DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
The Track One Request, filed Feb 28, 2024, was granted March 29, 2024. Therefore, this application is accorded special status.
Election/Restrictions
Applicant’s election without traverse of Group I (claims 1-26) drawn to a composition in the reply filed on July 12, 2024 was previously acknowledged.
Applicants subsequently canceled unelected claims 27-30 and added new claims 31-33. New claims 31-33 were grouped with elected Group I. With the cancellation of claims 27-30 in the response dated 07/12/2024, the restriction requirement was rendered moot.
Additionally, Applicant’s election without traverse of the following Species:
a lipid nanoparticle; and
solid phase synthesis
in the reply filed on July 12, 2024, was previously acknowledged.
Accordingly, claims 1-26 and 31-33 remain under examination.
Amendments
This action is in response to papers filed 3rd Feb 2026, in which claims 1, 6, and 31-33 were amended, no claims were canceled, and no new claims were added. All of the amendments have been thoroughly reviewed and entered.
Applicant has amended:
Abstract to overcome objections; the previous objections are withdrawn.
claims 1 and 6 to overcome the 112(a) rejections; the 112(a) rejections of all claims are withdrawn.
Applicant has amended claims 1 and 6 to overcome the 103 rejection; the 103 rejection over Scholefield and Liu are withdrawn. However, a new 103 rejection, addressing amendments has been presented in this Office Action.
NSDP: In view of amendments, i) a new provisional double patenting rejection over 18690134 in view of Anzalone has been made; ii) previous rejection over 18690120 has been withdrawn.
Applicant’s arguments, see Pgs. 13-19, filed 3rd Feb 2026, with respect to:
rejections of claims under 35 USC § 103 have been fully considered but are not persuasive for the reasons discussed in this office action. A 35 USC § 103 rejection in view of amendments is presented in this Final Office Action.
Arguments applicable to amended claims are addressed below. Arguments that are no longer relevant are not addressed.
Rejections not reiterated here are withdrawn.
Status of Claims
Claims 1-26 and 31-33 are currently under consideration.
New Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-14, 16-20, 25, and 31 are rejected under 35 U.S.C. 103 as being unpatentable over Anzalone (Anzalone, A.V., Randolph, P.B., Davis, J.R. et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149–157, 2019) and evidenced by Worgall (Worgall and Crystal, Chapter Thirty-Four - Gene Therapy, 2007, Pages 471-492, ISBN 9780123706157) (claim 17).
Regarding claims 1 and 2, Anzalone teaches a gene-editing technology called Prime Editing which is a versatile and precise genome editing method that directly writes new genetic information into a specified DNA site using a catalytically impaired Cas9 endonuclease fused to an engineered reverse transcriptase, programmed with a prime editing guide RNA (pegRNA) that both specifies the target site and encodes the desired edit. The pegRNA has the following components as seen from Examiner’s annotations of Anzalone ’s Fig.1. As seen in the figure, the primer binding site (PBS) is complementary to the guide.
PNG
media_image1.png
200
400
media_image1.png
Greyscale
[AltContent: textbox (d) Primer-binding site)][AltContent: textbox (a) gRNA spacer)][AltContent: textbox (b) gRNA scaffold)][AltContent: textbox (c) Heterologous Sequence (HOS))]Anzalone teach on pg. 150, the PE strategy is: Cas9 targets DNA using a guide RNA containing a spacer sequence that hybridizes to the target DNA site. The guide RNA specifies the DNA target and contains new genetic information that replaces target DNA nucleotides. With respect to correcting the pathogenic E6V-coding mutation in HBB, Anzalone correct to either wild-type HBB, or to HBB containing a PAM disrupting silent mutation, (Fig. 5 | Prime editing of pathogenic mutations, prime editing in primary mouse cortical neurons, and correction (via A•T-to-T•A transversion) in HEK293T cells).
Anzalone teaches RNA prime editing guide RNA ("PEgRNA", Extended Data Fig. 3a and legend) comprising, from 5' to 3': a spacer, gRNA core (aka sgRNA scaffold or gRNA backbone) (which binds to the dCas9+RT), and an extension arm). The extension arm comprises in the 5' to 3' direction a primer binding site and a RT template. Anzalone ’s pegRNA reads on instant template RNA comprising the following components: (a) a gRNA spacer (Anzalone : spacer), (b) a gRNA scaffold that binds SpCas9 (Anzalone : scaffold which binds to the dCas9+RT), (c) a heterologous object sequence (Anzalone : RT template), and (d) a primer binding site (PBS) sequence.
With respect to the SEQ ID Nos. recited in the claims, the pegRNA for E6V correction is HBB 3.5 (Extended Data Fig. 9 sequences):
PNG
media_image3.png
200
400
media_image3.png
Greyscale
Reproduced below, these comprise:
(a) HBB gene targeted pegRNA spacer sequence, which is 100% identical to instant SEQ ID NO: 20,027. See sequence in first row, second column of Extended Data Fig. 9, also below:
GTAACGGCAGACTTCTCCAC
And alignment with instant:
Query Match 100.0%; Score 20; DB 1; Length 20;
Best Local Similarity 100.0%;
Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTAACGGCAGACTTCTCCAC 20
||||||||||||||||||||
Db 1 GTAACGGCAGACTTCTCCAC 20
(c) extension arm (reads on instant heterologous object sequence and PBS), the first 25 of 26 nucleotides of which are 100% identical to instant HOS, SEQ ID NO: 20,291, wherein nucleotide 13 of SEQ ID NO: 20291 is A, and PBS, SEQ ID NO: 20157. See sequence in first row, third column of Extended Data Fig. 9, also below:
ACCTGACTCCTGAGGAGAAGTCTGCC
And alignment with instant:
Query Match 100.0%; Score 14; DB 1; Length 26;
Best Local Similarity 100.0%;
Matches 14; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ACCTGACTCCTGAG 14
||||||||||||||
Db 1 ACCTGACTCCTGAG 14
Query Match 100.0%; Score 11; DB 1; Length 26;
Best Local Similarity 100.0%;
Matches 11; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAGAAGTCTGC 11
|||||||||||
Db 15 GAGAAGTCTGC 25
The remaining limitations (SEQ ID Nos.) have not been considered because they have been recited as optional (or).
Regarding claim 3, Anzalone teaches the pegRNA that reads on template of claim 1, wherein the gRNA spacer has a length of 20 nucleotides (HBB 3.5, Extended Data Fig. 9 sequences).
Regarding claim 4, Anzalone teaches the pegRNA that reads on template of claim 1, wherein the heterologous object sequence (HOS) has a length of 14 nucleotides (HBB 3.5, Extended Data Fig. 9 sequences).
Claim interpretation for claim 5: The “post-edit homology region, a mutation region, and a pre-edit homology region” of the heterologous object sequence of claim 5 is being interpreted as per Pg. 22, para 80-82 and Pg. 36, lines 16-18, to mean the template RNA comprises a mutation region of 1, 2, or 3 nucleotides of sequence differences relative to the corresponding portion of the human HBB gene, wherein this region is flanked by regions of 100% identity to the target (the HBB gene).
Regarding claim 5, Anzalone teaches the pegRNA that reads on template of claim 1, wherein the heterologous object sequence comprises, from 5' to 3', a post-edit homology region, a mutation region, and a pre-edit homology region (Fig. 1b and c).
Regarding claim 6, Anzalone teaches the pegRNA that reads on template of claim 1, wherein the heterologous object sequence (HOS) has an RNA sequence of:
(i) SEQ ID NO: 20291 (ACCUGACUCCUGAG) as discussed for claim 1.
The remaining limitations (SEQ ID Nos.) have not been considered because they have been recited as optional (or).
Regarding claim 7, Anzalone teaches the pegRNA that reads on template of claim 1, wherein the PBS sequence has a length of 11 nucleotides as discussed in the rejection of claim 1.
Regarding claim 9, Anzalone teaches the pegRNA that reads on template of claim 1, wherein the gRNA scaffold comprises an RNA sequence having at least 90% identity to SEQ ID NO: 20,117 (pU6-HEK3_pegRNA_CTTins, pg. 25 and (sgRNA scaffold 2, Supplementary Table 3 on pg. 8).
SCAFFOLD2
Query Match 95.8%; Score 72.8; DB 1; Length 76;
Best Local Similarity 97.4%;
Matches 74; Conservative 0; Mismatches 2; Indels 0; Gaps 0;
Qy 1 GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT 60
Qy 61 GGCACCGAGTCGGTGC 76
|| ||||||||||| |
Db 61 GGGACCGAGTCGGTCC 76
Regarding claim 10, Anzalone teach the teaches the pegRNA that reads on template of claim 1, wherein the gRNA scaffold comprises an RNA sequence according to SEQ ID NO: 20,117 (sgRNA scaffold 1, Supplementary Table 3 on pg. 8).
SGRNASCAFFOLD1
Query Match 100.0%; Score 76; DB 1; Length 76;
Best Local Similarity 100.0%;
Matches 76; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 GTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTCCGTTATCAACTTGAAAAAGT 60
Qy 61 GGCACCGAGTCGGTGC 76
||||||||||||||||
Db 61 GGCACCGAGTCGGTGC 76
Regarding claim 11, Anzalone teach the pegRNA that reads on template of claim 1, wherein the RNA sequence of the template RNA has at least 90% identity to SEQ ID NO: 21,903. As discussed in the rejection of claim 1 above, the combination of elements ((a) spacer, (b) scaffold, and (c) a heterologous object sequence comprising a mutation, and (d) a primer binding site (PBS) sequence) comprising the HOS and PBS put together by the ordinary skilled artisan would result in a template RNA has at least 90% identity to SEQ ID NO: 21,963.
ALLTOGETHER
Query Match 100.0%; Score 121; DB 1; Length 122;
Best Local Similarity 100.0%;
Matches 121; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GTAACGGCAGACTTCTCCACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 GTAACGGCAGACTTCTCCACGTTTTAGAGCTAGAAATAGCAAGTTAAAATAAGGCTAGTC 60
Qy 61 CGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCACCTGACTCCTGAGGAGAAGTCTG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 CGTTATCAACTTGAAAAAGTGGCACCGAGTCGGTGCACCTGACTCCTGAGGAGAAGTCTG 120
Qy 121 C 121
|
Db 121 C 121
The remaining limitations (SEQ ID Nos.) have not been considered because they have been recited as optional (or).
Regarding claim 13, Anzalone teach the teaches the pegRNA that reads on template of claim 1, wherein the mutation region comprises a first region designed to correct a pathogenic mutation in the HBB gene and a second region designed to introduce a silent substitution (Introduction of a PAM-modifying silent mutation improved editing efficiency and product purity to 58% correction with 1.4% indels (Fig. 5a), pg. 155).
Regarding claim 16, Anzalone teach a gene modifying system comprising: teaches a pegRNA that reads on template of claim 1, as discussed in the rejection of claim 1, and a gene modifying polypeptide (Cas9 endonuclease fused to an engineered reverse transcriptase, abstract).
Regarding claim 17, Anzalone teach the gene modifying system of claim 16, which comprises the nucleic acid encoding the gene modifying polypeptide, wherein the nucleic acid comprises RNA (pLenti-hSyn-C-PE2-NpuC sequence comprising N-terminal NLS + Cas9 H840A, Supplementary Sequences on pg. 25-26). Anzalone does not explicitly teach the suitable vectors comprise RNA. However, Worgall makes this explicit by discussing retrovirus and lentivirus vectors are both RNA-based vectors (first line of section on Retrovirus, Pg. 479).
Regarding claim 18, Anzalone teach the gene modifying system of claim 16, wherein the gene modifying polypeptide comprises: a reverse transcriptase (RT) domain; a Cas domain; and
a linker disposed between the RT domain and the Cas domain (pCMV-PE2: N-terminal NLS + Cas9 H840A, Flexible linker, M-MLV reverse transcriptase + C-terminal NLS, Plasmid backbone, Supplementary Sequences on pg. 24).
Regarding claim 19, Anzalone teach the gene modifying system of claim 18, wherein the Cas domain is a SpCas9 domain (Supplementary Note 3).
Regarding claim 20, Anzalone teach the gene modifying system of claim 18, wherein the RT domain is an RT domain from a murine leukemia virus (MMLV) (Supplementary Sequences on pg. 30).
Regarding claim 25, Anzalone taught that the system of claim 16 is used in a method for modifying a target site in the human HBB gene in a cell, the method comprising contacting the cell with the gene modifying system of claim 16, thereby modifying the target site in the human HBB gene in a cell (We used prime editing in human cells to correct, efficiently and with few byproducts, the primary genetic causes of sickle cell disease (requiring a transversion in HBB), abstract; HEK293T tissue culture transfection protocol and genomic DNA Preparation, pg. 158; FIG. 5 shows a screen of PEgRNAs for correction of the HBB E6V allele in HEK293T cells).
Regarding claim 31, Anzalone teach the teaches the pegRNA that reads on template of claim 1, wherein the heterologous object sequence (HOS) has the RNA sequence of ACCUGACUCCUGAG as shown in the alignment with Anzalone ’s HBB sequence with instant SEQ ID NO: 20291, and discussed in the rejection of claims 1 and 6.
Anzalone does not teach a PBS consisting of 11 nucleotides as recited in claim 1, or the PBS sequence consists of an RNA sequence of GAGAAGUCUGC as recited claim 8, or results in a template RNA according to SEQ ID NO: 21,963; i.e., exactly as recited in SEQ ID NO: 21,963 as recited claim 12.
However, Anzalone had taught that the length of the primer can be variable (primer ~8-15 nt, Extended Data Fig. 3 a). Examples of primers of various lengths ranging from 9 to 15 nucleotides are provided in the supplementary data (Extended Data Fig. 9 sequences). Results show that for PE2, HEK3 +1 T to A transversions, primer lengths of 11 and 13 nucleotides are the same (Extended Data Fig. 4 o).
It would have been prima facie obvious to an artisan of ordinary skill in the art before the effective filing date of the claimed invention to have varied the length of the primer because Anzalone teach that this is permissible. Once reduced by one nucleotide, one would obtain a primer that is 11 nucleotides, and gain the cost-savings advantage of synthesizing one less nucleotide. Having obtained a shorter primer, one would combine the various elements taught by Anzalone into a single RNA sequence to make a template RNA for the advantage of having a single template that functions in correcting a genomic loci as taught by Anzalone by the mechanism of prime editing. The combination of elements (a) spacer, (b) scaffold, and the (c) HOS and (d) PBS put together by the ordinary skilled artisan would result in a contiguous template RNA comprising the elements (a) – (d) as recited. One would be motivated to look into the invention of Anzalone for the modular components because Anzalone provide the teachings and results obtained and one would have reasonable expectation of success in putting the various components together because Anzalone say that the design of a template RNA is meant to be modular. All of the claimed elements were disclosed by Anzalone and one skilled in the art could have combined these prior art elements by known methods, with no change in their respective functions, and the combination would have yielded predictable results i.e. the template RNA of the instant invention. See MPEP 2143 I.(A) and (G).
Thus, Anzalone makes obvious instant claims 1-14, 16-20, 25, and 31.
Claims 21-23 and 26 are rejected under 35 U.S.C. 103 as being unpatentable over Anzalone (Anzalone, A.V., Randolph, P.B., Davis, J.R. et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149–157, 2019) as applied to claims 1-14, 16-20, 25, and 31 above in view of Liu (WO 2020191233)
Regarding claims 21-23 and 26, the template RNA of claim 1 is discussed above.
Anzalone do not teach the limitations of these claims.
However, before the effective filing date of instant invention, Liu had taught a gene modifying system comprising similar components as taught by Anzalone which were discussed in the rejection of claim 1 and 16.
Regarding claim 21, Liu taught that the system of claim 16 further comprises a second strand- targeting gRNA spacer that directs a second nick to the second strand of the human HBB gene (The system may also include other functionalities added… (c) a nCas9:gRNA complex to create a second site nick on the opposite strand, paragraph [0412]).
Regarding claim 22, Liu taught that the system of claim 16 is in a pharmaceutical composition (paragraph [1091].
Regarding claim 23, Liu taught the pharmaceutical composition of claim 22, wherein the pharmaceutically acceptable excipient is a lipid nanoparticle (paragraph [0887]).
Regarding claim 26, Liu taught that the system of claim 16 is a method for treating a subject having a disease or condition associated with a mutation in the human HBB gene, the method comprising administering to the subject the gene modifying system of claim 16, thereby treating the subject having a disease or condition associated with a mutation in the human HBB gene (paragraph [0836] In some embodiments, a rAAV constructs or the herein compositions are administered to a subject; paragraph [0909] These methods could be applied to all genetic diseases for which genome editors are considered for use in treatment).
It would have been prima facie obvious to an artisan of ordinary skill in the art before the effective filing date of the claimed invention to have combined the various elements taught by Anzalone and Liu into a single RNA sequence to make a template RNA and introduce all these components into a pharmaceutical composition for the advantage of administering the same to human subjects. All of the claimed elements were disclosed by Liu and Anzalone and one skilled in the art could have combined these prior art elements by known methods, with no change in their respective functions, and the combination would have yielded predictable results i.e. administering the template RNA of the instant invention to a subject in order to treat the subject having a disease or condition associated with a mutation in the human HBB gene. See MPEP 2143 I.(A) and 2144 II.
Thus, Anzalone in view of Liu make obvious instant claims 21-23 and 26.
Claim 15 is rejected under 35 U.S.C. 103 as being unpatentable over Anzalone (Anzalone and Harrison, Gene Therapy (2021), 28:396–401) as applied to claims 1-14, 16-20, 25, and 31 above and further in view of Ma (Ma, S.et al., The journal of gene medicine, 23(11), e3377. 2021).
Regarding claim 15, Anzalone teach a pegRNA that reads on template of claim 1, which comprises the RNA sequence set out in SEQ ID NO: 20,950. As discussed in the rejection of claim 1, 11, and 12 above, the combination of elements (a) spacer, (b) scaffold, (c) a heterologous object sequence comprising a mutation, and (d) a primer binding site (PBS) sequence comprising the HOS and PBS taught by Anzalone put together by the ordinary skilled artisan would result in a template RNA according to SEQ ID NO: 21,963, which has the same nucleobase sequence as SEQ ID NO: 20,942.
Anzalone do not teach wherein the RNA sequence of the template RNA has the chemical modifications set out in SEQ ID NO: 20,942.
However, before the effective filing date of the claimed invention Ma teach that modification of nucleotides of template RNA sequences are possible and confer several advantages to the RNA (Section on 3.5 Chemical modification: 2′-O-methyl modification can improve target site binding capacity by increasing Tm, hybridization kinetics and sgRNA stability; a phosphorothioate bond can be introduced at the end of sgRNA to improve nuclease stability, Pg. 7). Ma further teach template RNAs are more conducive to chemical synthesis and chemical modification because of their short lengths (gRNA, first two lines, left column, Pg. 5) and engineering gRNA to optimize its composition and structure can enhance the versatility of CRISPR system applications (gRNA, first two lines, right column, Pg. 5).
It would have been prima facie obvious to an artisan of ordinary skill in the art before the effective filing date of the claimed invention to have combined the teachings of Anzalone and Ma and chemically modified the RNA sequence of the template RNA with 2′-O-methyl and phosphorothioate bonds. All of the claimed elements of the sequence were taught by Liu and chemical modifications taught by Ma, to enable one skilled in the art to have combined these prior art elements by known methods and the combination would have yielded predictable results, i.e., enhanced functionality of the template RNA as taught by Ma. See MPEP 2143 I.(A) and (G).
Thus, Anzalone in view of Ma make obvious instant claim 15.
Claim 24 is rejected under 35 U.S.C. 103 as being unpatentable over Anzalone (Anzalone and Harrison, Gene Therapy (2021), 28:396–401) as applied to claims 1-14, 16-20, 25, and 31 above and further in view of GAUDELLI (WO 2021050571).
Regarding claim 24, Anzalone teach the pegRNA that reads on template of claim 1.
Anzalone do not teach a method of making the template RNA of claim 1 by solid-phase synthesis.
However, before the effective filing date of the claimed invention GAUDELLI teach programmable nucleobase editors that can edit a pathogenic mutation associated with a genetic disease (abstract). The editor is a fusion protein bound to a guide RNA which is complementary to the target to be edited (lines 10-12, Pg. 16). GAUDELLI teach the guide polynucleotides can be synthesized chemically, synthesized enzymatically, or a combination thereof. For example, the guide RNA can be synthesized using standard phosphoramidite-based solid-phase synthesis methods. Alternatively, the guide RNA can be synthesized in vitro by operably linking DNA encoding the guide RNA to a promoter control sequence that is recognized by a phage RNA polymerase. (lines 24-25, Pg. 158).
It would have been prima facie obvious to an artisan of ordinary skill in the art before the effective filing date of the claimed invention to have combined the teachings of Anzalone and GAUDELLI and chemically synthesize the template using standard phosphoramidite-based solid-phase synthesis methods, as GAUDELLI have done in the synthesis of their RNA for use in a similar gene editing system. Further GAUDELLI teach that such a synthesis method is a standard synthesis method. Thus, one of ordinary skill in the art would have been able to practice it. All of the claimed elements of the sequence were taught by Anzalone and chemical synthesis method taught by GAUDELLI, to enable one skilled in the art to have combined these prior art elements by known methods and the combination would have yielded predictable results, i.e., a solid-phase synthesized template RNA. See MPEP 2143 I.(A) and (G).
Thus, Anzalone in view of Gaudelli make obvious instant claim 24.
Claims 32 and 33 are rejected under 35 U.S.C. 103 as being unpatentable over Anzalone (Anzalone and Harrison, Gene Therapy (2021), 28:396–401) as applied to claims 1-14, 16-20, 25, and 31 above and further in view of Alberts (Alberts B, Johnson A, Lewis J, et al., New York: Garland Science; 2002.) and evidenced by Expasy (Expasy protein translate tool, retrieved from the expasy webpage on the internet <https://web.expasy.org/translate/> 2 pages, [retrieved on 28 March 2026]).
Claims 32 and 33 recite HOS that only differ from the HOS recited in claim 31 by 1 or 2 nucleotides. All HOS recite the sequence containing the corrected mutation.
The teachings of Anzalone have been discussed above and apply. Specifically, Liu teach the teaches the sequence of the pegRNA that reads on template of claim 1, wherein the heterologous object sequence (HOS) has an RNA sequence of SEQ ID NO: 20291 as shown in the alignment with Anzalone’s PEG and discussed in the rejection of claims 1, 6, and 31. The HOS discussed has the sequence: ACCTGACTCCTGAG. Anzalone further teach all HOS are contiguous with a primer (PBS), as is also seen in instant application. Consistent in all HOS taught are the GAG trinucleotide juxtaposed between the HOS and PBS (Extended Data Fig. 9 sequences). Anzalone shows in Fig. 1 the PBS binds to the DNA template that must be edited. Therefore, the primer must be complementary to the template. There is no such requirement (of complementarity with DNA to be edited) for the HOS. In fact, the HOS acts as a template for template-dependent extension of the primer. This further implies the newly synthesized strand will be dictated by the well-known rules of complementary base pairing with the template.
The HOS taught by Anzalone and discussed above when viewed from the triplet codon point of view is: AC CTG ACT CCT GAG. Translated, these would result in amino acids: LTPE, as evidenced by https://web.expasy.org/translate/.
Anzalone do not teach HOS has an RNA sequence of nucleotides 97 to 110 of SEQ ID NO: 21903 (claim 32) or nucleotides 97 to 110 of SEQ ID NO: 20567 (claim 33).
However, before the effective filing date of instant application, Alberts had taught the triplet codons that code for various amino acids. See Fig. 6-50 below:
PNG
media_image4.png
689
1247
media_image4.png
Greyscale
It would have been prima facie obvious to one of ordinary skill in the art before the effective filing date of the instant invention to insert all possible codons for LTPE for the advantage of having novel nucleic acid sequences yet maintaining the correct codon needed for glutamic amino acid as taught by Alberts, and further substitute this sequence for HOS sequence taught by Anzalone, and arrive at a sequence that is 100% identical to instant positions 97 to 110 of SEQ ID NO: 21903 (claim 32) or nucleotides 97 to 110 of SEQ ID NO: 20567 (claim 33). More importantly, such a created sequence has been shown above to result in 100% of the same polypeptide (LTPE). If carrying out two codon changes to include the protective amino acid substitutions leads to anticipated success, it is likely the product not of innovation but of ordinary skill and common sense to provide routine optimization. Thus, there is no patentable distinction between the taught HOS sequence of Anzalone and instant HOS sequences. See MPEP 2143(I) A and MPEP 2144.05 (II). One of ordinary skill in the art would have a reasonable expectation of success since Anzalone utilizes basic tools of molecular biology and Alberts is a standard textbook in the field. In conclusion, while the art does not teach a sequence that is identical to recited sequences, the sequence of the corrected translated product was known including mutations/changes, therefore reaching an optimal polynucleotide sequence for its synthesis was within the capacity of one of ordinary skill in the art.
Thus, Anzalone in view of Alberts and evidenced by Expasy make obvious instant claims 32 and 33.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Response to Arguments:
Applicant's arguments (Remarks) filed 17-06-2025 to claim rejections under 35 USC § 103 have been fully considered but they are not persuasive for the reasons discussed below.
On Pg. 13 of the Remarks, the response summarizes the 103 rejection made and alleges that a prima facie case of obviousness has not been made.
On Pg. 8 of the Remarks, the response elaborates on the § 103 rejection because a prima facie case for obviousness has not been made:
1. With respect to Claims 1-14, 16-23, 25, 26, and 31:
i. On pg. 14 - 15: no objective reason to utilize the teachings of the references to arrive at the claimed invention.
Applicant’s arguments with respect to claim(s) the reference of Liu have been considered but are moot because the new ground of rejection for these claims does not rely on the Scholefield and Liu reference applied in previous office action. Instead, this Office action utilizes the review article of Anzalone as the primary reference which establishes that the design of a pegRNA was well-known in the art at the time of filing. Anzalone further discusses the modular nature of the pegRNA. Thus, Anzalone provides an objective reason to look for the pieces; i.e., HOS sequence, spacer sequence etc., to place in the known design of a pegRNA to make a template such as instant.
ii. On pg. 16: lack of motivation to utilize the teachings of the references to arrive at the claimed invention.
Instant rejection utilizes reference of Anzalone, which present sequences that are clearly defined along with its 5’ to 3’ orientation.
iii. On pg. 17: no reasonable expectation of success to utilize the teachings of the references to arrive at the claimed invention because of variability in editing efficiencies seen with different sequences; and allege significant optimization.
This is not found persuasive because instant rejection relies on the availability of the genetic code, reading and practicing this code is well within the scope of routine optimization performed by one of ordinary skill in the biological arts. See MPEP 2144.05 II.
However, a new rejection over these claims in view of amendments has been presented in this office action.
2. With respect to claim 15:
On pg. 9: On Pg. 12 of the Remarks, the response asserts that the reference of Ma does not remedy the deficiency of Liu in the rejection of claim 15 because Ma fails to recite the specific modification pattern of claim 15.
This is not found persuasive. While Ma does not teach or suggest a template RNA of the exact sequence or specific modification pattern as instant, Ma does provide guidance on designing/modifying the different elements of a gRNA (entire section 3) that is sufficient for one of skill in the art to modify the templates taught by Anzalone and further by routine optimization result in templates with high activity.
However, a new rejection over these claims in view of amendments has been presented in this office action.
3. With respect to claim 24:
On pg. 12 of the Remarks, the response asserts that the reference of Gaudelli does not remedy the deficiency of Liu in the rejection of claim 24 because Gaudelli relates to "nucleobase editors comprising adenosine deaminase domains," and does not teach or suggest a gene modifying system or a template RNA as in instant claim 1.
This is not found persuasive. Gaudelli does relate to gene modifying system (Cas, pg. 6, 3rd paragraph) and teaches gRNAs (pg. 16, 3rd paragraph). While Gaudelli does not teach or suggest a template RNA of the exact sequence as instant, Gaudelli does suggest chemically synthesizing or enzymatically synthesizing, or a combination thereof of synthesizing gRNAs. See pg. 13 of NFOA where Examiner has cited Gaudelli (lines 24-25, Pg. 158). This suggestion is sufficient for one of skill in the art to make the templates taught by Anzalone as the methods of chemically synthesizing or enzymatically synthesizing, or a combination thereof of are known in the art.
However, a new rejection over these claims in view of amendments has been presented in this office action.
4. With respect to claims 32 and 33:
On pg. 13, Applicants argue that there is no teaching or suggestion that would guide a person to randomly select a 14-nucleotide portion of Genbank 1 or Genbank 2 and use it as a heterologous object sequence as currently claimed in instant claim 1 without extensive experimentation.
This argument is persuasive. However, a new rejection in view of amendments has been presented in this office action.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-26 and 31-33 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 22-23, 35, and 43-46 of copending Application No. 18690134 in view of Anzalone (Anzalone, A.V., Randolph, P.B., Davis, J.R. et al. Search-and-replace genome editing without double-strand breaks or donor DNA. Nature 576, 149–157, 2019).
Although the claims at issue are not identical, they are not patentably distinct from each other because: claims of the aforementioned patent application are also drawn to template RNA comprising a template RNA comprising from 5' to 3':
a) a gRNA spacer that is complementary to a first portion of the gene,
b) a gRNA scaffold that binds a Cas domain;
c) a heterologous object sequence
and
d) a primer binding site (PBS) sequence; and further a method of use of the template with a polypeptide to modify a gene.
The following is a table of claims of the present application that recite all or some limitation of claims from ‘134 application.
Present Application claim number
‘134 patent claim number
1,16,18
22, 45
25
43
26
44 – 46
The reverse transcriptase (RT) domain of the instant application is a polymerase as recited in the disclosure of ‘134 patent; E6V mutation that is corrected in the instant application is one of the diseases (SCD) listed in Table 12 of the ‘134 patent, and referred to in claim 45 of the reference application.
The reference application does not recite sequences of the template RNA comprising the elements (a) spacer, (b) scaffold, (c) a heterologous object sequence comprising a mutation, and (d) a primer binding site (PBS) sequence.
However, before the effective filing date of instant invention, Anzalone had taught a PegRNA comprising the above elements. The teachings of Anzalone discussed in the 103 rejection of claims 1-14, 16-20, 25, and 31 above apply.
It would have been obvious to one of ordinary skill in the art to have included a PegRNA sequence taught by Anzalone that recognizes and edits the SCD-causing mutation (E6V), in order to treat SCD. Doing so would lead one to arrive at instant application.
Any additional limitations of the ‘134 claims are encompassed by the open claim language “comprising” found in the instant claims. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Response to Applicant’s Remarks:
It is noted the response requests that double patenting rejections be held in abeyance until the rejections outstanding in the instant application are overcome. i) A new provisional double patenting rejection over 18690134 in view of Anzalone has been made and presented above; ii) previous provisional double patenting rejection over 18690120 has been withdrawn as the amendments sufficiently overcome the previous provisional double patenting rejection.
Conclusion
No claims are allowed.
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Correspondence
Any inquiry concerning this communication or earlier communications from the examiner should be directed to SHABANA MEYERING, Ph.D. whose telephone number is (703)756-4603. The examiner can normally be reached M - F: 9am to 5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached on (571) 272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/SHABANA S MEYERING/Examiner, Art Unit 1635
/SHABANA S MEYERING/Examiner, Art Unit 1635
/CATHERINE KONOPKA/ Primary Examiner, Art Unit 1635