This Office Action Replaces the previous Non-Final Rejection mailed on August 11, 2026 1
DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 03/05/2025 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Art Unit Designation
The art unit designation for correspondence to this Office Action has changed to 1681.
This application has been transferred from Examiner JOSEPH R SPANGLER to Examiner Tian Yu. All future correspondence should be directed to Examiner Tian Yu whose contact information appears at the end of this Office Action.
Nucleotide and/or Amino Acid Sequence Disclosures
Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures
37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted:
1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying:
a. the name of the XML file
b. the date of creation; and
c. the size of the XML file in bytes; or
2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying:
a. the name of the XML file;
b. the date of creation; and
c. the size of the XML file in bytes.
SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS:
Specific deficiency - Sequences appearing in the drawings are not identified by sequence identifiers in accordance with 37 CFR 1.831(c). Sequence identifiers for sequences (i.e., “SEQ ID NO:X” or the like) must appear either in the drawings or in the Brief Description of the Drawings.
Specifically, FIGS. 5-7 contains nucleotide sequences with 10 or more specifically defined and enumerated residues, that are not identified with sequence identifiers, either in the drawing or in the Brief Description of the Drawings, where the correlation between multiple sequences in the drawing and their sequence identifiers in the Brief Description is clear.
Required response – Applicant must provide:
Amended drawings in accordance with 37 CFR 1.121(d) inserting the required sequence identifiers;
AND/OR
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required sequence identifiers (i.e., “SEQ ID NO:X” or the like) into the Brief Description of the Drawings, consisting of:
• A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
• A copy of the amended specification without markings (clean version); and
• A statement that the substitute specification contains no new matter.
Status of Claims
This office action is in response to Applicant's Response to Election / Restriction filed on May 12, 2026. No claims amendment are made in the response filed on May 12, 2026.
Claims 1-10, 31, 33-34, 37, 47, 58-59, 87, 98, 101, 107, 112, 120 are currently pending, with claim 5-7, 9-10, 58 and 120 withdrawn.
Claims 1-4, 8, 31, 33-34, 37, 47, 59, 87, 98, 101, 107 and 112 are under examination. This is the first action on the merits.
Election/Restrictions
Applicant’s election without traverse of Group I (claims 1-10, 31, 33-34, 37, 47, 59, 87, 98, 101, 107, 112 and 120) in the reply filed on May 12, 2026 is acknowledged 2.
Applicant’s election without traverse of the following species in the reply filed on May 12, 2026 is acknowledged 3:
Species of O-tRNA: SEQ ID NO: 2;
Species of one or more nucleic acid bases at the specified positions: an adenine at
nucleic acid position 53 and a uracil at nucleic acid position 63.
Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claims 5-7, 9-10, 58 and 120 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention.
Examination on the merits commences on claims 1-4, 8, 31, 33-34, 37, 47, 59, 87, 98, 101, 107 and 112.
Claim Objections
Claims 3 and 4 are objected to because of the following informality:
Claim 3 recites an O-tRNA comprising “a uracil at nucleic acid position 63.” Claim 4 depends from claim 3 and further defines the O-tRNA as comprising “a nucleic acid sequence consisting of the sequence set forth in SEQ ID NO: 2,” which comprises thymine bases, not uracil bases. Revising claim 3 to recite thymine at position 63 instead of uracil is suggested for consistency with claim 4.
Priority
The priority date of the instant claims 1-4, 8, 31, 33-34, 37, 47, 59, 87, 98, 101, 107 and 112 is 09/17/2021, filling date of the US provisional application NO. 63/245,789.
Claim Interpretation
In evaluating the patentability of the claims presented in this application, claim terms have been given their broadest reasonable interpretation (BRI) consistent with the specification, as understood by one of ordinary skill in the art, as outlined in MPEP§ 2111.
Claim 1 recites a nucleic acid sequence “at least 85% identical to the sequence set forth in SEQ ID NO: 1.” Neither the claim nor the specification defines “% identical” or how it is determined.
Accordingly, under BRI, “% identical” or percent identity between two sequences may be determined by any method known in the art. For instance, identity(A,B)=100% (number of identical nucleotides / min(length(A),length(B))). See NovoPro (What is the difference between homology, similarity and identity?; 2018-03-01; www .novoprolabs.com/support/articles/what-is-the-difference-between-homology-similarity-and-identity-201803011302.html)
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claim 34 is rejected under 35 U.S.C. 112(b), as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 34 recites " … structure according to Formula I," which is indefinite because Formula I is only disclosed in the specification (para. [0086]) and not in the claim.
MPEP 2173.05(s) states:
“Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table "is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience." Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993).”
Therefore, according to MPEP, claims should be self-contained and clearly define the invention without relying on external references. This approach ensures clarity and avoids potential ambiguity in interpreting the scope of the claims.
In this instant case, claim 34 is indefinite because it refers to a chemical formula according to a specific figure in the specification, without specifying the formula in the claim itself. The referenced formula can be readily incorporated into the claim, therefore reference to the specification is improper.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 8, 31, 33-34, 37, 47, 59, 98 and 101 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Mureev (US20180171321A1- Platform for a non-natural amino acid incorporation into proteins; Published on 2018-06-21), as evidenced by Guo (Guo et al. Evolution of amber suppressor tRNAs for efficient bacterial production of proteins containing nonnatural amino acids. Angew Chem Int Ed Engl. 2009;48(48):9148-51. doi: 10.1002/anie.200904035. PMID: 19856359; PMCID: PMC2887739).
Regarding claim 1, Mureev teaches an orthogonal tRNA (O-tRNA) comprising a nucleic acid sequence at least 85% identical to the sequence set forth in SEQ ID NO: 1 and comprising a deletion of the cytosine located at nucleic acid position 16 of the O-tRNA (Fig. 28, SEQ ID NO: 69, sequence identity 88.15%);
wherein the nucleic acid positions correspond to the sequence set forth in SEQ ID NO: 1; and
wherein the O-tRNA is capable of being aminoacylated with at least one non-standard amino acid (nsAA) by an orthogonal aminoacyl tRNA synthetase (O-RS) (Fig. 28, MjYtRNA species; [0260] TyrRS from M. jannaschii that mediate incorporation of a range of benzyl side-chain analogs; [0243)
Sequence 1 length:77 – SEQ ID NO.1, this application
Sequence 2 length:76 - US20180171321A1, SEQ ID NO 69
Matches 67
Mismatches: 5
Gaps: 9
Sequence identity = 100% (# of identical nucleotides / min(length(1),length(2)))= 67/76= 88.15%
1 -CCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGCGCCGGTTCAA 59 (SEQ ID NO 1)
|| ||..|||||||| |||||||||||||||||||||||||||||||||.|.|||||||
1 CCC-GCCTTAGTTCAG-AGGGCAGAACGGCGGACTCTAAATCCGCATGGCACGGGTTCAA 58 (US20180171321A1, SEQ ID NO 69)
60 AT-CCG--GCCCGCCGGACCA 77
|| ||| | ||.||||||
59 ATCCCGTAG---GCGGGACCA 76
Mureev teaches the MjY1 (SEQ ID NO 69) O-tRNA ([0243]) was identified in Guo and corresponds to the tRNAs pAzPhe1 in Guo ([0243]; [0048] MjY1, corresponding to the tRNA pAzPhe1 in Guo, cited as ref#37).
Guo teaches the orthogonal translation system utilizing O-tRNA such as MjY1 is a well-known engineered M. jannaschii amber suppressor tyrosyl-tRNA/tRNA-synthetase (MjtRNATyrCUA /MjYRS) pair, capable of aminoacylate O-tRNA with at least one non-standard amino acid (nsAA) by an orthogonal aminoacyl tRNA synthetase (O-RS). The aminoacylation of O-tRNA by its corresponding O-RS is based on the natural translation mechanism, where each tRNA must be selectively charged by its cognate aminoacyl-tRNA synthetase (aaRS). (page 1-2).
Guo teaches the MjY1 O-tRNA (disclosed as pAzPhe1) is capable of being aminoacylated with at least one non-standard amino acid (nsAA) by an orthogonal aminoacyl tRNA synthetase (O-RS) (see Table 1, pAzPhe1 is a MjtRNATyrCUA variant O-tRNA, aminoacylated with p-azidophenylalanine by an aaRS for p-azidophenylalanine).
Regarding claim 8, Mureev teaches O-tRNA comprises the sequence CAG-AGGGCAG at nucleic acid positions 13 to 23, wherein the nucleic acid positions correspond to the sequence set forth in SEQ ID NO: 1 (Seq ID NO: 69, see alignment above) .
Regarding claim 31, Mureev teaches O-tRNA comprises the sequence of SEQ ID NO: 5 (Seq ID No: 69 in Mureev is identical to SEQ ID NO: 5).
Sequence 1 length:76 – SEQ ID NO.5, this application
Sequence 2 length:76 - US20180171321A1, SEQ ID NO 69
Matches 76
Mismatches: 0
Gaps: 0
1 CCCGCCTTAGTTCAGAGGGCAGAACGGCGGACTCTAAATCCGCATGGCACGGGTTCAAAT 60 (SEQ ID NO 5)
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
1 CCCGCCTTAGTTCAGAGGGCAGAACGGCGGACTCTAAATCCGCATGGCACGGGTTCAAAT 60 (US20180171321A1, SEQ ID NO 69)
61 CCCGTAGGCGGGACCA 76
||||||||||||||||
61 CCCGTAGGCGGGACCA 76
Regarding claim 33, Mureev teaches O-tRNA is aminoacylated with the nsAA ([0261] O-tRNAs incorporation of AzF (an unnatural amino acid according to the instant specification [0028]) is evaluated. Thus a skilled artisan would readily understand that the disclosed O-tRNAs have been aminoacylated with nsAA).
Regarding claim 34, Mureev teaches O-tRNA is aminoacylated with the nsAA AzF ([0261]), which is a non-standard amino acid having the structure of Formula I (see instant specification, [0086]), featuring an azide group, which is not found in natural amino acids (see instant specification, [0091] “non-standard amino acid is 4-azidophenylalanine (AzF).”)
Regarding claim 37, Mureev teaches the nsAA AzF ([0261]), which is 4-azidophenylalanine comprising a phenylalanine analog (see instant specification, [0091] “non-standard amino acid is 4-azidophenylalanine (AzF).”)
Regarding claim 47, Mureev teaches the nsAA AzF ([0261]).
Regarding claim 59, Mureev teaches orthogonal translation system (OTS) comprising the O-tRNA of claim 1 and an O-RS ([0260]-[0261] MjTyrRS-AzFRS OTS comprising MjY1 and AzFRS) .
Regarding claim 98, Mureev teaches a polypeptide comprising at least one nsAA is produced by the OTS ([0048] describing Comparative analysis of amber codon suppression efficiencies in E. coli cell-free translation system via expression of eGFP, which can only be fully expressed and emit fluorescence if the amber codon is translated as incorporation of nsAA; see also [0155]; [0248]; [0259]-[0261]).
Regarding claim 101, Mureev teaches O-tRNA comprises the sequence of SEQ ID NO: 5 (Seq ID No: 69 in Mureev is identical to SEQ ID NO: 5).
Claims 1, 8, 31, 33-34, 37, 47, 59, 87, 98, 101, 107 and 112 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Guo (Guo et al. Evolution of amber suppressor tRNAs for efficient bacterial production of proteins containing nonnatural amino acids. Angew Chem Int Ed Engl. 2009;48(48):9148-51. doi: 10.1002/anie.200904035. PMID: 19856359; PMCID: PMC2887739), as evidenced by Mureev (US20180171321A1- Platform for a non-natural amino acid incorporation into proteins; Published on 2018-06-21).
As discussed above, Guo and Mureev teach the same O-tRNA sequence (referred to as MjY1 (SEQ ID NO 69) in Mureev; pAzPhe1 in Guo), with Mureev citing Guo. The difference is that Mureev focuses on cell-free systems, whereas Guo teaches an in vivo orthogonal translation system for O-tRNA screening.
Regarding claim 1, Guo teaches pAzPhe1 O-tRNA, pAzPhe1 comprises a nucleic acid sequence at least 85% identical to the sequence set forth in SEQ ID NO: 1 and comprising a deletion of the cytosine located at nucleic acid position 16 of the O-tRNA, as evidenced by Mureev.
Mureev teaches the full sequence of pAzPhe1 (SEQ ID NO: 69) (Fig. 28 MjY1_tRNA; [0243]; [0048] MjY1, corresponding to the tRNA pAzPhe1 in Guo, cited as ref#37).
Sequence 1 length:77 – SEQ ID NO.1, this application
Sequence 2 length:76 - US20180171321A1, SEQ ID NO 69
Matches 67
Mismatches: 5
Gaps: 9
Sequence identity = 100% (# of identical nucleotides / min(length(1),length(2)))= 67/76= 88.15%
1 -CCGGCGGTAGTTCAGCAGGGCAGAACGGCGGACTCTAAATCCGCATGGCGCCGGTTCAA 59 (SEQ ID NO 1)
|| ||..|||||||| |||||||||||||||||||||||||||||||||.|.|||||||
1 CCC-GCCTTAGTTCAG-AGGGCAGAACGGCGGACTCTAAATCCGCATGGCACGGGTTCAA 58 (US20180171321A1, SEQ ID NO 69)
60 AT-CCG--GCCCGCCGGACCA 77
|| ||| | ||.||||||
59 ATCCCGTAG---GCGGGACCA 76
Regarding claim 8, Guo as evidenced by Mureev teaches O-tRNA comprises the sequence CAG-AGGGCAG at nucleic acid positions 13 to 23, wherein the nucleic acid positions correspond to the sequence set forth in SEQ ID NO: 1 (Seq ID NO: 69, see alignment above)
Regarding claim 31, Guo as evidenced by Mureev teaches O-tRNA comprises the sequence of SEQ ID NO: 5 (Seq ID No: 69 in Mureev is identical to SEQ ID NO: 5).
Regarding claim 33, Guo teaches O-tRNA is aminoacylated with the nsAA (Table 1).
Regarding claim 34, Guo teaches the nsAA has the structure according to Formula I; wherein the R group is any substituent other than a corresponding substituent used in the twenty natural amino acids (Scheme 1, p-azidophenylalanine (3)).
Regarding claim 37, Guo teaches the nsAA comprises a phenylalanine analog (Scheme 1, p-azidophenylalanine (3)).
Regarding claim 47, Guo teaches 4-azido-phenylalanine (AzF) ((Scheme 1, p-azidophenylalanine (3), p-azidophenylalanine and AzF are synonyms, see commonchemistry.cas.org/detail?cas_rn=33173-53-4)
Regarding claim 101, Guo as evidenced by Mureev teaches O-tRNA comprises the sequence of SEQ ID NO: 5 (Seq ID No: 69 in Mureev is identical to SEQ ID NO: 5).
Regarding claim 59, Guo teaches an orthogonal translation system (OTS) comprising the O-tRNA of claim 1 and an O-RS (Table 1).
Regarding claim 87, Guo teaches a cell comprising the OTS comprising the O-tRNA of claim 1, and an O-RS (supplementary information, page 7, tRNA region expressed into vector pLeiG‐PS, in which an amber GFPuv variant (GFP N149TAG) is expressed under control of the T5 promoter/Lac operator. These constructs were co‐transformed with pBK‐derived vectors (Fig. S4A) expressing each appropriate aaRS; page 8, E. coli DH10B cells were used in all library transformation steps.) Guo teaches expressing the O-tRNA in cells to screen for tRNA hits, with highest activity, including pAzPhe1 (Table 1, Figure 2).
Regarding claim 98, Guo teaches a polypeptide comprising at least one nsAA, wherein the polypeptide is produced by the OTS of claim 59 (supplementary information, page 7; Figure S7, an amber GFPuv variant (GFP N149TAG) is expressed for fluorescence screening of O-tRNA).
Regarding claim 107, Guo teaches a vector comprising O-tRNA nucleic acid sequence consisting of a sequence set forth in SEQ ID NO:5, as evidenced by Mureev. Guo teaches using a vector comprising O-tRNA sequence to express the O-tRNA in cells to screen for tRNA hits, with highest activity, including pAzPhe1 (supplementary information, page 7, tRNA region expressed into vector pLeiG‐PS ; Table 1, Figure 2).
Mureev teaches the full sequence of pAzPhe1 (SEQ ID NO: 69) (Fig. 28 MjY1_tRNA; [0243]; [0048] MjY1, corresponding to the tRNAs pAzPhe1 in Guo, cited as ref#37), which is identical to SEQ ID NO: 5.
Regarding claim 112, as discussed for claim 87, Guo teaches a cell comprising the OTS of claim 59, wherein the tRNA is expressed in the cell, wherein the O-tRNA is capable of being aminoacylated with the at least one non-standard amino acid (nsAA) by an O-RS (see Table 1, pAzPhe1 is a MjtRNATyrCUA variant O-tRNA, aminoacylated with p-azidophenylalanine by an aaRS for p-azidophenylalanine).
Subject Matter Not Taught/Suggested in Prior Art
Claims 2-4 are objected to as being dependent upon a rejected base claim 1, but would be allowable if rewritten in independent form to overcome the objection set forth in this office action, and to include all of the limitations of the base claim and any intervening claims.
The following subject matter is not taught or suggested in the prior art:
Regarding claim 2, no prior art teach or suggest an orthogonal tRNA (O-tRNA) comprising a nucleic acid sequence at least 90% identical to the sequence set forth in SEQ ID NO: 1 and comprising a deletion of the cytosine located at nucleic acid position 16 of the O-tRNA.
SEQ ID NO: 69 in Mureev comprises the claimed deletion and has 88.15% identity to SEQ ID NO: 1, SEQ ID NO: 71 in Mureev similarly comprises the claimed deletion and has 88 % identity to SEQ ID NO: 1. However, the prior art provides no reason for a skilled artisan to modify the sequences in Mureev to achieve higher precent identity to SEQ ID NO: 1, which appear to be a specific J17 M. jannaschii tRNATyrCUA mutant (see [0259]; SEQ ID NO: 1 in
Paulsel 4, which is identical to SEQ ID NO: 1 in this application).
Regarding claims 3-4, no prior art teach or suggest the specific base modifications required by claim 3.
Conclusion
Claims 2-4 are objected to; claims 1,8,31,33-34,37,47,59,87,98,101,107 and 112 are rejected. No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to TIAN NMN YU whose telephone number is (703)756-4694. The examiner can normally be reached Monday - Friday 8:30 am - 5:30 pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/TIAN NMN YU/Examiner , Art Unit 1681
1 The present office action additionally raises the following rejection(s):
Claim 34 is rejected under 35 U.S.C. 112(b)
2 Claim 58 is withdrawn as being drawn to non-elected group II
3 Claims 5-7, 9-10 and 120 are withdrawn as being drawn to non-elected species.
4 Paulsel (US20090123971A1 - Compositions of aminoacyl-tRNA synthetase and uses thereof)
Prosecution Insights