DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application and Claims Status Summary
Claims 1- 6, 8- 12, 15, 16, 18, 19, 21, 23, 32- 34, 36, and 37 are pending.
Claims 19, 21, 23, 32- 34, and 36 are withdrawn.
Claims 1- 6, 8- 12, 15, 16, 18, and 37 are considered on the merits.
Claims 1- 6, 8- 12, 15, 16, 18, and 37 are rejected.
No claims are allowed.
Election/Restrictions
Applicant’s election without traverse of Invention I, claims 1-6, 8- 12, 15, 16, 18, and 37, drawn to a “recombinant adeno-associated virus (rAAV) vector” in the reply filed on 2026 July 27 is acknowledged.
Claims 19, 21, 23, 32, 33, 34, and 36 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 2026 July 27.
Applicant’s election without traverse of species “crRNA SEQ ID NO 60” in the reply filed on 2026 July 27 is acknowledged.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1, 3, 6, 15, 16 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ekman (Ekman et al. Mol Ther Nucleic Acids. 2019 Sep 6;17:829-839.).
Regarding claim 1, Ekman provides a cartoon and explanation of their rAAV, “(A) Cartoon of the human HTT transgene ... Arrowhead indicates approximate location of sgRNA [crRNA] binding site. (B) Schematic of the AAV vector. ITR, inverted terminal repeat; hSyn, human synapsin promoter; NLS, nuclear localization sequence; 3xHA, three tandem repeats of the human influenza hemagglutinin (HA) epitope tag.” (Figures 2A, 2B, shown below).
PNG
media_image1.png
182
386
media_image1.png
Greyscale
Notice, Ekman’s vector’s 5’ to 3’ topography meets the claim criteria set forth: 5’ a first ITR (clause a); a gene targeting crRNA (clause b), and a second ITR (clause c). Ekman’s sgRNA targets the HTT gene and therefore teaches clause b) “crRNA sequence having homology to … a huntingtin (HTT) gene.” Ekman provides further explanation their sgRNA (crRNA) targets the HTT gene, “We injected ... mice … with … an AAV1 vector encoding SaCas9 and … sgRNA targeting the human HTT gene (AAV1-SaCas9-HTT)” (page 830, 2nd column 3rd paragraph).
Regarding claim 3, Ekman further teaches “one or more nuclear localization signals (NLSs)” as shown above in the image and the following explanation of their rAAV cartoon, “NLS, nuclear localization sequence.”
Regarding claim 6, Ekman further teaches “one or more human influenza hemagglutinin (HA) epitope tags” as shown above in the image and the following explanation of their rAAV cartoon, “3xHA, three tandem repeats of the human influenza hemagglutinin (HA) epitope tag.”
Regarding claims 15 and 16, Ekman further teaches the nucleic acid molecule encodes an AAV capsid protein by showing, in their Figure 2C diagram “Timeline for in vivo studies” (shown below), their AAV is delivered via capsid as noted by the arrow.
PNG
media_image2.png
95
364
media_image2.png
Greyscale
Furthermore, Ekman reinforces the AAV capsid protein is an AAV1 and/or AAV9 by describing their immunofluorescent staining in Figure 2D, “Immunofluorescent staining of striatal sections 4 weeks after R6/2 mice were injected with 6 X 1010 vector genomes of (left) AAV1-SaCas9-mRosa26 or (right) AAV1-SaCas9-HTT” (Figure 2D legend).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim(s) 2, 4, and 37 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ekman (Ekman et al. Mol Ther Nucleic Acids. 2019 Sep 6;17:829-839.) as applied to claim 1 above, and further in view of Gao (Gao US 20220186257 A1).
Regarding claim 2, Ekman further teaches “a promoter sequence” between the first and second ITRs as shown above in the image and the following explanation of their rAAV cartoon, “hSyn, human synapsin promoter.” Furthermore, recall Ekman’s vector encodes Cas9 nuclease (see image and description above).
However, Ekman does not teach, “further comprising between the first AAV ITR and the second AAV ITR sequence: … (b) a … Cas13 polypeptide; and (c) a polyA sequence.”
Ekman states the purpose (field of endeavor) of their CRISPR-Cas based AAV is to “permanently disable mutant gene function” and furthermore, “Cas9… can be used to disrupt the expression of the mutant HTT gene” (Abstract).
Gao is in the same field of endeavor, “the disclosure provides an isolated nucleic acid or an rAAV encoding a transgene comprising an RNA-guided nuclease (RGN) operably linked to a first promoter, and a second promoter operably linked to a multi guide-RNA (multi-gRNA) expression cassette…” [Abstract]. Gao further explains their field, “Aspects of the disclosure relate to compositions and methods for silencing one or more target genes in a cell or subject.” [0003]. This is consistent with the instant application’s field, “as various neurological disorders arise… that could benefit from gene silencing, we demonstrate that Cas13 can be delivered … to mediate the knockdown of the specific genes” [0014]. Gao continues by teaching the remaining elements of the claim in their statement, “The rAAV vectors and rAAVs described herein have the following architecture: 5′ITR-U6 promoter-multi guide cassette-CB6 promoter-CasRx-polyA-3′ITR” [0089], [0090]. CasRx is described as, “an RGN [RNA-guided nuclease] is a Cas13 family protein or a variant thereof. In some embodiments, an RGN is a Cas13RX…” [0005]
It would have been obvious for a person having ordinary skill in the art (PHOSITA) before the effective filing date of the claimed invention to have added the Cas13 (CasRx) and PolyA sequence as taught by Gao to the AAV as taught by Ekman because it is simply combining prior art elements according to known methods to yield predictable results. Both Ekman and Gao were in the field of gene manipulation via AAVs; in particular gene knockdown. Whereas Ekman utilizes a genome targeted gene knockdown method, Gao utilizes an expression targeted gene knockdown method for the same end result. Furthermore, they both successfully incorporated CRISPR nuclease technology in their gene knockdown systems. Further still, Gao and Ekman oriented the components of their AAVs in the same 5’ to 3’ direction, indicating a single-minded design strategy. A PHOSITA in the field of genetic knockdowns would necessarily be familiar with multiple modes of gene knockdown. Furthermore, a PHOSITA would have recognized the combination of Gao’s Cas13 and PolyA sequence would operate structurally and functionally the same in Ekman’s AAV. With this recognition in mind, a PHOSITA familiar with expression level gene knockdown would have taken advantage of Gao’s expression level mode of gene knockdown in Ekman’s genome level mode of knockdown AAV and therefore a PHOSITA would have predicted the combination of Gao and Ekman’s AAV.
Regarding claim 4, Ekman and Gao teach the AAV comprising Cas13 (substituted for SaCas9) as described above.
Furthermore, Ekman’s rAAV cartoon teaches “the one or more NLSs occur 5' to the nucleic acid molecule encoding the Cas13 polypeptide” as shown above in the image and the following explanation of their rAAV cartoon, “NLS, nuclear localization sequence.” The NLSs are position 5’ and 3’ to the SaCas9.
Regarding claim 37, Ekman and Gao teach the AAV comprising Cas13 (substituted for SaCas9) as described above and a promoter.
Furthermore, Gao’s statement above teaches, “wherein a promoter is associated with the crRNA sequence having homology to … a huntingtin (HTT) gene, such that the promoter drives expression of the crRNA sequence.”
Claim(s) 5 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ekman (Ekman et al. Mol Ther Nucleic Acids. 2019 Sep 6;17:829-839.), and Gao (Gao US 20220186257 A1), as applied to claim 1 and 2 above, and further in view of Lim (Lim et al. Treatment of a Mouse Model of ALS by In Vivo Base Editing. Mol Ther. 2020 Apr 8;28(4):1177-1189. Epub 2020 Jan 14.).
Regarding claim 5, Ekman-Gao teaches claim 1 and 2 as described above, including, “a promoter sequence” between the first and second ITRs as shown above.
However, Ekman-Gao does not teach, “wherein the promoter sequence is a cytomegalovirus early enhancer/chicken β-actin (CAG) promoter sequence.”
Lim is in the same field of endeavor, gene therapy via CRISPR and AAV technologies. However, in their embodiment, the disease target is the superoxide dismutase 1 (SOD1) gene, “we establish an intein-mediated trans-splicing system that enables in vivo delivery of cytidine base editors (CBEs) consisting of the widely used Cas9 protein from Streptococcus pyogenes. We show that intrathecal injection of dual AAV particles encoding a split-intein CBE engineered to trans-splice and introduce a nonsense-coding substitution into a mutant SOD1 gene…” (Abstract). Furthermore, Lim teaches their system in their Figure 3A vector cartoon diagram (shown below).
PNG
media_image3.png
174
266
media_image3.png
Greyscale
Notice in the top vector, between the end ITRs, and adjacent to the 5’ ITR, Lim teaches their use of the CAG promoter. For clarity, Lim describes the cartoon in the figure legend, “A) Schematic of AAV vectors encoding the split-intein CBE. Abbreviations are as follows: ITR, inverted terminal repeat; CAG, cytomegalovirus early enhancer/chicken β-actin promoter; NLS, nuclear localization signal; Int-N, N-terminal intein domain; Int-C, C-terminal intein domain, V5, V5 epitope tag; 3 x HA, three tandem repeats of the human influenza hemagglutinin (HA) epitope tag.”
It would have been obvious for a person having ordinary skill in the art (PHOSITA) before the effective filing date of the claimed invention to have combined the CAG promoter sequence taught by Lim with the AAV vector as taught by Ekman-Gao because it is simply combining prior art elements according to known methods to yield predictable results. Both Ekman-Gao and Lim were in the field of gene manipulation via AAVs. Furthermore, they both successfully incorporated CRISPR technology. Furthermore, a PHOSITA would have recognized Lim’s CAG promoter sequence would operate structurally and functionally the same in Ekman-Gao’s AAV as in their own AAV and therefore a PHOSITA would have predicted the combination of Lim’s CAG promoter with and Ekman-Gao’s AAV.
Claim(s) 8 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ekman (Ekman et al. Mol Ther Nucleic Acids. 2019 Sep 6;17:829-839.) as applied to claim 1 above, and further in view of Lim (Lim et al. Treatment of a Mouse Model of ALS by In Vivo Base Editing. Mol Ther. 2020 Apr 8;28(4):1177-1189. Epub 2020 Jan 14.), and further in view of Yuk-Ming (Yuk-Ming US 20060252071 A1), and NCBI (Yuk-Ming_NCBI Blast_407_SEQIDNO_60_2026 Oct 5. https://blast.ncbi.nlm.nih.gov/Blast.cgi).
Regarding claim 2, the applicant is reminded of the requirement or election of species and their election of species crRNA SEQ ID NO 60.
Ekman teaches claim 1 as described above.
However, Ekman does not teach, “wherein the crRNA sequence comprises one or more of SEQ ID NOs:60.” Furthermore, Ekman does not teach “a crRNA sequence having homology to a superoxide dismutase 1 (SOD1) gene ...”
However, Ekman does teach “a crRNA sequence having homology to … a huntingtin (HTT) gene” as shown above.
Lim is in the same field of endeavor, gene therapy via CRISPR and AAV technologies. However, unlike Ekman, in Lim’s embodiment, the disease target is the superoxide dismutase 1 (SOD1) gene, “we establish an intein-mediated trans-splicing system that enables in vivo delivery of cytidine base editors (CBEs) consisting of the widely used Cas9 protein from Streptococcus pyogenes. We show that intrathecal injection of dual AAV particles encoding a split-intein CBE engineered to trans-splice and introduce a nonsense-coding substitution into a mutant SOD1 gene…” (Abstract). Furthermore, Lim teaches their system in their Figure 3A vector cartoon diagram (shown below).
PNG
media_image3.png
174
266
media_image3.png
Greyscale
Notice in each of the two vectors, between the end ITRs, and adjacent to the 3’ ITRs, Lim teaches their use of their sgRNA targeting SOD1.
However, Lim similarly does not teach, “wherein the crRNA sequence comprises one or more of SEQ ID NOs:60.”
Yuk-Ming teaches their SEQ ID No 24. Yuk-Ming’s SEQ ID No 24 is 65 nucleotides and its bases 19- 48 shares 100% identity with SEQ ID No 60 of the instant application as shown below (NCBI. Yuk-Ming_NCBI Blast_407_SEQIDNO_60_2026 Oct 5. https://blast.ncbi.nlm.nih.gov/Blast.cgi).
SEQ ID No 60 1 TCGAGCAGAAGGAAAGTAATGGACCAGTGA 30
||||||||||||||||||||||||||||||
SEQ ID No 24 1 tgcagggcatcatcaatt TCGAGCAGAAGGAAAGTAATGGACCAGTGA aggtgtggggaa 65
Yuk-Ming describes their SEQ ID No 24 “oligonucleotide for detection of superoxide dismutase (SOD1).” Whereas Yuk-Ming does not use their SEQ ID No 24 for the purpose of a crRNA, the exact sequence of the instant SEQ ID No 60 is known it is further known the sequence aligns and targets SOD1.
It would have been obvious for a person having ordinary skill in the art (PHOSITA) at the time of filing to use the SEQ ID No 24 of Yuk-Ming as a crRNA in the AAV of Lim because this is simply choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success (“obvious to try”).
Lim and Yuk-Ming are both in the field of SOD1 gene therapy. Lim teaches an AAV with SOD1 crRNA sequence. A PHOSITA would have recognized the SOD1 SEQ ID No 24 would operate structurally and functionally similar to Lim’s SOD1 crRNA and therefore substituted Yuk-Ming’s SEQ ID No 24 and had a reasonable expectation of success.
Furthermore, it would have been obvious for a person having ordinary skill in the art (PHOSITA) at the time of filing to use SEQ ID No 24 of Yuk-Ming as a crRNA in the AAV of Ekman withing the AAV vector of Ekman because this is simply combining prior art elements according to known methods to yield predictable results. Yuk-Ming-Lim teaches an AAV with SOD1 targeting crRNA sequence. A PHOSITA would have recognized Yuk-Ming-Lim’s SOD1 targeting AAV with crRNA SEQ ID No 24 would operate structurally and functionally similar to Ekman’s HTT targeting AAV crRNA. Furthermore, a PHOSITA would have observed the success of Ekman’s HTT targeting crRNA-AAV vector, and recognized Yuk-Ming-Lims’s SEQ ID No 24 SOD1 crRNA and predicted Yuk-Ming-Lims’s SEQ ID No 24 crRNA in Ekman’s AAV vector would similarly work successfully.
Claim(s) 9 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ekman (Ekman et al. Mol Ther Nucleic Acids. 2019 Sep 6;17:829-839.), and Lim (Lim et al. Treatment of a Mouse Model of ALS by In Vivo Base Editing. Mol Ther. 2020 Apr 8;28(4):1177-1189. Epub 2020 Jan 14.), and Yuk-Ming (Yuk-Ming US 20060252071 A1), as applied to claim 8 above, and further in view of Zeballos (Zeballos et al. Next-Generation CRISPR Technologies and Their Applications in Gene and Cell Therapy. Trends Biotechnol. 2021 June 9;39(7):692-705.).
Ekman, Lim, and Yuk-Ming, teach claim 8 as described above.
However, Ekman, Lim, and Yuk-Ming do not teach, “wherein the crRNA further comprises a Cas13-specific direct repeat region.”
Zeballos is in the same field of endeavor as exemplified here, where Zeballos describes an AAV vector CRISPR gene manipulation system similar, “… because of their compact size, certain Cas13 effectors, such as the Cas13 protein from Ruminococcus flavefaciens (RfxCas13), can be packaged into a single AAV vector particle to enable continuous in vivo targeting.” (page 701, 2nd paragraph). Furthermore, Zeballos teaches their methods are compatible with SOD1 therapy in their Table 1, “Therapeutic outcomes” column, “Reduced the rate of muscle atrophy and muscle denervation, improved neuromuscular function, and slowed disease progression in the G93A-SOD1 mouse model of ALS.” Furthermore, in their Figure 3A, Zeballos depicts a cartoon of a Cas13-sgRNA RNP complex, where the sgRNA’s scaffold (Cas13-specific direct repeat region) is shown as a stem loop structure (highlighted below).
PNG
media_image4.png
213
217
media_image4.png
Greyscale
It would have been obvious for a person having ordinary skill in the art (PHOSITA) before the effective filing date of the claimed invention to have added Zeballos’s Cas13-specific direct repeat region to Ekman-Lim-Yuk-Ming’s SOD1 targeting AAV vector because it is simply combining prior art elements according to known methods to yield predictable result. A PHOSITA would recognize the Cas13-based SOD1 AAV vector of Ekman-Lim-Yuk-Ming. Likewise, a PHOSITA would recognize the Cas13-based AAV vector of Zeballos. In particular, a PHOSITA would recognize the Cas13 specific direct repeat region of Zeballos. Furthermore, a PHOSITA wanting their Cas13 to be activated in vivo, would necessarily incorporate a direct repeat region. Therefore, a PHOSITA would necessarily include Zeballos’s Cas13 specific direct repeat region in Ekman-Lim-Yuk-Ming’s SOD1 targeting AAV vector.
Claim(s) 10 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ekman (Ekman et al. Mol Ther Nucleic Acids. 2019 Sep 6;17:829-839.), and Lim (Lim et al. Treatment of a Mouse Model of ALS by In Vivo Base Editing. Mol Ther. 2020 Apr 8;28(4):1177-1189. Epub 2020 Jan 14.), and Yuk-Ming (Yuk-Ming US 20060252071 A1), and Zeballos (Zeballos et al. Next-Generation CRISPR Technologies and Their Applications in Gene and Cell Therapy. Trends Biotechnol. 2021 June 9;39(7):692-705.), as applied to claim 9 above, and further in view of Konermann (Konermann et al. Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR Effectors. Cell. 2018 Apr 19;173(3):665-676.e14.), and Clustal Omega (Clustal Omega _ Job Dispatcher _ EMBL-EBI_SEQIDNO131_2026 Oct 9.https://www.ebi.ac.uk/jdispatcher/msa/clustalo/summary?jobId=clustalo-I20261009-165739-0080-30262735-p1m).
Regarding claim 10, Ekman, Lim, Yuk-Ming, and Zeballos, teach claim 9 as described above.
However, Ekman, Lim, and Yuk-Ming do not teach, “where the Cas13-specific direct repeat region comprises the sequence set forth in SEQ ID NO:90.”
Konermann is in the same field of endeavor as exemplified here, where Konermann describes developing an AAV vector CRISPR gene manipulation system similar to Ekman-Lim-Yuk-Ming-Zeballos, “Biochemical characterization and protein engineering of seven distinct orthologs generated a ribonuclease effector derived from Ruminococcus flavefaciens XPD3002 (CasRx) with robust activity in human cells, CasRx can also be flexibly packaged into adeno-associated virus.” (Abstract). Konermann describes CasRx as a Cas13 nuclease, “… we designated this family of putative CRISPR ribonucleases as type VI Cas13d or type VI-D” (page 666, 2nd column, 3rd paragraph).
Konermann teaches the consensus direct repat sequence for RfxCas13, “5’-CAAGUAAACCCCUACCAACUGGUCGGGGUUUGAAAC-3’” (Figure S2c Konermann’s consensus Cas13d direct repeat sequence is 36 nucleotides and matches instant SEQ ID NO 90 74.3 %. The alignment of the two sequences is shown below (Clustal Omega).
SEQIDNO_90 1 gaaacaccg AACCCCTACCAACTGGTCGGGGTTTG ---- 35
--|--- ||||||||||||||||||||||||||
Konermann 1 ---caagua AACCCCTACCAACTGGTCGGGGTTTG aaac 36
Konermann’s bases 7- 32 match SEQ ID NO 90’s bases 10- 35 100% (u being equivalent to t). Konermann’s consensus Cas13d direct repeat sequence’s bases 33- 36 are aaac, the conserved 3’ sequence of Cas13d direct repeat sequence, “Cas13d direct repeats (DRs) are highly conserved in length and predicted secondary structure (Figure S2C), with a 36 nt length, an 8–10 nt stem with A/U-rich loop, and a 5’-AAAAC motif at the 3’ end of the direct repeat” (page 667, 1st column, 2nd paragraph). Konermann gives structural importance only to the stem loop and 3’ sequence by their above statement highlighting, “an 8–10 nt stem with A/U-rich loop, and a 5’-AAAAC motif at the 3’ end of the direct repeat.” SEQ ID NO 90 varies from SEQ ID NO 131 only in the first nine bases of SEQ ID NO 90. However, as noted above, Konermann is dismissive of the structural importance of these first nine bases, as noted by their silence on the matter. These bases, therefore, are not critical to the stem loop scaffold structure taught by Konermann above.
It would have been obvious for a person having ordinary skill in the art (PHOSITA) before the effective filing date of the claimed invention to have modified the 5’ end of Konermann’s RfxCas13 consensus sequence and substituted it for instant SEQ ID NO 90 of Ekman-Lim-Yuk-Ming-Zeballos’s SOD1 targeting AAV vector because it is simply choosing from a finite number of identified, predictable solutions, with a reasonable expectation of success (“obvious to try”). As noted above, Konermann taught the scaffold (direct repeat region) structural elements for a RfxCas13 (RxCas13) scaffold RNA. The instant SEQ ID NO 90 has those stem loop structural elements. Furthermore, regarding the first nine bases at the 5’ end of SEQ ID NO 90, those bases are not structurally critical (as noted above), and therefore, it would simply be a matter of routine optimization to come to the conclusion of the sequence that finally match instant SEQ ID NO 30; and a PHOSITA would necessarily optimize their direct repeat sequence. Furthermore, regarding the 3’ AAAC sequence taught by Konermann, while it is not cited as a sequence included as part of SEQ ID NO 90, it may be included into the Cas13-specific direct repeat region of the instant claim as written.
Claim(s) 11 and 12 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ekman (Ekman et al. Mol Ther Nucleic Acids. 2019 Sep 6;17:829-839.) and Gao (Gao US 20220186257 A1), as applied to claim 2 above, and further in view of Lim (Lim et al. Treatment of a Mouse Model of ALS by In Vivo Base Editing. Mol Ther. 2020 Apr 8;28(4):1177-1189. Epub 2020 Jan 14.), and Yuk-Ming (Yuk-Ming US 20060252071 A1), and Zeballos (Zeballos et al. Next-Generation CRISPR Technologies and Their Applications in Gene and Cell Therapy. Trends Biotechnol. 2021 June 9;39(7):692-705.), and Konermann (Konermann et al. Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR Effectors. Cell. 2018 Apr 19;173(3):665-676.e14.), and Clustal Omega (Clustal Omega _ Job Dispatcher _ EMBL-EBI_SEQIDNO131_2026 Oct 9. https://www.ebi.ac.uk/jdispatcher/msa/clustalo/summary?jobId=clustalo-I20261009-165739-0080-30262735-p1m), as applied to claim 10 above.
Regarding claim 11 and 12, Ekman-Gao teaches claim 1 and 2 as described above. Furthermore, Ekman, Lim, Yuk-Ming, Zeballos, Konermann, and Clustal Omega teach the AAV vector is a Ruminococcus flavefaciens CRISPR-Cas13d based AAV vector is targeted toward SOD1 as described above. Furthermore, Konermann teaches the embodiment deadCa13d (dCas13d), “… inactivating the positively charged catalytic residues of the HEPN motifs (dCas13d: R295A, H300A, R849A, H854A) did not affect array processing” (page 667, 1st column, 4th paragraph).
Claim(s) 18 is/are rejected under 35 U.S.C. 103 as being unpatentable over Ekman (Ekman et al. Mol Ther Nucleic Acids. 2019 Sep 6;17:829-839.), as applied to claim 1 above, and further in view of and Lim (Lim et al. Treatment of a Mouse Model of ALS by In Vivo Base Editing. Mol Ther. 2020 Apr 8;28(4):1177-1189. Epub 2020 Jan 14.), and Yuk-Ming (Yuk-Ming US 20060252071 A1), and Zeballos (Zeballos et al. Next-Generation CRISPR Technologies and Their Applications in Gene and Cell Therapy. Trends Biotechnol. 2021 June 9;39(7):692-705.), and Konermann (Konermann et al. Transcriptome Engineering with RNA-Targeting Type VI-D CRISPR Effectors. Cell. 2018 Apr 19;173(3):665-676.e14.), and Clustal Omega (Clustal Omega _ Job Dispatcher _ EMBL-EBI_SEQIDNO131_2026 Oct 9.https://www.ebi.ac.uk/jdispatcher/msa/clustalo/summary?jobId=clustalo-I20261009-165739-0080-30262735-p1m), as applied to claim 10 above, and further in view of Hsu (Hsu US 20190062724 A1), and NCBI (NCBI Blast_699_SEQIDNO_131_vs_Konermann_2026 Oct 9. https://blast.ncbi.nlm.nih.gov/Blast.cgi).
Regarding claim 18, Ekman teaches claim 1 as described above.
However, Ekman does not teach, “A pharmaceutical composition comprising: the rAAV vector of claim 1 and at least one pharmaceutically acceptable excipient and/or additive.“
Ekman does teach motivation for pursuing therapeutic intervention using their AAV methods, “There is no cure for HD, and current therapies only provide symptomatic relief. Thus, there is an urgent need for strategies that can reduce the formation of toxic HTT protein inclusions and treat the underlying cause of the disorder” (page 832, 2nd column, 3rd paragraph).
Hsu teaches a “pharmaceutically acceptable excipient and/or additive” by stating, “Also provided are compositions that include one or more of any Cas13d protein (or nucleic acid molecule encoding Cas13d), any gRNA, any RNP complex, any isolated nucleic acid molecule, any vector, or any cell, provided herein. Such compositions can include a pharmaceutically acceptable carrier” [0020].
Hsu is relevant because their SEQ ID NO 131 is 36 nucleotides and matches Konermann’s consensus Cas13d direct repeat sequence 100% (shown below) (NCBI Blast_699_SEQIDNO_131_vs_Konermann_2026 Oct 9. https://blast.ncbi.nlm.nih.gov/Blast.cgi).
SEQ ID NO 131 1 CAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC 36
||||||||||||||||||||||||||||||||||||
Konermann 1 CAAGTAAACCCCTACCAACTGGTCGGGGTTTGAAAC 36
Furthermore, Hsu used their SEQ ID NO 131 for the same purpose as Konermann and the instant application as taught by the following statement, ”… the one or more DR [direct repeat] sequences have at least 80%, … sequence identity to SEQ ID NO: 131… ” [0012]. Therefore, Hsu’s SEQ ID NO 131 is applicable/substitutable with Konermann’s Cas13d direct repeat sequence for all of the reasons stated above.
It would have been obvious for a person having ordinary skill in the art (PHOSITA) before the effective filing date of the claimed invention to have made Ekman’s AAV vector into the pharmaceutical composition of Hsu having at least one pharmaceutically acceptable excipient and/or additive because Hsu provided the motivation to develop “strategies that can reduce the formation of toxic HTT protein inclusions and treat the underlying cause of the disorder.” A PHOSITA would recognize Ekmann’s strategies would include Hsu’s pharmaceutical compositions. Therefore, a PHOSITA would have predicted the combination of Ekmann’s AAV vector with Hsu’s pharmaceutical carrier with at least one excipient or additive.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AARON DUREL WARD whose telephone number is (571)272-8495. The examiner can normally be reached Monday to Thursday 8:00AM 6:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 15712705919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AARON DUREL WARD/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
