Prosecution Insights
Last updated: July 17, 2026
Application No. 18/577,142

PRECIPITATION SUPPRESSING AGENT

Non-Final OA §102§103
Filed
Jan 05, 2024
Priority
Jul 08, 2021 — JP 2021-113562 +1 more
Examiner
RYAN, DOUGLAS CHARLES
Art Unit
Tech Center
Assignee
Nippon Shinyaku Co., Ltd.
OA Round
1 (Non-Final)
40%
Grant Probability
Moderate
1-2
OA Rounds
8m
Est. Remaining
89%
With Interview

Examiner Intelligence

Grants 40% of resolved cases
40%
Career Allowance Rate
28 granted / 70 resolved
-20.0% vs TC avg
Strong +49% interview lift
Without
With
+48.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 3m
Avg Prosecution
38 currently pending
Career history
121
Total Applications
across all art units

Statute-Specific Performance

§101
1.4%
-38.6% vs TC avg
§103
48.0%
+8.0% vs TC avg
§102
4.8%
-35.2% vs TC avg
§112
21.2%
-18.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 70 resolved cases

Office Action

§102 §103
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status This action is written in response to applicant’s correspondence received on 1/5/2024. Claims 1-17 are pending. All pending claims are currently under examination. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1-9, 12-13, and 15-17 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Madden (US 2003/0119768 A1). The rejection is further evidenced by Huberlant (J Huberlant. Encyclopaedia of Food Science,Food Technology and Nutrition, Copyright 1993, Academic Press) Regarding claims 1-2, Madden is a patent document that teaches and specifically focuses on the discovery that oligonucleotides form multimeric aggregates with greater toxicity, and furthermore that additions of sugars such as mannitol and sucrose can be added with the effect of reducing multimeric aggregates from forming (i.e., the sugars are added to suppress precipitation of the oligo, Abstract and throughout). Madden teaches that the oligonucleotide can be an antisense oligonucleotide (Example 1, where SEQ ID NO: 1 is an antisense oligomer as stated in the sequence listing found on page 10). Thus, Madden teaches a precipitation suppressing agent for an antisense oligomer comprising a sugar that is not glucose (sucrose, per Madden Example 1 and Abstract). Madden teaches that the concentration when using sucrose can be between 10nM-100nM for the effects of acting as an anti-aggregation agent (i.e., precipitation suppressing agent, paragraph 15). As evidenced by Huberlant, the molecular weight of sucrose is 342.3 (page 1, right column, third paragraph). Thus, as Madden teaches a 10nM-100nM concentration of sucrose, the concentration taught by Madden for the sucrose is 3.42 mg/mL – 34.2 mg/mL. Thus, Madden teaches that the sugar/sucrose is formulated at a concentration between 0.5 mg/mL – 3000 mg/mL. Regarding the claim limitations in the preamble, that the suppressing agent is in urine, the claim is drawn to the formulation. Madden teaches that same formulation, and therefore inherently teaches all of the claim limitations by teaching the same chemical solution recited in claim 1. Madden therefore anticipates claim 1. Regarding claim 3, Madden teaches that the antisense oligomer is diluted at a concentration of 0.5 – 2.5 mg/ml (e.g., paragraph 29). Regarding claims 4-5, Madden teaches that the antisense oligomer is diluted at a concentration of 0.5 – 2.5 mg/ml (e.g., paragraph 29). Given that Madden teaches that the sucrose is at a concentration between 3.42 – 34.2 mg/m (see claim 1 rejection, above) Madden teaches that the weight ratio of sugar to the antisense can be, for instance, (3.42 mg/ml sucrose) to 1 mg/ml of antisense, or a 3.42:1 ratio, which reads on the ratios in instant claims 4-5. Regarding claims 6-7, Madden teaches that the sugar is sucrose (e.g., Abstract, paragraph 15). As evidenced by Huberlant, sucrose is a disaccharide (page 1, right column, third paragraph). Regarding claim 8, Madden teaches that the sugar can be trialose (trehalose, paragraph 15). Regarding claim 9, Madden teaches that the antisense oligomer can be a morpholino oligomer (paragraph 22). Regarding claims 12-13, Madden teaches SEQ ID NO: 1 as the antisense oligo, where SEQ ID NO: 1 is reproduced below (see paragraph 28 and Example 1 of Madden): 5’-AACGTTGAGGGGCAT-3 As indicated above in bold and underlined, Madden’s SEQ ID NO: 1 oligo comprises four consecutive purines (e.g., four G nucleotides), at least two of which are Gs. Regarding claims 15-16, the broadest reasonable interpretation of these claims is that a sugar such as sucrose is added to an antisense oligo formulation, where the intended use and other limitations are inherent properties of the chemical formulation. As discussed above in the rejection of claim 1, Madden teaches chemical formulations comprising sucrose (i.e., a sugar that is not glucose) that is added to prevent aggregation (i.e., inhibit precipitation) at the recited concentrations of claims 15-16 (see rejection of claim 1). Regarding claim 16, administering the sugar would occur when the sugar that is formulated with the drug occurs. Furthermore, Madden teaches the administration of their compounds to subjects (for instance Example 2), and furthermore teaches that the prevention of aggregation by the addition of sugars reduces toxicity of oligos such as antisense oligos (Abstract). Thus, Madden anticipates claims 15-16, where furthermore a practitioner could immediately envision the methods given the teachings of Madden, where the methods recited in claims 15-16 are drawn to simply administering the compounds already taught by Madden for the administration to subjects (Abstract, Examples 1-2, and see rejection of claim 1 above). Regarding claim 17, as discussed above in the rejection of claim 1, Madden teaches pharmaceutical compositions comprising precipitation suppressing agents such as sugars other than glucose (i.e., sucrose per Madden), where Madden teaches the sucrose is administered or coupled with an oligo at the recited concentration (see rejection of claim 1, above). Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claim 10 is rejected under 35 U.S.C. 103 as being unpatentable over Madden (US 2003/0119768 A1) in view of Nan (Nan et al. Front Microbiol. 2018 Apr 20;9:750). Regarding the teachings of Madden, the teachings as they relate to claims 1-9 as discussed above in the 102 rejection are incorporated here. Madden teaches that the antisense oligomer can be a morpholino oligomer. Madden does not teach that the morpholino oligomer is a phosphorodiamidate morpholino oligomer (PMO). Nan is a research article specifically focused on phosphorodiamidate morpholino oligomers (Title, Abstract, and throughout). Nan teaches that “morpholino oligos, also known as phosphorodiamidate morpholino oligomers (PMO), have demonstrated promising effectiveness in developmental biology research involving gene knockdown as well as clinical trials focusing on treatments of genetic disorders,” (Introduction, first paragraph). Thus, Nan teaches that PMOs are known modifications that are useful and effective as therapeutics (Introduction). It would have been obvious to a person of ordinary skill in the art before the time of filing to change the morpholino oligomers of Madden for PMOs as taught by Nan because the practitioner would be motivated to use PMOs, a known modification that is further known to be useful for antisense oligos in therapeutic contexts. Claim 11 is rejected under 35 U.S.C. 103 as being unpatentable over Madden (US 2003/0119768 A1) in view of Andrews (Andrews BI et al. J Org Chem. 2021 January 1;86(1):49-61). Regarding the teachings of Madden, the teachings as they relate to claims 1-9 are discussed above in the 102 rejection and are incorporated here. Furthermore, Madden teaches that their strategy of using sugars to prevent aggregation of oligos is useful for newly synthesized oligos (paragraph 15). Thus, Madden teaches that the antisense oligos are synthesized (paragraph 15). Madden does not explicitly state that the oligos have an OH group at the 5’ end. Andrews is a research article that focuses on the synthesis of oligomers (Title, Abstract, and throughout). Andrews teaches that, during the synthesis of oligos, an OH group is left at the 5’ end after a final step of removing blocking groups from the chain as an embodiment of how synthetic oligos are produced (see Figure 3, and section 2.2, “Synthesis,” specifically page 50, right column, first two paragraphs). Thus, Andrews teaches that when oligos are manufactured synthetically they can have a 5’OH group at the end as a part of the synthesis process. It would have been obvious to a person of ordinary skill in the art before the effective filing date to combine the teachings of Madden with Andrews to arrive at antisense oligos with a 5’OH group because Andrews teaches that this is a known final step in the synthesis process of oligos such as antisense oligos taught by Madden. Thus, a practitioner would understand that the synthesis of such oligos as those of Madden can comprise 5’OH groups as a default step in oligo synthesis. Claim 14 is rejected under 35 U.S.C. 103 as being unpatentable over Madden (US 2003/0119768 A1) in view of Toda (JP2015091229, English Machine Translation and Original provided here). Regarding the teachings of Madden, the teachings as they relate to claims 1-9 are discussed above in the 102 rejection and are incorporated here. Madden teaches antisense oligos such as SEQ ID NO: 1 (e.g., paragraph 28). Madden does not teach instantly recited SEQ ID NO: 1. Toda is a patent publication that focuses on the use of antisense oligos to treat muscular dystrophy (title, abstract, and throughout). Toda and Madden therefore overlap in subject matter and field of endeavor because both teach the use of antisense oligos and their administration. Toda teaches SEQ ID NO: 6 as a preferred embodiment of an antisense oligo which is useful for treating muscular dystrophy, where Toda’s SEQ ID NO: 6 is aligned below with instant SEQ ID NO: 1 (see paragraphs 16-18 of Toda): GCTCGGCATCAGAGGGAGACCG (SEQ ID NO: 6, Toda) GCTCGGCATCAGAGGGAGACCG (instant SEQ ID NO: 1) As shown above, Toda’s SEQ ID NO: 6 is a 100% match of instant SEQ ID NO: 1. It would have been obvious to a person of ordinary skill in the art before the effective filing date of the invention to combine the teachings of Madden with Toda to arrive at the claimed invention, as such a combination is the simple substitution of one known prior art element for another with predictable success. In the present case, a practitioner would simply substitute the antisense oligo of Madden for SEQ ID NO: 6 of Toda. Furthermore, the combination is not simply the combination of art elements: a practitioner would be motivated to include the teachings of Toda with Madden because Toda teaches that their SEQ ID NO: 6 is a preferred embodiment that is useful for targeting and treating muscular dystrophy. Furthermore, the results are predictable because both Toda and Madden teach the same reagent and oligo types (i.e., antisense oligos). Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to DOUGLAS CHARLES RYAN whose telephone number is (571)272-8406. The examiner can normally be reached M-F 8AM - 5PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)-272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /D.C.R./Examiner, Art Unit 1635 /RAM R SHUKLA/Supervisory Patent Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Jan 05, 2024
Application Filed
Jun 18, 2026
Non-Final Rejection mailed — §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12630847
Novel CRISPR-Cas sigma enzyme and system
1y 4m to grant Granted May 19, 2026
Patent 12577576
SYSTEMS AND METHODS FOR PLANT GENOME EDITING USING CAS 12a ORTHOLOGS
5y 4m to grant Granted Mar 17, 2026
Patent 12480140
DIFFERENTIAL KNOCKOUT OF AN ALLELE OF A HETEROZYGOUS ELANE GENE
5y 0m to grant Granted Nov 25, 2025
Patent 12473539
RNA-GUIDED NUCLEASES AND ACTIVE FRAGMENTS AND VARIANTS THEREOF AND METHODS OF USE
1y 3m to grant Granted Nov 18, 2025
Patent 12448422
TRANSCRIPTION FACTOR NCGL0581 MUTANT AND USE THEREOF IN L-SERINE DETECTION
11m to grant Granted Oct 21, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
40%
Grant Probability
89%
With Interview (+48.9%)
3y 3m (~8m remaining)
Median Time to Grant
Low
PTA Risk
Based on 70 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month