Prosecution Insights
Last updated: August 15, 2026
Application No. 18/577,111

NEPHROTOXICITY REDUCING AGENT

Non-Final OA §102§103§112§DP
Filed
Jan 05, 2024
Priority
Jul 08, 2021 — JP 2021-113495 +1 more
Examiner
WARD, AARON DUREL
Art Unit
Tech Center
Assignee
National University Corporation Kobe University
OA Round
1 (Non-Final)
Grant Probability
Favorable
1-2
OA Rounds

Examiner Intelligence

Grants only 0% of cases
0%
Career Allowance Rate
0 granted / 0 resolved
-60.0% vs TC avg
Minimal +0% lift
Without
With
+0.0%
Interview Lift
resolved cases with interview
Typical timeline
Avg Prosecution
23 currently pending
Career history
10
Total Applications
across all art units

Statute-Specific Performance

§101
2.0%
-38.0% vs TC avg
§103
34.7%
-5.3% vs TC avg
§102
28.6%
-11.4% vs TC avg
§112
26.5%
-13.5% vs TC avg
Black line = Tech Center average estimate • Based on career data from 0 resolved cases

Office Action

§102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claim Status Summary Claims 1- 17 are pending. Claims 1- 17 are considered on the merits. Claims 1- 17 are rejected. No Claims are allowed. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 1-3, 6-14, and 17 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 recites, “A nephrotoxicity reducing agent for a pharmaceutical composition comprising an antisense oligomer, wherein the nephrotoxicity reducing agent comprises a sugar alcohol and is used in an amount such that a concentration of the sugar alcohol in the pharmaceutical composition is 1 mg/mL to 400 mg/mL.” The claim is indefinite because it is unclear whether the claim requires a pharmaceutical composition. The preamble of the claim identifies the pharmaceutical composition as intended use only, and therefore does not provide any structural limitation. Furthermore, the later limitation of “the pharmaceutical composition” merely uses it as a reference point for the amount of sugar alcohol concentration and similarly does not add any structural limitation. Therefore, the pharmaceutical composition must be explicitly claimed as part of the invention. The term “reduced” in claim 17 is a relative term which renders the claim indefinite. The term reduced” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The term “reduced” renders the clause “an antisense oligomer with … nephrotoxicity” indefinite. Those claims rejected but not specifically discussed are rejected for depending from a rejected claim but failing to remedy the indefiniteness therein. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claim 17 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Breadth of the Claims and Nature of the Invention Claim 17 recites, “A pharmaceutical composition comprising an antisense oligomer with reduced nephrotoxicity, wherein the pharmaceutical composition comprises a nephrotoxicity reducing agent comprising a sugar alcohol at a concentration of 1 mg/mL to 400 mg/mL.” In particular, the highlighted clause “an antisense oligomer with reduced nephrotoxicity” is not enabling. The clause is directed toward and encompasses any antisense oligomer (ASO) that has reduced nephrotoxicity. The invention is directed toward “nephrotoxicity reducing agent for a pharmaceutical composition comprising an antisense oligomer” [specification [0001]. In other words, a means to reduce the toxic effect of ASOs. The “nephrotoxicity reducing agent” is sugar alcohol, specifically “mannitol, sorbitol, glycerol, xylitol, arabitol, erythritol, galactitol, fucitol, iditol, inositol, volemitol, and lactitol” [0016]. The specification, in general, is not directed directly toward ASOs and even less so toward the improvement of toxicity of ASO’s themselves. State of the Prior Art and Level of PHOSITA and Predictability in the Art As recited in the instant specification’s background, “with respect to the antisense oligomers, it have been known that, for example, morpholino oligomers are accumulated in the kidney …, administration of morpholino oligomers causes nephrotoxicity” [0003]. Madden further explains the mechanism how ASO are known to aggregate and their aggregation leads to toxicity “oligonucleotides which tend to form multimeric aggregates have greater toxicity in the aggregate form than in monomeric form.” [Abstract]. Madden further demonstrated sugars disrupted oligomer aggregates “using chemical species such as mannitol or sucrose which disrupt aggregates” [Abstract]. Furthermore, Madden showed it was known that specific primary structures enhance aggregation and toxicity “” [non-limiting example of oligonucleotides which undergo multimerization are those which include a sequence of 4 G residues. Such oligonucleotides aggregate into a quadraplex.]. Furthermore, Dhuri (Dhuri et al. J Clin Med. 2020 Jun 26;9(6):2004.) showed in their review of ASOs that there a numerous structural modifications available to enhance ASO function “The amalgamation of chemical structure modifications of oligonucleotides and diverse delivery platforms provides an additional boost to the antisense field.” (page 2, 1st paragraph) However, Dhuri fails to mention any structural means of improving nephrotoxicity of ASO. Direction Provided by the Inventor and Working Examples and Experimentation Needed to Make/Use the Invention The applicant describes several ASOs in Example 1, in the presence and absence of D-mannitol. The applicant in the same example concludes “D-mannitol was confirmed to reduce nephrotoxicity.” In Example 3, the applicant further tested ASOs PMO 2 and 3 and still concluded “D-sorbitol was confirmed to reduce nephrotoxicity.” In all cases, the applicant failed to demonstrate any one ASO was more or less nephrotoxic than another. Therefore, based on the prior art of record and the applicant’s disclosure, it would require undue experimentation to make and use the instant invention as claimed. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claim(s) 1, 2, 3, 4, 5, 6, 7, 10, 11, 14, 15, 16, 17 is/are rejected under 35 U.S.C. 102(a)(1) and 102(a)(2) as being anticipated by Madden (Madden US 20030119768 A1), and Claim 14 as evidenced by Dhuri (Dhuri et al. J Clin Med. 2020 Jun 26;9(6):2004.). Regarding independent claims 1 and 15, Madden teaches “This application relates to an improved method [and composition] for use of oligonucleotide therapeutics which reduces the toxicity,” [0002]; specifically, nephrotoxicity, “The typical observation was the presence of basophilic granular material in the cytoplasm of epithelial cells of the proximal tubules of the kidney” [0055]; and “The oligonucleotide composition is administered in a pharmaceutically acceptable liquid carrier appropriate for administration” [0022]; and “administration of a therapeutic oligonucleotide” [Abstract]; and “INX-3280 antisense oligodeoxynucleotide is administered” [0020]; and “using chemical species such as mannitol or sucrose which disrupt [antisense oligonucleotide] aggregates” [Abstract]; and “Mannitol may be used at concentrations of from 50 to 500 mM.” 50mM to 500 mM Mannitol solution is equal to 9.11mg/mL to 91.09 mg/mL. Madden further teaches in their Example 5, “We therefore lyophilized INX-3280 from solutions containing … mannitol (300 mM) at an oligonucleotide concentration of 6.7mg/mL” [0084]. 300 mM mannitol is equal to 54.65 mg/mL and therefore anticipates the instant limitation because it falls within the claimed range 1 mg/mL to 400 mg/mL. Regarding claim 2, Madden’s 300 mM mannitol solution described above anticipates the instant claim. Regarding claim 3, Madden teaches in their Example 1 “the [INX-3280] solutions were diluted with sterile saline to the appropriate concentrations (approximately 0.5 and 2.5 mg/mL) for administration.” [0029]. 2.5 mg/mL therefore anticipates the instant limitation because it falls within the claimed range 0.5 mg/mL to 200 mg/mL. Regarding independent claims 4 and 16 and dependent claim 5, Madden’s, 300 mM mannitol solution described above has a ratio of sugar alcohol (mannitol) that is 8.16 per 1 (54.65 mg/mL per 6.7mg/mL) ASO which anticipates the claimed limitation because it falls within the claimed range of 0.05 to 30 per 1 and furthermore anticipates the claimed range of the sugar alcohol 0.1 to 13.3 per 1 of the antisense oligomer of instant claim 5. Regarding claim 6, Madden’s 300 mM mannitol solution described above anticipates the instant claim. Regarding claim 7, Madden’s further teaches “the invention preferably makes use of oligonucleotides which have been structurally modified to increase their resistance to nucleases…this includes… phosphorodithioate oligonucleotides, morpholino oligonucleotides and amidate-derivatives of oligonucleotides” [0022]. Regarding claim 10 and 11, Madden’s further teaches “a 15-mer [therapeutic ASO] directed against c-myc RNA, sometimes called INX-3280, is known and has the sequence: AAC GTT GAG GGG CAT Seq. ID. No. 1” [0017], [0018 ]. Regarding claim 14, Madden’s ASO INX-3280 (AAC GTT GAG GGG CAT Seq. ID. No. 1) matches only 6 non-contiguous bases of its 15 (40% total identity match) to instant SEQ ID No 11’s base positions 115937 to 115981. This level of complementarity is insufficient to target the claimed sequence as evidenced by Dhuri, “it has been well established that active ASOs are generally 15–20 nucleotides in length and can target complementary RNA by Watson–Crick base pairing” (page 5, 2nd paragraph). Regarding independent claim 17, Madden teaches “This application relates to an improved method [and composition] for use of oligonucleotide therapeutics which reduces the toxicity,” [0002]; specifically, nephrotoxicity, “The typical observation was the presence of basophilic granular material in the cytoplasm of epithelial cells of the proximal tubules of the kidney” [0055]; and “The oligonucleotide composition is administered in a pharmaceutically acceptable liquid carrier appropriate for administration” [0022]; and “administration of a therapeutic oligonucleotide” [Abstract]; “INX 2302 is a 20-mer sequence against ICAM-1 mRNA having the sequence: INX 2302: 5'-GCC CAA GCT GGC ATC CGT CA-3'” [0068], [0069]. INX 2302 lacks the more toxic structural motif of “a sequence of 4 G residues” [0017] and is therefore “an antisense oligomer with reduced Nephrotoxicity” compared to INX-3280 described above. Madden further teaches, “using chemical species such as mannitol or sucrose which disrupt [antisense oligonucleotide] aggregates” [Abstract]; and “Mannitol may be used at concentrations of from 50 to 500 mM.” 50mM to 500 mM Mannitol solution is equal to 9.11mg/mL to 91.09 mg/mL. Madden further teaches in their Example 5, “We therefore lyophilized INX-3280 from solutions containing … mannitol (300 mM) at an oligonucleotide concentration of 6.7mg/mL” [0084]. 300 mM mannitol is equal to 54.65 mg/mL and therefore anticipates the instant limitation because it falls within the claimed range 1 mg/mL to 400 mg/mL. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim(s) 8 is/are rejected under 35 U.S.C. 103 as being unpatentable over Madden (Madden US 20030119768 A1), and further in view of Ramu (Ramu WO 2020123645 A1). Regarding Claim 8, Madden teaches all of the elements of claim 1 as described above. Madden does not teach “wherein the antisense oligomer is a phosphorodiamidate morpholino oligomer.” However, Madden teaches “the invention preferably makes use of oligonucleotides which have been structurally modified to increase their resistance to nucleases…this includes… phosphorodithioate oligonucleotides, morpholino oligonucleotides and amidate-derivatives of oligonucleotides.” [0022]. Ramu teaches “an antisense sequence… and methods of using the vectors to treat subjects suffering from a muscular dystrophy such as DMD/ BMD.” [Abstract]; and “DM1 can also be treated… Using PMOs (phosphorodiamidate morpholino oligomer)…” [page 43, 2nd paragraph]. Ramu further teaches and “the invention contemplates compositions comprising… sugar alcohols such as mannitol or sorbitol” [page 58, last paragraph]. It would have been obvious for a person having ordinary skill in the art (PHOSITA) at the time of filing to have used Ramu’s phosphorodiamidate morpholino oligomer in combination with Madden’s reduced nephrotoxicity-ASO pharmaceutical composition because there was a teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention (“TSM”). As recited above, Madden gave the suggestion and motivation to use amidate-derivatives by stating they were “preferable” and they were more resistance to nucleases. Ramu demonstrated successful use of PMOs. Therefore, a PHOSITA would have had a reasonable expectation of success using Ramu’s PMO in Madden’s reduced nephrotoxicity-ASO pharmaceutical composition. Claim(s) 9 is/are rejected under 35 U.S.C. 103 as being unpatentable over Madden as applied to claim 1 above, and further in view of Sazani (Sazani et al. Int J Toxicol. 2011 May;30(3):322-33.). Regarding Claim 9, Madden teaches all of the elements of claim 1 as described above. Madden does not teach “wherein the 5′-end of the antisense oligomer is any group represented by the following chemical formulae (1) and (2).” However, Madden teaches “the invention preferably makes use of oligonucleotides which have been structurally modified to increase their resistance to nucleases…this includes… phosphorodithioate oligonucleotides, morpholino oligonucleotides and amidate-derivatives of oligonucleotides.” [0022]. Regarding claim 9, Sazani teaches the instant structure (1) in their Figure 1 (shown below): PNG media_image1.png 376 443 media_image1.png Greyscale “Figure 1. Chemical structure of phosphorodiamidate morpholino oligomer (PMO). The base sequence of AVI-4658 is CTC CAA CAT CAA GGA AGA TGG CAT TTC TAG” (Figure 1 legend). It would have been obvious for a person having ordinary skill in the art (PHOSITA) at the time of filing to have used Madden’s reduced nephrotoxicity-ASO pharmaceutical composition with the 5’-triethylene glycol cap taught by Sazani to arrive at the instant invention because it is simply combining prior art elements according to known methods to yield predictable results. ASOs and 5’-modified ASOs were known in the art described above. A PHOSITA in the field of morpholinos familiar with Madden would necessarily look to alternative teachings (for example Sazani) to optimize the performance of their morpholino. In particular, 5’-triethylene glycol’s inert property and added solubility would make it ideal for the instant pharmaceutical composition. Sazani successfully administered their 5’-triethylene glycol modified morpholino. Therefore, a PHOSITA would also have a reasonable expectation of success using the same modification on their Madden ASO. Claim(s) 12 is/are rejected under 35 U.S.C. 103 as being unpatentable over Madden as applied to claim 1 above, and further in view of Ramu (Ramu WO 2020123645 A1), and further in view of Blume (Blume US 20050244851 A1). Regarding claim 12, Madden teach all of the elements of claim 1. Ramu teaches “an antisense sequence… and methods of using the vectors to treat subjects suffering from a muscular dystrophy such as DMD/ BMD.” [Abstract]; “For example, Fukuyama congenital muscular dystrophy (FCMD)… additional coding sequences may encode an exon-skipping antisense oligonucleotide to restore correct exon 10 splicing in the defective FKTN gene” [page 27, 2nd paragraph]; and “at least one of the one or more coding sequences may be an exon skipping antisense sequence that induces skipping of an exon of a defective endogenous dystrophin” [page 24, last paragraph]; and “the composition is a pharmaceutical composition” [page 11, 4th paragraph]; and “DM1 can also be treated… Using PMOs (phosphorodiamidate morpholino oligomer)…” [page 43, 2nd paragraph]; and “the invention contemplates compositions comprising… sugar alcohols such as mannitol or sorbitol” [page 58, last paragraph]. Madden and Ramu do not teach the limitation “wherein the antisense oligomer comprises a base sequence selected from the group consisting of SEQ ID NOs: 1 to 10.” Blume (Blume US 20050244851 A1) teaches SEQ ID NO 4868715. SEQ ID NO 4868715 is a 25 nt oligomer. Instant SEQ ID NO 4 matches with 100% identity to bases 2-21 of Blume’s SEQ ID No 4868715 (shown below). SEQ ID NO 4 1 CCTTGGCTCGGCATCAGAGG 20 |||||||||||||||||||| SEQ ID NO 4868715 25 CCAGCCTTGGCTCGGCATCAGAGGG 1 Blume describes the field of their invention “The invention provides nucleic acid sequences which are complementary, in one embodiment, to a wide variety of human exons” [Abstract]; and “The human dystrophin gene… Alternative splicing is also known to occur in the 3' end of the gene” [0058]. Blume further teaches their sequence is an antisense oligonucleotide, “the array includes probes that have sequences corresponding to the sequences in the sequence listing, SEQ ID NOs 1-6,102,149. In one aspect, the majority of the probes on the array are complementary to known or predicted exons” [0067]. It would have been obvious for a person having ordinary skill in the art (PHOSITA) in the field of treating muscular dystrophy with ASOs at the time of filing to have used Madden’s reduced nephrotoxicity-ASO pharmaceutical composition and directed the composition toward muscular dystrophy as taught by Ramu. Furthermore, it would have been obvious for a PHOSITA to have further used the combined method of Madden and Ramu with Blume’s ASO SEQ ID NO 4868715 to arrive at the instant invention because it is a simply combining prior art elements according to known methods to yield predictable results. As described above, ASO pharmaceutical compositions with sugar alcohols directed toward muscular dystrophy were known. Furthermore, Ramu showed that it was known that ASOs directed toward muscular dystrophy functioned similarly, by inducing exon skipping. Therefore, a PHOSITA would have a reasonable expectation of success in substituting the ASO SEQ ID NO 4868715 as taught by Blume for the ASO taught by Ramu and using that ASO in the nephrotoxicity reducing ASO composition of Madden. Claim(s) 13 is/are rejected under 35 U.S.C. 103 as being unpatentable over Madden and Ramu as applied to claim 1 above, and further in view of Venn (Venn US 20220119890 A1, effectively filed Jan. 25, 2019), and in view of Lin (Lin et al. Chin J Cancer. 2014 May;33(5):256-8.). Regarding claim 13, Madden teach all of the elements of claim 1. Furthermore, Madden and Ramu together teach the nephrotoxicity reducing ASO composition directed toward muscular dystrophy as described immediately above. Madden and Ramu further teach the broad therapeutic utility (cancer therapy) of their ASOs. Madden teaches “the monomerized oligonucleotides of the invention now enable the therapeutic use of cisplatin, in combination with oligonucleotides of the invention, for the treatment of disorders, particularly cancers,” [0025] and Ramu teaches “Such non-coding RNA can be microRNA (miR), shRNA (short hairpin RNA), piRNA, snoRNA, snRNA, exRNA, scaRNA, long ncRNAs such as Xist and HOT AIR, anti-sense RNA, or precursor thereof, preferably with therapeutic value, e.g., those associated with diseases such as cancer… particularly various types of muscular dystrophies (MDs), including DMD/BMD” [page 7, 2nd paragraph]. Madden-Ramu does not teach “wherein the antisense oligomer targets a sequence ranging from positions 115937 to 115981 of a base sequence set forth as SEQ ID NO: 11.” Venn teaches “compositions comprising a plurality of different bait oligonucleotides, wherein the plurality of different bait oligonucleotides is configured to collectively hybridize to DNA molecules derived from at least 200 target genomic regions,” [0007]. Venn further teaches “present description provides a cancer assay panel for targeted detection of cancer-specific methylation patterns” [Abstract]. Venn further teaches the 36 nt sequence SEQ ID NO 141203. 34 of 45 Bases (115942 to 115979) of instant SEQ ID No 11 complementarily align 100% with first 34 bases of Venn’s SEQ ID NO 141203 (shown below). This is sufficient base complementarity to target instant SEQ ID NO 11. SEQ ID NO 11 115942 GTCTCCTTCCACGGTCTCCCTCTGATGCCGAGCC 115979 |||||||||||||||||||||||||||||||||| SEQ ID NO 141203 34 GTCTCCTTCCACGGTCTCCCTCTGATGCCGAGCC 1 Venn does not teach a relationship between muscular dystrophy and cancer. Lin teaches “myotonic MD is associated with an increased cancer risk. However, the cancer risk in other types of MD is unclear… genetic defects in hereditary MD may increase cancer risks in females and a sex difference should be further investigated.” (Abstract). It would have been obvious for a PHOSITA at the time of filing to substitute the ASO of Madden- Ramu for Venn’s antisense oligomer SEQ ID NO 141203 because Lin’s teaching, suggestion, and motivation would have led a PHOSITA to combine Madden-Ramu’s and Venn’s teachings to arrive at the claimed invention (“TSM”). Lin provided the motivation for combining prior art references by suggesting ties between MD and cancer “should be further investigated.” Therefore, a PHOSITA in the same field of endeavor would have looked toward teachings in the field of MD and cancer; leading them to both Madden-Ramu and Venn respectively. Madden-Ramu and Venn each showed their methods, compositions, and ASO’s were functional and successful and broadly useful. Therefore, a PHOSITA would also have a reasonable expectation of success using Venn’s ASO SEQ ID NO 141203 with Madden-Ramu’s composition. Non-Statutory Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1- 6, 7, 8, 9, 10, 11, 12, 15, 16, 17 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1- 6, 9, 10, 11, 12, 13, 14, 15, 16, 17 respectively of copending Application No. 18577133 in view of Madden (Madden US 20030119768 A1). For clarity, below is a table indicating the instant claims and the respective copending provisional NSDP claims. Instant application No. 18577111 1 2 3 4 5 6 7 8 9 10 11 12 15 16 17 Copending application No. 18577133 1 2 3 4 5 6 9 10 11 12 13 14 15 16 17 The instant application 18577111 and the copending application 18577133 are both assigned to Nippon Shinyaku Co., Ltd. Regarding claim 1, the instant application recites “A nephrotoxicity reducing agent for a pharmaceutical composition comprising an antisense oligomer, wherein the nephrotoxicity reducing agent comprises a sugar alcohol and is used in an amount such that a concentration of the sugar alcohol in the pharmaceutical composition is 1 mg/mL to 400 mg/mL.” Similarly claim 1 of copending application 18577133 recites “A nephrotoxicity reducing agent for a pharmaceutical composition comprising an antisense oligomer, wherein the nephrotoxicity reducing agent comprises a non-glucose sugar and is used in an amount such that a concentration of the sugar in the pharmaceutical composition is 1 mg/mL to 400 mg/mL.” Claim 1 of copending application 18577133 differs from the instant application only in the sugar limitation; sugar alcohol in the instant application versus non-glucose sugar in the copending application 18577133. The instant independent claims 15, 16, and 17 are identical to the respective copending application 18577133 claims except for the same difference in regards to sugar alcohol versus non-glucose sugar as described above. The limitations of instant Claims 3, 7, 8, 9, 10, 11, 12 are identical to the respective claims of the copending application 18577133 except for the inherited difference from claim 1 as stated above. Furthermore, the instant SEQ ID NOs 1- 10 (claim 12) match 100% to the copending application 18577133 SEQ ID NOs 1- 10 respectively. Similar to claims 1, 15, 16, and 17, the limitations of instant Claims 4, 5, 6, differ only from the respective copending application 18577133 claims in regards to a sugar alcohol versus a non-glucose sugar, but are otherwise identical. The limitations of instant Claim 2 differs in the range of sugar concentration: “1 mg/mL to 400 mg/mL” in the instant application versus “5 mg/mL to 340 mg/mL” in the copending application 18577133. The instant application does not claim “non-glucose sugar” moieties. However, Madden teaches “administration of a therapeutic oligonucleotide” [Abstract]; and “The oligonucleotide composition is administered in a pharmaceutically acceptable liquid carrier appropriate for administration” [0022]; and “This application relates to an improved method for use of oligonucleotide therapeutics which reduces the toxicity,” [0002]; and “oligonucleotides which tend to form multimeric aggregates have greater toxicity in the aggregate form than in monomeric form.” [Abstract]. Furthermore, Madden teaches their concern is for nephrotoxicity, “The typical observation was the presence of basophilic granular material in the cytoplasm of epithelial cells of the proximal tubules of the kidney” [0055]; and “slow metabolism … of oligonucleotides in the major organs of distribution (kidneys and liver)” [0065]. Madden further teaches their nephrotoxicity reducing agent is an alcohol sugar, “using chemical species such as mannitol or sucrose which disrupt aggregates” [Abstract]; and “Mannitol may be used at concentrations of from 50 to 500 mM.” [0015]. 50 to 500 mM Mannitol solution is equal to 9.11 mg/mL to 91.09 mg/mL. Madden further teaches in their Example 5, “We therefore lyophilized INX-3280 from solutions containing … mannitol (300 mM) at an oligonucleotide concentration of 6.7mg/mL” [0084]. 300 mM mannitol is equal to 54.65 mg/mL and therefore anticipates the instant limitation because it falls within the claimed range 1 mg/mL to 400 mg/mL. Furthermore, Madden teaches “Following the demonstration that 300 mM sucrose can fully protect [morpholino ASO] INX-3280 against quadruplex formation” [0086]. Finally, Madden claims “11. The method of claim 10, wherein the chemical additive is mannitol or sucrose.” It would have been obvious to a PHOSITA to have taken the pharmaceutical compositions of copending application 18577133 and substituted their non-glucose sugar for the claimed sugar alcohol of the instant application because it is a simple substitution of one known element for another to obtain predictable result. Madden showed sugar alcohols were as capable ASO anti-aggregates as non-glucose sugars. Therefore, a PHOSITA would have had a reasonable expectation of success substituting the non-glucose sugar claimed in copending application 18577133 for the instant sugar alcohol. Furthermore, the overlapping ranges of sugar alcohol/non-glucose sugar (“1 mg/mL to 400 mg/mL” in the instant application versus “5 mg/mL to 340 mg/mL” in the copending application 18577133) render claim 2 obvious. This is a provisional nonstatutory double patenting rejection. Claims 1- 6, 7, 8, 9, 10, 11, 12, 15, 16, 17 provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1- 6, 9, 10, 11, 12, 13, 14, 15, 16, 17 respectively of copending Application No. 18577142 in view of Madden (Madden US 20030119768 A1). For clarity, below is a table indicating the instant claims and the respective copending provisional NSDP claims. Instant application No. 18577111 1 2 3 4 5 6 7 8 9 10 11 12 15 16 17 Copending application No. 18577142 1 2 3 4 5 6 9 10 11 12 13 14 15 16 17 The instant application 18577111 and the copending application 18577142 are both assigned to Nippon Shinyaku Co., Ltd. Claim interpretation This examiner reminds the applicant that the claim language must be given its broadest reasonable interpretation in light of the specification. In this regard, the clause “A precipitation suppressing agent” from claim 1 of the copending application 18577142 reads on the instant claim language “a nephrotoxicity reducing agent.” Regarding claim 1, the instant application recites “A nephrotoxicity reducing agent for a pharmaceutical composition comprising an antisense oligomer, wherein the nephrotoxicity reducing agent comprises a sugar alcohol and is used in an amount such that a concentration of the sugar alcohol in the pharmaceutical composition is 1 mg/mL to 400 mg/mL.” Similarly claim 1 of copending application 18577142 recites “A precipitation suppressing agent for an antisense oligomer in urine of a subject to whom a pharmaceutical composition comprising an antisense oligomer has been administered, wherein the precipitation suppressing agent comprises a sugar other than glucose and is used in an amount such that a concentration of the sugar in the pharmaceutical composition is 0.5 mg/mL to 3000 mg/mL.” Claim 1 of copending application 18577142differs from the instant application 1) in the sugar limitation; “sugar alcohol” is claimed in the instant application versus “sugar other than glucose” in the copending application 18577142; and 2) the sugar concentration of the instant claim is 1 mg/mL to 400 mg/mL whereas the sugar concentration in th copending application 18577142 is 0.5 mg/mL to 3000 mg/mL. The instant application does not claim “a sugar other than glucose.” However, Madden teaches the instant claimed invention is obvious over the limitation “a sugar other than glucose” for all of the same reasons described above. Furthermore, the specific concentration of 300mM in addition to the overlapping ranges of sugar alcohol/sugar other than glucose (“1 mg/mL to 400 mg/mL” in the instant application versus “0.5 mg/mL to 3000 mg/mL” in the copending application 18577142) render claim 1 obvious. Similarly, the instant independent claims 15, 16, and 17 are identical to the respective copending application 18577142 claims except for the same difference in regards to sugar alcohol versus sugar other than glucose as described above and overlapping ranges of sugar concentration (instant claim 15 claims 1 mg/mL to 400 mg/mL versus copending application 18577142 claims 0.5 mg/mL to 3000 mg/mL), weight ratio of sugar to ASO (claim 16 claims 0.05 to 30 per 1 versus copending application 18577142 claims 0.1 to 100 per 1), and sugar concentration (claim 17 claims 1 mg/mL to 400 mg/mL versus copending application 18577142 claims 0.5 mg/mL to 3000 mg/mL) respectively. Therefore, the overlapping ranges render the claims obvious. The limitation of instant Claim 2, differs in the overlapping range of sugar concentration: “1 mg/mL to 400 mg/mL” in the instant application versus “ 2.6 mg/mL to 1694.1 mg/mL” in the copending application 18577142. Therefore, the overlapping range renders the claim obvious. The limitations of instant Claim 3 differs in the overlapping ranges of oligomer concentration (instant claim 3 claims 0.5 mg/mL to 200 mg/mL versus copending application 18577142 claims 0.05 mg/mL to 2000 mg/mL). Therefore, the overlapping ranges render the claim obvious. The limitations of instant Claim 4, 5 differs in the overlapping ranges of weight ratio of sugar to ASO (instant claim 4 claims 0.05 to 30 per 1; instant claim 5 claims 0.1 to 13.3 per 1 versus copending application 18577142 claim 4 claims 0.1 to 100 per 1; claim 5 claims 1 to 53 per 1). Therefore, the overlapping ranges render the claims obvious. The limitations of instant Claims 7, 8, 9, 10, 11, 12 are identical to the respective claims of the copending application 18577142 except for the inherited difference from claim 1 as stated above. Furthermore, the instant SEQ ID NOs 1- 10 (claim 12) match 100% to the copending application 18577142 SEQ ID NOs 1- 10 respectively. Similar to claims 1, 15, 16, and 17, the limitations of instant Claim 6, differ only from the respective copending application 18577142 claim in regards to a sugar alcohol claimed in the instant application versus a disaccharide sugar claimed in the copending application, but is otherwise identical. This is a provisional nonstatutory double patenting rejection. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to AARON DUREL WARD whose telephone number is (571)272-8495. The examiner can normally be reached Monday to Thursday 8:00AM 6:00PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 15712705919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AARON DUREL WARD/ Examiner, Art Unit 1636 /NEIL P HAMMELL/ Supervisory Patent Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Jan 05, 2024
Application Filed
Jul 23, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
Grant Probability
Low
PTA Risk
Based on 0 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month