-548u” and “miR-548v” are interpreted as referring to a mature miR-548u or miR-548v, or homologs, variants, and isoforms thereof (pg. 6-7).
Enablement of claims 1-2 require that one of ordinary skill, without undue experimentation, be able to improve straited muscle cell relaxation in a subject as interpreted herein, by administering any miR-548u or miR-548v mature sequence, or homolog, variant, or isoform thereof. The claims encompass improving striated muscle cell relaxation in the context of striated muscle stiffness, e.g., in Parkinson’s disease, and heart failure with preserved ejection fraction.
Guidance in the Specification
The specification demonstrates that transfection of engineered cardiac tissue (ECT) with commercially-available human miR-548u or miR-548v mimics shown in Table 1 results in increased relaxation velocity, and improved or increased contraction force (pg. 14-18). The specification also demonstrates that transfection of human induced pluripotent stem cells derived cardiomyocytes (hiPSC-CM) with a commercially-available human miR-548v mimic results in “significantly increased” relaxation velocities, increased contraction velocities, beating amplitudes and rate (pg. 24-25), and increased viscoelastic tension (pg. 27-28). The specification demonstrates that the human miR-548v mimic also elicits increased relaxation velocities in transfected hiPSC-CM engineered cardiac tissue (hECT) (pg. 25-26). The commercially-available human miR-548v and miR-548u mimics used in specification are proprietary chemically-modified double-stranded RNAs (see product information for miRVana miRNA mimics covering miRBase v. 21, as evidenced by the WayBack Machine).
The specification does not provide any examples in other striated muscle cell types, i.e., skeletal muscle. The specification does not provide any examples of using miR-548v and miR-548u sequences from other primate species (“primate-specific miR-548 family, pg. 25), unmodified miR-548v and miR-548u mature sequences, miR-548v and miR-548u precursor sequences, or variants, homologs, or isoforms of miR-548v and miR-548u sequences. The specification does not provide any examples in subjects, e.g., subjects suffering from striated muscle stiffness, e.g., in Parkinson’s disease, or heart failure with preserved ejection fraction.
The specification suggests that there was no evidence prior to the effective filing date that human miR-548v or miR-548u regulate aspects of striated muscle cell relaxation (pg. 25). The specification also suggests that the mechanisms regulating relaxation of a particular type of striated muscle cell, i.e., cardiomyocytes, are not well understood, and tools and techniques to characterize aspects of relaxation have only recently emerged (pg. 1-2). The specification also provides evidence that miRNAs regulate “almost every cellular process” (pg. 2). The specification describes the effects of a human miR-548v mimic on the transcriptome of human induced pluripotent stem cells derived cardiomyocytes (pg. 26-27). However, the specification does not provide any guidance to ascertain the effects of miR-548v or miR-548u encompassed by the claims on any other cells, e.g., striated muscle cells in vivo, including skeletal muscle cells, or cells which impact striated muscle cell relaxation, e.g., neurons, or other cells within cardiac tissue, e.g., endothelial cells which the specification teaches “show[] an enrichment of hsa-miR-548v” (pg. 25).
The specification does describe examples in 3D culture (i.e., “ECT”), which the specification teaches is more representative of an in vivo state than 2D culture (pg. 25). However, it is not evident that the skilled artisan could extrapolate the in vitro examples of the specification, to in vivo methods in a subject where striated muscle cells are integrated into a system with much greater complexity than the specification’s 3D model, at least with respect to tissue maturity, organization, and forces (see Mather et al., and Turnbull et al., further described below). Beyond the examples in the specification, the specification suggests that there is a complete lack of knowledge regarding the effects of miR-548v or miR-548u on striated muscle cell relaxation, let alone the effects of any variants, homologs or isoforms thereof. The specification also provides evidence that the mechanisms regulating straited muscle cell relaxation, and even the tools and techniques to assess such relaxation, are not well understood. It is not evident that the skilled artisan could predict the effects of administering miR-548v or miR-548u on straited muscle cell relaxation in a subject, e.g., a subject with striated muscle stiffness, e.g., in Parkinson’s disease, or a subject with heart failure with preserved ejection fraction, given the limited examples and guidance in the specification.
State of the Prior Art
As stated above, the prior art describes the sequences of human precursor miR-548v and miR-548u (Butler et al., WO2014012081 A2, published 16 January 2014, SEQ ID NOs: 1218-1219), as well as the mature sequences of human miR-548v and miR-548u (Wang et al., WO 2012/009508 A2, published 19 January 2012, SEQ ID NOs: 51-52). The prior art generally describes various chemically-modified and sequence-modified miRNA variants (see, for example, [001061]-[001066] of Butler, pgs. 24-27 of Wang). The prior art also describes the specific chemically-modified mimics of human miR-548u and miR-548v described in the specification (see ThermoFisher product information for miRVana miRNA mimics covering miRBase v. 21, available July 2019 and August 2019 as evidenced by the WayBack Machine). The prior art describes a single homolog for each of human miR-548v and miR-548u (see miRBase entries for cja-miR-548v and cja-miR-548u). However, a thorough search of the prior art failed to uncover any examples, working or theoretical, of the instantly claimed methods, or any evidence to suggest that miR-548v or miR-548u encompassed by the claim regulate striated muscle cell relaxation, or muscle physiology generally.
The closest prior art to the instantly claimed methods of improving striated muscle cell relaxation, wherein the subject suffers from heart failure with preserved ejection fraction is Gupta (Gupta et al., 2013, Journal of Molecular and Cellular Cardiology, 62 (2013), pg. 131-141). Gupta describes downregulation of several miR-548 family members in peripheral blood mononuclear cells (PBMCs) of heart failure patients (Abstract; Table 3). However, miR-548u and miR-548v were not among the miR-548 family members identified by Gupta, and Gupta does not describe the levels of miR-548u or miR-548v in any striated muscle cells, e.g., cardiomyoctes. It is not evident that miR-548u or miR-548v encompassed by the claim would be predicted to regulate cardiomyocyte relaxation in a subject, e.g., a subject with heart failure, given the lack of information in the prior art related to miR-548u or miR-548v in cardiomyocyte physiology.
The prior art fails to provide evidence that miR-548v or miR-548u regulate muscle stiffness associated with Parkinson’s disease. It is also not evident how the instantly claimed methods relate to skeletal muscle rigidity associated with Parkinson’s disease, given that skeletal muscle rigidity in Parkinson’s appears to be the result of neurodegeneration and proteinaceous cytoplasmic inclusions (see Scorza et al., 2018, Journal of Clinical Neuroscience, 53 (2018), pg. 1-5; “PD is… a complex progressive neurodegenerative disorder referred by.. rigidity,” pg. 1; “the main, characteristic neuropathological feature of PD is related to loss of dopaminergic neurons… and widespread intracellular protein…,” pg. 1, right col.). While Parkinson’s disease is associated with various structural changes in the heart and an increased risk for heart failure (“PD patients carry an increased risk of developing cardiac disease… increased rate of heart failure,” pg. 2, left col., Scorza), it is not evident that miR-548u or miR-548v encompassed by the claim would be predicted to remedy these conditions, given that the cause of cardiac changes in PD does not appear to be understood.
The prior art provides evidence that miRNA-based therapies are unpredictable, and face unresolved challenges. Bajan (Bajan et al., 2020, Cells, 9, 137, pg. 1-27) teaches that no miRNA-based drugs have reached a clinical setting. Bajan teaches this may be related to the ability of the miRNA network, which is “intricate,” comprising “inbuilt redundancies and few confirmed targets,” to “absorb and ‘correct’ for the effect of a [miRNA-based] drug” (pg. 17). Bajan also describes in vivo toxicity related to miRNA replacement (pg. 14). Bajan also teaches that “[i]dentifying and validating the suitability of a miRNA as a therapeutic target [is] still [a] major challenge in the field,” in part due to the low accuracy rate of predicting miRNA regulatory networks (pg. 14). Indeed, as described by Riolo, “[r]esearch of miRNA target genes has proved to be more complicated than predictable… [a]ll candidate miRNA targets must be experimentally validated to verify their role” (pg. 16). The search did not uncover any guidance which would allow the skilled artisan to predict the target(s) of miR-548u or miR-548v encompassed by the claim, and/or predict the physiological consequences of the administering the miRNAs to subjects.
The prior art also provides evidence that 3D models of cardiac tissue, such as those described in the specification, are not predictive of methods in a subject. For example, Turnbull (Turnbull et al., 2013, The FASEB Journal, 28, pg. 644-654) teaches that hECT is a “simplified model that lacks many components of a working heart, such as humoral, metabolic, and neurogenic factors that affect cardiac function and interventional responses” (pg. 653, left col.). Turnbull also teaches that hECT “may represent an immature human cardiac phenotype,” which Mathur (Mathur et al., 2016, Advanced Drug Delivery Reviews, 96 (2016), pg. 203-213) teaches is a major barrier to translational applications (“immaturity of hiPSC-CMs complicates the cells’ adoption as a reliable readout for translational applications. Such immature embryonic or neonatal-like CMs cannot compare morphologically with large and stiff ventricular CMs in the adult human heart. Thus, cardiac tissues constructed from hiPSC-CMs have significantly lower field potentials and contraction forces than adult ventricular tissue, so at this point cannot be considered an exact in vitro model of mature myocardium,” pg. 210, right col.).
Taken together, the prior art does not provide any examples of the claimed method, and fails to provide evidence which would suggest that the claimed methods could be performed in a subject and achieve “improv[ed] striated muscle cell relaxation” generally, or in the context of striated muscle stiffness, e.g., in Parkinson’s disease, cardiomyocytes, or in heart failure with preserved ejection fraction.
Experimentation Required and Level of Skill in the Art
In order to practice the invention, a large amount of highly unpredictable experimentation would be required. The skilled artisan would need to prepare miR-548v and miR-548u sequences encompassed by the claims, e.g., mature sequences from various primate species, chemically-modified variants, precursors, and variants, homologs, and isoforms, with various differences relative to a miR-548v or miR-548u sequence. The skilled artisan would then need to administer the miR-548v and miR-548u sequences to subjects encompassed by the claims, e.g., mammalian subjects, human subjects, subjects with muscle stiffness, Parkinson’s disease, or heart failure. The skilled artisan would need to determine the dose, duration, and routes to administer the miR-548v and miR-548u sequences to the various subjects. The skilled artisan would then need to determine whether the administration “improv[ed] striated muscle cell relaxation,” e.g., by using one of the means described in the specification (“impulse elastography, myostretching or atomic force microscopy,” pg. 4).
The level of skill in the art is high, and the aforementioned experimentation is within the purview of the skilled artisan. However, the amount of experimentation is undue. Neither the specification nor prior art provide examples of the instantly claimed methods, nor evidence that the skilled artisan could use to reasonably predict that the claimed methods could achieve “improv[ed] striated muscle cell relaxation” in a subject, e.g., a subject with striated muscle stiffness, e.g., due to Parkinson’s disease, or heart failure with preserved ejection fraction. The only guidance with respect to the use miR-548v or miR-548u sequences in the context of improved striated muscle cell relaxation are the narrow, in vitro examples described in the specification. As described above, the specification and prior art provide evidence that the skilled artisan could not reasonably extrapolate the results achieved in the specification’s in vitro to results in a subject.
Conclusion
Taking into consideration the factors outlined above, it is the conclusion that undue experimentation would be required to practice the methods as claimed.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claim 13 is rejected under 35 U.S.C. 101 because the claimed invention is directed to a law of nature or natural phenomena without significantly more. The claim recites a “therapeutic composition comprising at least one miRNA selected from the group consisting of miR-548u or miR-548v, wherein the therapeutic composition is in a form that is suitable for administration to a subject in need of improved straited muscle relaxation.” The term “therapeutic” is interpreted as reciting an intended use for the composition, which does not structurally limit the claim because the claim body recites a structurally complete invention. In view of the indefiniteness described above, the phrase “in a form that is suitable for administration to a subject in need of improved striated muscle relaxation” is interpreted as requiring that the composition be suitable for administration to a subject, e.g., that the composition be “pharmaceutically acceptable” (pg. 11). Pharmaceutically acceptable carriers or excipients are interpreted as referring to any type of non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material, or formulation auxiliary (pg. 11). The claim, therefore, encompasses a composition comprising at least one miRNA selected from miR-548u or miR-548v, which is interpreted as referring to a mature miR-548u or miR-548v sequence, or homologs, variants, and isoforms thereof (pg. 6-7), in a non-toxic encapsulating material.
Laws of nature and natural phenomena, as identified by the courts, include naturally occurring principles/relations and nature-based products that are naturally occurring or that do not have markedly different characteristics compared to what occurs in nature. Expression Atlas teaches that miR-548u and miR-548v occur naturally inside human cells (“ensg00000212017 (MIR548U) homo sapiens microRNA 548u,” and “ensg00000265520 (MIR548V) homo sapiens microRNA 548v,” accessed 4 June 2026). Human cells meet the scope of a non-toxic encapsulating material. Therefore, the composition of claim 13 is not markedly different from its naturally-occurring counterpart. Claim 13 recites a nature-based product.
As stated above, the claim recites the term “therapeutic,” which is interpreted as reciting an intended use for the composition. This intended use does not structurally limit the claim. Thus, the judicial exception is not integrated into a practical application and does not include additional elements that are sufficient to amount to significantly more than the judicial exception.
Claim Rejections - 35 USC § 102 - Wang
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claim 13 is rejected under 35 U.S.C. 102(a)(1) and 35 U.S.C. 102(a)(2) as being anticipated by Wang (Wang et al., WO 2012/009508 A2, published 19 January 2012).
As described above, claim 13 is interpreted as encompassing a composition comprising at least one miRNA selected from miR-548u or miR-548v, which is interpreted as referring to a mature miR-548u or miR-548v sequence, or homologs, variants, and isoforms thereof (pg. 6-7), in a pharmaceutically acceptable form, e.g., comprising a non-toxic solid, semi-solid or liquid filler, diluent, encapsulating material, or formulation auxiliary (pg. 11). The term “therapeutic” is interpreted as reciting an intended use which does not structurally limit the composition.
Wang teaches a composition, which is intended to be used therapeutically, wherein the composition comprises at least one miRNA in a pharmaceutically acceptable form (“the miR-548 family is included in this disclosure. MiR-548 family of sequences include mature sequences selected from:… CAAAGACUGCAAUUACUUUUGCG (SEQ ID NO: 51), AGCUACAGUUACUUUUGCACCA (SEQ ID NO: 52),” pg. 4; “the present disclosure provides a pharmaceutical composition comprising a microRNA of the disclosure or a nucleic acid molecule encoding a microRNA of the disclosure…,” pg. 38; “[c]onventional pharmaceutical practice may be employed to provide suitable formations or compositions to administer the compounds to patients suffering from neoplasia… [m]ethods well known in the art for making formulations are found…,” pg. 38; pg. 37-40). As shown in Fig. A below, the mature miR-548 sequences disclosed by Wang are 100% identical to the mature sequences of miR-548u and miR-548v disclosed in the specification (pg. 7). Thus, Wang’s composition meets the limitations of claim 13.
FIGURE A
CAAAGACUGCAAUUACUUUUGCG Instant SEQ ID NO: 1, “hsa-miR-548u”
CAAAGACUGCAAUUACUUUUGCG Wang, SEQ ID NO: 51
AGCUACAGUUACUUUUGCACCA Instant SEQ ID NO: 2, “hsa-miR-548v”
AGCUACAGUUACUUUUGCACCA Wang, SEQ ID NO: 51
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to JENNA L PERSONS whose telephone number is (703)756-1334. The examiner can normally be reached M-F: 9-5pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, JENNIFER A DUNSTON can be reached at (571) 272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/JENNA L PERSONS/Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637
Prosecution Insights