Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Claim status
Claims 58-74 are pending
Claims 58-74 are under examination
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 4/19/2024 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
However, Applicant is reminded that the listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
New Claim Rejections - 35 USC § 112(a)
NEW MATTER
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claim 73 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
The new limitation directed to the AAV vector of claim 73, “wherein a Type II-C Cas9 nuclease protein is bound to the Nme sgRNA” in instant claim appears to represent new matter. MPEP 2163.06 notes “If new matter is added to the claims, the examiner should reject the claims under 35 U.S.C. 112(a), pre-AIA first paragraph - written description requirement. In re Rasmussen , 650 F.2d 1212, 211 USPQ 323 (CCPA 1981).” No basis for this limitation was identified in Applicant’s remarks filed 12/06/2024, a review of the specification by the Examiner did NOT find any specific basis for the recited complex of an AAV vector bound to a Type II-C Cas9 nuclease.
Claim Rejections - 35 USC § 112(a)
(Written Description)
Claims 58-74 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
Independent claim 58 encompasses a genus of Neisseria meningitidis single guide RNAs (Nme sgRNA) comprising a truncated Stem 2 region relative to the full-length Nme sgRNA of SEQ ID NO:219, while the specification describes a limited number of functional Nme sgRNA species comprising a few specific truncated Stem 2 regions, combined with a specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220, combined with a specific spacer length of 23 or 24 nucleotides.
Dependent claims 59-61 encompass a genus of truncated Nme sgRNAs in an AAV vector comprising various promoters and regulatory sequences, while the specification describes a limited number of functional Nme sgRNA species, with a limited number of U6 or U1a promoters capable of fitting in an AAV vector.
Dependent claim 62 encompasses a genus of truncated Nme sgRNAs in an AAV vector comprising various spacer target sequences, while the specification describes a limited number of functional Nme sgRNA species comprising spacer regions that target PCSK9 or ROSA26.
Dependent claims 63-64 encompass a genus of truncated Nme sgRNAs in an AAV vector comprising various lengths, while the specification describes a limited number of functional Nme sgRNA species comprising a limited number of truncated Stem 2 regions, combined with a specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220, combined with a specific spacer length of 23 or 24 nucleotides.
Dependent claims 65 and 71 encompass a genus of truncated Nme sgRNAs in an AAV vector relative to regions of the full-length Nme sgRNA of SEQ ID NO:219, while the specification describes a limited number of functional Nme sgRNA species comprising a limited number of truncated Stem 2 regions, combined with a specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220, combined with a specific spacer length of 23 or 24 nucleotides.
Dependent claim 66 encompasses a genus of Nme sgRNA comprising a truncated Stem 2 region of 24 nucleotides corresponding to nucleic acid residues 78-101 of SEQ ID NO:220, while Applicant’s specification describes a limited number functional Nme sgRNA species comprising the truncated Stem 2 region of 24 nucleotides encoded by nucleic acid residues 78-101 of SEQ ID NO:220, which is combined with a specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220 and combined with a specific spacer length of 23 or 24 nucleotides.
Dependent claims 68-69 encompasses a genus of Nme sgRNAs in an AAV vector comprising a truncated repeat:antirepeat region corresponding relative to SEQ ID NO:219, while Applicant’s specification describes a limited number functional Nme sgRNA species comprising a limited number of Stem 2 region, which is combined with a specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220 and combined with a specific spacer length of 23 or 24 nucleotides..
Dependent claims 70-72 encompass a genus of Nme sgRNAs in an AAV vector comprising a truncated spacer region corresponding relative to SEQ ID NO:219, while Applicant’s specification describes a limited number functional Nme sgRNA species comprising a limited numbers truncated Stem 2, which is combined with a specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220 and combined with a specific spacer length of 23 or 24 nucleotides..
Dependent claim 73 encompasses a genus of truncated Nme sgRNAs in an AAV vector for binding to a type-II Cas9 nuclease, while the specification describes no AAV vectors bound to a type-II C Cas9 nuclease, and a limited number of functional Nme sgRNA species comprising truncated Stem 2 regions relative to the full-length Nme sgRNA of SEQ ID NO:219 that would be capable of binding a Nme1 or Nme2 Cas9.
Dependent claim 74 encompasses a genus of methods for using a truncated Nme sgRNAs in an AAV vector for treating a genus of medical conditions comprising a genus of spacer regions partially complementary to a genus of genes, while the specification describes a limited number of functional Nme sgRNA species comprising spacer regions complete complementary to specific regions in a limited number of genes to treat a limited number of medical conditions.
Under the written description guidelines (see MPEP 2163) the Examiner is directed to determine whether one skilled in the art would recognize that the Applicant was in possession of the claimed invention as a whole at the time of filing. The following considerations are critical to this determination.
To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. See, e.g., Moba, B.V. v. Diamond Automation, Inc., 325 F.3d 1306, 1319, 66 USPQ2d 1429, 1438 (Fed. Cir. 2003); Vas-Cath, Inc. v. Mahurkar, 935 F.2d at 1563, 19 USPQ2d at 1116. An original claim may lack written description support when (1) the claim defines the invention in functional language specifying a desired result but the disclosure fails to sufficiently identify how the function is performed or the result is achieved or (2) a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement is not necessarily met when the claim language appears in ipsis verbis in the specification. "Even if a claim is supported by the specification, the language of the specification, to the extent possible, must describe the claimed invention so that one skilled in the art can recognize what is claimed. The appearance of mere indistinct words in a specification or a claim, even an original claim, does not necessarily satisfy that requirement." Enzo Biochem, Inc. v. Gen-Probe, Inc., 323 F.3d 956, 968, 63 USPQ2d 1609, 1616 (Fed. Cir. 2002).
ACTUAL REDUCTION TO PRACTICE
In regard to claim 58 encompassing a genus of Nme sgRNA comprising a truncated Stem 2 region, the specification provides a limited number of functional Nme sgRNA comprising truncated Stem 2 regions.
Specifically, the specification discloses SEQ ID NO:220, which comprises the following features with respect to the spacer, repeat:anti-repeat duplex, stem 1, and stem 2 (from Fig. 3):
PNG
media_image1.png
116
1451
media_image1.png
Greyscale
Applicant demonstrates that the 101 nucleotide long SEQ ID NO:220 encodes a functional sgRNA, which comprises a truncated stem 2 region encoded by nucleotides 78-101 of SEQ ID NO: 220, combined with a truncated repeat:anti-repeat region encoded by residues 25-52 of SEQ ID NO:220, combined with a spacer of 24 nucleotides. Furthermore, Applicant demonstrates that the spacer region of SEQ ID NO:220 (i.e., sgRNA #10) can be reduced from 24 nucleotides to 23 nucleotides (i.e., SEQ ID NO:221), and still retain function. Furthermore, Applicant demonstrates that a 3’ terminal “UA” dinucleotides can be included after the stem 2 region (i.e., SEQ ID NO:224), and still retain function.
[AltContent: textbox ([img-media_image2.png])]Moreover, in the context of the truncated repeat:anti-repeat region encoded by residues 25-52 of SEQ ID NO:220, the specification discloses seven (7) truncated Stem 2 regions that form functional Nme sgRNA (p, 19, last para., Fig. 2, see sgRNA #2 and #4-#9). However, the functionality of these truncated Stem 2 Nme sgRNA are highly variable. For example, sgRNAs #6 and #9 exhibit nearly a 10-fold reduction in sgRNA function with only 1% or 2% cutting, respectively. Furthermore, sgRNA #3 with the truncated stem 2 region (which appears to correspond to SEQ ID NO:211, see Applicant’s Fig. 2 excerpt below), exhibited 0% cutting.
Thus, Applicant’s specification demonstrates that about one-third of the truncated Nme sgRNA either do not work (i.e., sgRNA #3) or have significantly reduced activity (i.e., sgRNA#6 or #9). Moreover, Applicant does not describe any other Nme sgRNA that comprise a truncated Stem 2 region, and all of the functioning Nme sgRNA described by the Applicant are combined with a specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220, and combined with a specific spacer length of 23 or 24 nucleotides.
In regard to dependent claims 63 and 64 encompass a genus of Nme sgRNAs that are varying lengths in nucleotides, as stated supra, Applicant only describes the limited genus of truncated Stem 2, combined with a specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220, and combined with a specific spacer length of 23 or 24 nucleotides.
In regard to dependent claims 66-67 encompassing a genus of Nme sgRNA comprising a truncated Stem 2 region of 24 nucleotides corresponding to nucleic acid residues 78-101 of SEQ ID NO:220, as stated supra, Applicant only describes the truncated Stem 2 region of 24 nucleotides encoded by nucleic acid residues 78-101 of SEQ ID NO:220, combined with a specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220, and combined with a specific spacer length of 23 or 24 nucleotides.
In regard to dependent claims 68-69 encompassing a genus of Nme sgRNA comprising a truncated repeat:antirepeat region corresponding to nucleic acid residues 25-76 of SEQ ID NO:219, as stated supra, Applicant specification describes a limited number functional Nme sgRNA species comprising specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220, combined with a specific truncated Stem 2 region, which is combined with a spacer of 23 or 24 nucleotides.
In regard to dependent claims 70-72 encompassing a genus of Nme sgRNAs that comprise a truncated spacer, as stated supra, Applicant specification describes a limited number functional Nme sgRNA species comprising a spacer of 23 or 24 nucleotides combined with a specific truncated Stem 2 region, which is combined with a specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220.
In regard to dependent claim 73 encompassing a genus of Nme sgRNAs bound to a genus of type-II C Cas9 nucleases, Applicant only describes functional Nme sgRNA that bind Nme1 or Nme2 Cas9.
In regard to dependent claim 74 encompassing a genus of method for reducing symptoms of a medical condition, as stated supra, Applicant only describes a limited genus of functional Nme sgRNA for treating specific medical conditions, by targeting specific genes, with specific spacer regions.
Furthermore, the phrase “relative to a full-length sequence of SEQ ID NO: 219” is not a distinguishing identifying characteristic of the claimed Nme sgRNA as is simply a measure of sequence length (i.e., the length of the Stem 2 region of SEQ ID NO: 219 is 42 nucleotides, the length of the repeat:antirepeat region of SEQ ID NO:219 is 52 nucleotides, and the length of the spacer of SEQ ID NO:219 is 24 nucleotides). The breadth of this relative comparison allows hundreds of possible truncated stem 2 regions that are 24 nucleotides in length and hundreds of possible truncated repeat:antirepeat regions, thereby producing a combined genus of tens of thousands of possible Nme sgRNAs.
Accordingly, Applicant demonstrated by a reduction to practice to a limited number of functional Nme sgRNAs (e.g., SEQ ID NOs:210, 212, 213, 215, 216, 218, 220, 221, 224) comprising a comprising specific truncated Stem 2 regions, combined with a specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220, and combined with a specific spacer length of 23 or 24 nucleotides. Furthermore, Applicant did not adequately set forth in terms of distinguishing identifying characteristics as evidenced by other descriptions of the invention that are sufficiently detailed to show that Applicant was in possession of the thousands of Nme sgRNAs comprising any truncated Stem 2 region, combined with any truncated repeat:anti-repeat region and combined with any spacer length.
DISCLOSURE OF STRUCTURE
The Applicant has provided limited genus of functional Nme sgRNA comprising truncated Stem 2 regions and a truncated repeat:antirepeat region relative to SEQ ID NO:219. Certainly, with the help of an oligo synthesizer, a skilled artisan could eventually make the claimed genus of thousands of Nme sgRNAs. The wild-type full length Nme sgRNA of SEQ ID NO:219 was known in the prior art and was shown to be functional (see Fig. S1 of Hou et al., PNAS, 2013, 110:15644-15649, see IDS filed 12/13/2024).
However, the prior art provides a single description of functional Nme sgRNAs comprising a specific truncated Stem 2 region combined with a specific truncated repeat:antirepeat region relative to the full-length SEQ ID NO:219. Furthermore, neither the specification nor the art indicate a relationship between the structure of the claimed genus of truncated sgRNA and the ability to make and use functional Nme sgRNA comprising any truncated Stem 2 region combined with any truncated repeat:antirepeat region relative to the full-length SEQ ID NO:219.
SUFFICIENT RELEVANT IDENTIFYING CHARACTERISTICS
The breadth of the claims encompass a genus of thousands of Nme sgRNAs comprising any truncated Stem 2 region combined with any truncated repeat:antirepeat region relative to the full-length SEQ ID NO:219, yet the present specification provides no guidance nor description which manner to make the truncations in Stem 2 and repeat:antirepeat regions beyond those described as comprising the specific truncated Stem 2 region of SEQ ID NOs:210, 212, 213, 215, 216, 218, 220, 221, 224 and the repeat:antirepeat residues 25-52 of SEQ ID NO:220, respectively, that would result in functional Nme sgRNA, therefore the skilled artisan would not know what rational approach to take to make the genus of thousands of truncated Nme sgRNA with any predictable outcome on their function. Therefore, it is incumbent on the Applicant to provide this nexus between structure and function, in order to be given credit for possession of the claimed genus of truncated Nme sgRNA.
STATE OF THE ART & QUANTITY OF EXPERIMENTATION
The method of making the claimed invention was not well established. Although truncated Nme sgRNA were known in the state of the art, one of skill in the art would neither expect nor predict the ability to generate functional Nme sgRNA according to the claimed genus of truncations.
The closest prior art Lee et al. (Mol Ther, 2016, 24:645-654, see IDS filed 12/13/2024), teaches a Nme sgRNA[AltContent: textbox ([img-media_image3.png])] comprising a truncated stem 2 region of 38 nucleotides (relative to the full length stem 2 region of 42 nucleotides of SEQ ID NO:219) (see excerpt from Fig. 1b adjacent). Furthermore, the stem 2 truncation by Lee is a terminal truncation that is offset by an added polyU tract, and Lee provides no guidance for how to make a functional Nme sgRNA with any truncated stem 2 region.
Furthermore, Lee teaches the Nme sgRNA further comprises a truncated repeat:antirepeat region of 40 nucleotides (relative to the full length repeat:antirepeat regions of 52 nucleotides of SEQ ID NO:219). However, this is a single specific repeat:antirepeat truncation that is combined with a specific stem 2 truncation to make a functional Nme sgRNA, and provides no guidance for how to make a functional Nme sgRNA with any truncated stem 2 region, with any truncated repeat:antirepeat region, with any spacer region relative to SEQ ID NO:219.
Furthermore, the prior art of Wolfe et al. (US2015/0191744, filed 12/16/2014, published 7/09/2015) demonstrates that a Nme sgRNA nearly identical to that of Lee (2016) comprising the same truncated Stem 2 and the same truncated repeat:anti-repeat duplex (i.e., nmsgRNAm3) but did not have the polyU tract on the 3’ end was unable to localize dCas9-GFP to the genomic DNA of a cell compared to the wild-type Nme sgRNA comprising SEQ ID NO:219 (see Fig. 15G). Thus, nearly identical Nme sgRNAs with the same truncated Stem 2 and repeat:anti-repeat regions did not predictably generate a functional Nme sgRNA.
Furthermore, the prior art of Church (US2015/0259684, published 9/17/2015, see IDS filed 12/13/2024) teaches making and using a Nme sgRNA, but explicitly teaches “the complete 3’tracrRNA sequence was always included, as truncations are known to be detrimental” (Example XVII, [0144]). Thus, any truncations involving the repeat region of the repeat:antirepeat region would have needed to be tested empirically to ensure functionality. Furthermore, in regard to truncating the repeat:anti-repeat region relative to other type II Cas9 crRNA, Church provides an alignment of the crRNA repeat regions from several Cas9 species (see Fig. 12A, excerpt below). However, as can be seen from the alignment, the Nme crRNA comprises less than 50% identity (17/36 nucleotides) with the better characterized S. pyogenes crRNA. Thus, these was no manner a priori for one to predict the effects of truncations in the repeat:antirepeat region by comparison with other Cas9 orthologues.
PNG
media_image4.png
125
763
media_image4.png
Greyscale
Finally, the post-filing art by Applicant as published in Sun et al., (Mol Cell, 2019, 76:938-952, see IDS filed 12/13/2024) evidences that truncations of Stem 2 of the sgRNA were unpredictable with respect to their effects on Nme Cas9 activity. Sun evidences that “Nme1Cas9 makes extensive hydrogen-bond contacts and stacking interaction with the sgRNA” (p. 4, Results, 2nd para.), and that unlike most stem-loop 2 sgRNA nucleotides, the stem-loop 2 of the Nme sgRNA “is flipped out and stabilized by stacking by the side chains of the Nme1Cas9, wherein “truncation of stem-loop 2 reduced Nme1Cas9 activity, wherein the sgRNA lacking stem-loop 2 exhibited no activity” (p. 2, Results, 3rd para.). Thus, the prior art, Applicant’s specification and their post-filing work evidence that not just any truncation in the Nme sgRNA stem-loop 2 and not just any truncation in the repeat:antirepeat relative to SEQ ID NO:219 could predictably make a functional Nme sgRNA as broadly as claimed.
Applicant has claimed a genus of thousands of Nme sgRNA comprising any truncated Stem 2 region and any truncated repeat:antirepeat region and any spacer relative to SEQ ID NO:219, yet the specification has disclosed only limited number of such truncated sgRNA, and has not set forth in terms of distinguishing identifying characteristics as evidenced by other descriptions of the invention that are sufficiently detailed to show that Applicant was in possession of the claimed genus of truncated Nme sgRNA. Furthermore, the state of the art indicated that making the claimed genus of truncated Nme sgRNA was not well established and would require undue experimentation to make and use these truncated Nme sgRNA as broadly as claimed, and one of skill in the art would neither expect nor predict making and using a truncated Nme sgRNA produced according to the claimed genus of thousands of truncated Nme sgRNA beyond those described as comprising the specific truncated Stem 2 region of SEQ ID NOs:210, 212, 213, 215, 216, 218, 220, 221, 224, which are combined with the specific truncated repeat:anti-repeat region encoded by nucleic acid residues 25-52 of SEQ ID NO:220, and combined with a specific spacer length of 23 or 24 nucleotides.
CONCLUSION
Therefore, the Examiner concludes that there is insufficient written description of the instantly claimed genus of Nme sgRNA comprising any truncated Stem 2 region and any truncated repeat:antirepeat region and any spacer region relative to full length SEQ ID NO:219. Specifically, there is limited description of the structure-function relationship between the claimed genus of truncations and their ability to produce a functional Nme sgRNA, and the Examiner further concludes a skilled artisan would find the specification inadequately describes the claimed genus of truncated Nme sgRNA.
Claim Rejections - 35 USC § 112(a)
(Scope of Enablement)
Claim 74 is rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for a method for reducing a symptom of a limited genus medical conditions by targeting a limited genus of genes with an AAV vector encoding a limited genus of Nme sgRNA that specifically targeting said limited genus of genes, and in combination with a Nme Cas9, does not reasonably provide enablement for methods for reducing a symptom of any medical condition by targeting any gene with an AAV vector encoding any truncated Nme sgRNA that are complementary to any portion of said genes. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to practice the invention commensurate in scope with these claims.
SCOPE OF THE INVENTION
Independent claim 74 encompasses methods of reducing a symptom in a genus of medical conditions in a subject comprising administering a genus of AAV vectors comprising encoding a genus of Nme sgRNA comprising a truncated sgRNA that are complementary to a portion of a genus of genes, while the specification discloses a limited number of such methods in a subject, and discloses only a limited genus of Nme sgRNA that target a limited genus of genes comprising a limit genus of spacers that are complementary to the target gene.
In regard to the scope of the genus of medical condition to be treated, Applicant’s specification describes the genus of conditions including any impairment of the normal state of the living animal or plant body or one of its parts that interrupts or modifies the performance of the vital functions (p. 13, last para.). Although, Applicant’s specification specifically states that the medical conditions to be treated can include hypercholesterolemia, tyrosinemia, x-linked chronic granulomatous disease, and aspartylglycosaminuris (p. 7. 1st para.), the breadth of the genus of the medical conditions and target genes encompass a genus of tens of thousands of medical conditions for plants and animals by targeting a genus of hundreds of thousands of genes. Overall, Applicant’s specification states that the all-in-one AAV delivery platform can be used “to target any gene in any tissue” (p. 67, Clinical Applications).
In regard to the scope of the Nme sgRNA to be administered, as stated in the pending 112(a) written description rejection above, the scope of the method claims encompasses a genus of thousands of truncated Nme sgRNA. Moreover, in regard to the scope of the Nme sgRNA comprise a portion of at least a plurality of gene, Applicant’s specification indicates as few as 18 nucleotides can be used in the Nme sgRNA with as few as 8-9 nucleotides that hybridize to the target sequence (p. 61, 1st and last para.). However, Applicant demonstrates that only a limited number of spacer regions can be predictably used to target a gene of interest, which have to be empirically tested for functionality and specificity.
The factors to be considered in determining whether undue experimentation is required are summarized In re Wands 858 F.2d 731, 8 USPQ2nd 1400 (Fed. Cir, 1988). The Court in Wands states: “Enablement is not precluded by the necessity for some 'experimentation.'” Clearly, enablement of a claimed invention cannot be predicated on the basis of quantity of experimentation required to make or use the invention. “Whether undue experimentation is needed is not a single simple factual determination, but rather is a conclusion reached by weighing many factual considerations.” (Wands, 8 USPQ2d 1404). The factors to be considered in determining whether undue experimentation is required include: (1) the quantity of experimentation necessary, (2) the amount or direction or guidance presented, (3) the presence or absence of working examples, (4) the nature of the invention, (5) the state of the prior art, (6) the relative skill of those in the art, (7) the predictability or unpredictability of the art, and (8) the breadth of the claims. While all of these factors are considered, a sufficient amount for a prima facie case is discussed below.
The office has analyzed the specification in direct accordance to the factors outlined in In re Wands. MPEP 2164.04 states: "[W]hile the analysis and conclusion of a lack of enablement are based on factors discussed in MPEP 2164.01(a) and the evidence as whole, it is not necessary to discuss each factor in written enablement rejection." These factors will be analyzed, in turn, to demonstrate that one of ordinary skill in the art would have had to perform "undue experimentation" to make and/or use the invention and therefore, Applicant's claims are not enabled commensurate with the scope of the invention.
ACTUAL REDUCTION TO PRACTICE
In regard to claim 74 encompassing methods of reducing a symptom in a genus of medical conditions in a subject comprising administering a genus of AAV vectors comprising encoding a genus of Nme sgRNA comprising a truncated sgRNA that are complementary to any portion of genus of genes, the specification provides a limited number of examples of reducing a symptom in a few medical conditions by administering an AAV vector comprising a single Nme sgRNA with a Nme Cas9 that target a specific region of a specific gene.
[AltContent: textbox ([img-media_image5.png])]Specifically, the specification discloses a method of using an AAV8 vector encoding the Nme sgRNA encoded by SEQ ID NO:220 that comprises a 24 nucleotide spacer targeting the gene Pcsk9 under control of a U6 promoter, in addition to a humanized NmeCas9 transgene (Figs. 11-13, 44, 49, 54 and 56, see excerpt from Fig. 44A adjacent). The symptom reduced by Applicant’s method is a reduction in serum cholesterol levels compared to a Nme2 sgRNA targeting a Rosa26 control gene, wherein the only medical condition is hypercholesterolemia (Example XXII, see Fig. 44C), wherein the only gene targeted is Pcsk9 with a single sgRNA spacer that was optimized for its functionality and specificity.
Furthermore, the specification discloses a method of using an AAV8 vector encoding a Nme sgRNA encoded by SEQ ID NO:220 that comprises two 24 nucleotide spacers (i.e., Hpd1 and Hpd2) targeting the FAH genes under the control of a U6 promoter in additions to a humanized Nme Cas9 transgene (Example XXII, Figs. 50-53, and 56). The only symptom reduced by Applicant’s method is a reduction in mortality, wherein the only medical condition is Type I tyrosinemia ( see Fig. 51), wherein the only gene targeted is FAH with a pair of sgRNA spacers that were optimized for their functionality and specificity.
Finally, the specification discloses a method of using an AAV6 vector encoding a Nme sgRNA encoded by SEQ ID NO:220 that comprises two 24 nucleotide spacers (i.e., Tyr2 and Tyr3) targeting the Tyrosinase coat color genes under the control of a U6 promoter in additions to a humanized Nme Cas9 transgene (Figs. 57 and 58). Although coat color is changed, no symptom of a medical conditions is addressed, and again the sgRNA used were optimized for functionality and specificity.
The specification provides no other methods of reducing a symptom of any medical condition comprising a AAV vector encoding any truncated Nme sgRNA that targets any gene or portion thereof in any tissue.
In fact, Applicant’s specification admits that “indel rates varied significantly depending on the target sequence and locus” (p. 62, last para.). For example, the specification discloses targeting 28 loci throughout the human genome, but NmeCas9 induced indels in only half of the loci (i.e., 19 sites), with editing efficiencies below 5% in four of them (p. 66, 3rd. para.). Thus, Applicant’s specification supports the fact not just any spacer region can be used once a specific medical condition and specific gene has been identified.
STATE OF THE ART & QUANTITY OF EXPERIMENTATION
The method of practicing the claimed invention is not well established. In fact, the state of the art teaches that using an Nme sgRNA to target any gene in any tissue is not a highly successful technique or has highly variable results depending on the medical condition, the gene targeted, and the sgRNA used. Consequently, there is ample reason to conclude that there would be a high degree of unpredictability in a method of reducing a symptom in any medical condition in a subject by targeting any gene comprising administering a genus of AAV vectors comprising encoding a genus of truncated Nme sgRNA that are complementary to any portion of said genus of genes. Furthermore, instant claim does not require the introduction of a Nme1 or Nme2 Cas9 nuclease.
As mentioned in the 112(a) written description rejection, the closest prior art Lee et al. (Mol Ther, 2016, 24:645-654, see IDS filed 12/13/2024), teaches a Nme sgRNA comprising a truncated stem 2 region of 38 nucleotides (relative to the full length stem 2 region of 42 nucleotides of SEQ ID NO:219) and a truncated repeat:antirepeat region of 40 nucleotides (relative to the full length repeat:antirepeat regions of 52 nucleotides of SEQ ID NO:219). Importantly, Lee tests a variety of clinically relevant genes for Nme sgRNA targeting, and demonstrates that sgRNA must be empirically tested for successful indel formation. Specifically, a sgRNA for the HPRT1 locus can cause indel formation at high as 35% depending on the length of the spacer used, while a sgRNA for the RYR2 locus causes no indel formation, although the two separated crRNA and tracrRNA can cause indels depending on the length of the spacer in the crRNA (see Table S1). In other words, not only does the spacer sequence need to be optimized for gene targeting to ensure functionality and specificity, but the fused sgRNA itself must be tested to predictably cause an indel in a target gene.
Since the prior art at the effective filing date of the present application did not provide guidance for reducing a symptom of any medical condition by administering an AAV vector comprising any truncated Nme sgRNA targeting any portion of any gene, it is incumbent upon the instant specification to do so. The physiological art, especially gene therapy, is recognized as unpredictable (MPEP 2164.03). As set forth in In re Fisher, 166 USPQ 18 (CCPA 1970), compliance with 35 USC 112, first paragraph requires: “That scope of claims must bear a reasonable correlation to scope of enablement provided by specification to persons of ordinary skill in the art; in cases involving predictable factors, such as mechanical or electrical elements, a single embodiment provides broad enablement in the sense that, once imagined, other embodiments can be made without difficulty and their performance characteristics predicted by resort to known scientific laws; in cases involving unpredictable factors, such as most chemical reactions and physiological activity, scope of enablement varies inversely with degree of unpredictability of factors involved.” Moreover, the courts have also stated that reasonable correlation must exist between scope of exclusive right to patent application and scope of enablement set forth in the patent application (27 USPQ2d 1662 Ex parte Maize!.). In view of the foregoing, due to the lack of sufficient guidance provided by the specification regarding the issues set forth above, the state of the relevant art, and the breadth of the claims, it would have required undue experimentation for one skilled in the art to make and use the instant broadly claimed invention.
CONCLUSION
In conclusion, since the art teaches that success of said method is prone to influence by multiple factors, and is highly unpredictable with respect to reducing a symptom of any medical conditions by administering any AAV vector comprising any truncated Nme sgRNA targeting any portion of any gene, and the specification does not provide ample guidance with respect to achieving the unexpected results, one would be burdened with undue experimentation to use the claimed invention. Given the breadth of the claims and the limited scope of the specification, an undue quantity of experimentation is require to make and use the invention beyond the scope of reducing a symptom of specific medical conditions such as hypercholesterolemia, tyrosinemia, or X-SCID, by administering an AAV vector comprising a limited genus of truncated Nme sgRNA targeting comprising a specific 20-24 nucleotide portion of a specific gene such as Pcsk9, FAH, or IL2RG, respectively.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 58-74 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention.
Claim 58 is drawn to a truncated sgRNA sequence “relative to” a full-length sequence of SEQ ID NO: 219. The phrase “relative to” is not defined by the claim nor used anywhere in the specification to identify sgRNA sequences, and it is unclear if the sequence of the truncated sgRNA actually comprises the sequence of SEQ ID NO: 219 (or portion thereof) or if this phrase is simply a measure of sequence length (i.e., the length of the Stem 2 region of SEQ ID NO: 219 is 42 nucleotides). The instant claims lack clarity because the language of the claim is such that a person of ordinary skill in the art could not interpret the metes and bounds of the claim so as to understand how to avoid infringement. In other words, claiming a sequence “relative to” another sequence raises doubts as to the actual content of the claimed sequence. Dependent claims 59-74 are included in the basis of the rejection because although they recite and encompass the truncated sgRNA of claim 58, they do not clarify the nature of the truncated Stem 2 region, truncated repeat anti-repeat region, nor spacer region relative to SEQ ID NO:219.
Claim 67 is drawn to the Nme sgRNA that comprises a region of SEQ ID NO:220, which is indefinite because SEQ ID NO:220 is a DNA sequence not an RNA sequence.
Claim 74 is drawn to the AAV vector of claim 1, which lacks proper antecedence because claim 1 is cancelled, thereby making claim 74 incomplete. For the sake of compact prosecution, claim 74 is being interpreted as being dependent on Claim 58.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 58-65, 68-73 are rejected under 35 U.S.C. 103 as being unpatentable over Lee et al. (Mol Ther, 24:645-654, see IDS filed 4/19/2024), in view of Davidson et al. (US2016/0355796, filed 1/10/2016, published 12/08/2016)
[AltContent: textbox ([img-media_image3.png])] With respect to claim 58, Lee teaches a vector comprising single guide RNA sequence from N. meningitides Cas9 comprising an internally truncated repeat:anti-repeat region and a 3’ terminally truncated stem 2 (see excerpt from Fig. 1b adjacent).
With respect to claim 58, as shown below relative to the full-length Nme sgRNA as set forth in SEQ ID NO: 219 (see excerpt from Fig. 3 of Applicant’s specification) Lee teaches the length of the Stem 2 region is truncated by approximately 6 bases on the 3’ end. Note the broadest reasonable interpretation of the phrase “a truncated Stem 2 region relative to a full-length Nme sgRNA set forth in SEQ ID NO: 219” has been interpreted as not limiting the actual nucleotide sequence of the claimed Nme sgRNA in the Stem 2 region.
PNG
media_image6.png
155
1640
media_image6.png
Greyscale
NNNNNNNNNNNNNNNNNNNNNNNNGUUGUAGCUCCCUUUCUCXXXXXGAAAXXXXXGAGAACCGUUGCUACAAUAAGGCCGUCUGAAAAGAUGUGCCGCAACGCUCUGCCCCUUAAAGCUUCUGCUUUAAGGGGCXXXXTTTTT
SPACER TRUNCATED REPEAT:ANTI-REPEAT STEM 1 TRUNCATED STEM 2
However in regard to claim 58, although Lee teaches the Nme Cas9 protein is withing the packaging limit of AAV vectors which could be used for more efficient in vivo delivery for genome editing (p. 653, 2nd para.), they do not reduce to practice an AAV vector comprising a Nme sgRNA and Cas9.
Davidson teaches compositions and methods of using CRIPSR Cas9 sgRNA in AAV vectors to transform and genome engineer human cells (Abstract).
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare the truncated Nme sgRNA in an AAV vector as suggested by Lee with a reasonable expectation of success in light of the teachings of Davidson. The ordinary skilled artisan would have been motivated to do so because it is explicitly suggested by Lee as an efficient in vivo delivery for genome editing and adds to the CRISPR-Cas9 toolbox for a wide range of biological and medical applications.
With respect to claims 59 and 60, both Lee and Davidson teach the vector comprises at least one promoter. Specifically with respect to claim 60, both Lee and Davidson teaches the vector comprises the U6 promoter for driving expression of the sgRNA (Fig. 1b, top of Lee, see also [0008, 0148] and Figs.18A of Davidson).
With respect to claim 61, Davidson teaches the presence of a Kozak sequence (GCCACCATG) at the translational start of the Cas9 sequence [0305].
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare the truncated Nme sgRNA in a AAV as suggested, and further combine the Nme Cas9 with Kozak sequence as taught by Davidson with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so because it was well known that the Kozak sequence improves translation of the subsequent gene.
With respect to claim 62, Lee teaches a Nme sgRNA that comprises a spacer for targeting the HPRT1 gene (Table S1), which is complementary to a portion of the Rosa26 gene.
With respect to claims 63 and 64, as shown supra, Lee teaches the length of the core truncated sgRNA is 101 nucleotides (without spacer and polyU).
With respect to claim 65, as shown supra, Lee teaches the Nme sgRNA comprises a truncated Stem 2 region relative to a full-length Nme sgRNA set forth in SEQ ID NO: 219 comprising a Stem 2 region corresponding to residues 102-143.
With respect to claims 68-69, as shown supra, Lee teaches the Nme sgRNA comprises a truncated repeat:anti-repeat region relative to a full-length Nme sgRNA set forth in SEQ ID NO: 219 comprising a repeat:anti-repeat region corresponding to residues 25-76. In regard to claim 69, as shown supra, Lee teaches the Nme sgRNA comprises a first sequence corresponding to residues 25-36 of SEQ ID NO: 219, a second sequence corresponding to residues 49-52 of SEQ ID NO: 219, a third sequence corresponding to residues 65-76 of SEQ ID NO: 219.
With respect to claims 70-72, as shown supra, Lee teaches the spacer sequence for truncated Nme sgRNA was varied between 24 to 20 nucleotides (p. 646, Results, 1st para).
With respect to claim 73, as stated supra, Lee teaches that when the sgRNA is expressed from the AAV vector it forms a complex with the N. meningitides Cas9.
Hence, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Claim 74 is rejected under 35 U.S.C. 103 as being unpatentable over Lee et al. (Mol Ther, 24:645-654, see IDS filed 4/19/2024), in view of Davidson et al. (US2016/0355796, filed 1/10/2016, published 12/08/2016), as applied to claim 58, in further view of Conway et al. (US 2016/0030477, filed 7/30/2015, published 2/04/2016)
As discussed previously, Lee et al. suggest an AAV vector comprising a Nme sgRNA comprising a truncated stem 2 region of 38 nucleotides (relative to the full length stem 2 region of 42 nucleotides of SEQ ID NO:219) and a truncated repeat:antirepeat region of 40 nucleotides (relative to the full length repeat:antirepeat regions of 52 nucleotides of SEQ ID NO:219) for use in a medical condition.
Although Lee teaches a Nme sgRNA comprising a spacer that successfully targets the IL2RG gene (Table S1), and Davidson teaches the AAV-sgRNA vector can target a variety of human cell types, they are silent to using the AAV Nme sgRNA to reduced an immunological symptom of the X-linked SCID in a subject.
Conway teaches method of using nucleases such as CRISPR for targeting the IL2RG gene so as to reduce an immunological symptom of X-linked SCID in a subject (Abstract, [0015]).
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare the truncated Nme sgRNA targeting IL2RG in a AAV vector to use in a medical application as suggested by Lee and Davidson, and use it in a method to reduce an immunological symptom of X-linked SCID in a subject as taught by Conway with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so as taught by Conway because X-SCID patients have infections very early in life, and without therapeutic intervention X-SCID is typically fatal during the first year of life (Background, [0006].
Hence, the claimed invention as a whole was prima facie obvious in the absence of evidence to the contrary.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory obviousness-type double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); and In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the conflicting application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement.
Effective January 1, 1994, a registered attorney or agent of record may sign a terminal disclaimer. A terminal disclaimer signed by the assignee must fully comply with 37 CFR 3.73(b).
Claims 58-73 are provisionally rejected on the grounds of nonstatutory double patenting as being unpatentable over claims 1-9 of copending Application No. 18/980,456, in view of Davidson et al. (US2016/0355796, filed 1/10/2016, published 12/08/2016). This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented
The subject matter claimed in the instant application is disclosed in the referenced application as follows: the Nme sgRNA of cited application makes obvious the AAV Nme sgRNA composition of instant application. It is clear that elements of the cited application claims are to be found in instant claims. The difference between the cited application claims and the instant claims lies in the fact that the instant application claims combine the sgRNA in an AAV vector.
Nevertheless, combining sgRNA into AAV vector was well known at the time of filing.
For example, Davidson teaches compositions and methods of using CRIPSR Cas9 sgRNA in AAV vectors to transform and genome engineer human cells (Abstract).
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to prepare the truncated Nme sgRNA in a vector claimed and choose an AAV vector as taught by Davidson with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so as taught by Davidson because the AAV vector is an efficient means for transforming human cells.
With respect to claims 59 and 60, Davidson teaches the vector comprises the U6 promoter, which would have been obvious to include for driving expression of the sgRNA ([0008, 0148] and Figs.18A of Davidson).
With respect to claim 61, Davidson teaches the presence of a Kozak sequence (GCCACCATG) at the translational start of the Cas9 sequence [0305], furthermore Davidson teaches the AAV vector comprising the sgRNA and the Cas9 sequence (see Fig.18A).
Accordingly, it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to claim the truncated Nme sgRNA in a AAV as suggested, and further combine the Nme Cas9 with Kozak sequence as taught by Davidson with a reasonable expectation of success. The ordinary skilled artisan would have been motivated to do so for several reasons. First, it was well known that the Kozak sequence improves translation of the subsequent gene. Furthermore, Davidson teaches that combining the sgRNA and Cas9 into a single AAV vector ensures that cells reproducibly receive both elements of the CRISPR system [0467].
With respect to claim 62, the spacer region is claimed with such a high degree of generality, any spacer used would comprise a region complementary to the Rosa26 locus.
Since the instant application claims are obvious over cited application claims in view of Davidson, said claims are not patentably distinct.
Conclusion
No claims are allowed.
Examiner Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ARTHUR S LEONARD whose telephone number is (571)270-3073. The examiner can normally be reached on Mon-Fri 9am-5pm.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James Doug Schultz can be reached on 571-272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ARTHUR S LEONARD/Examiner, Art Unit 1631
Prosecution Insights