Prosecution Insights
Last updated: May 29, 2026
Application No. 18/612,850

COMPOSITIONS AND METHODS FOR ENHANCED ANTIGEN BINDING PROTEINS

Non-Final OA §103§112
Filed
Mar 21, 2024
Priority
Sep 22, 2021 — provisional 63/246,978 +1 more
Examiner
VYAS, KEYUR ANILKUMAR
Art Unit
1637
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Hdt Bio Corp.
OA Round
3 (Non-Final)
52%
Grant Probability
Moderate
3-4
OA Rounds
1y 4m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 52% of resolved cases
52%
Career Allowance Rate
34 granted / 66 resolved
-8.5% vs TC avg
Strong +64% interview lift
Without
With
+63.5%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
38 currently pending
Career history
111
Total Applications
across all art units

Statute-Specific Performance

§101
0.7%
-39.3% vs TC avg
§103
53.8%
+13.8% vs TC avg
§102
10.4%
-29.6% vs TC avg
§112
7.8%
-32.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 66 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Continued Examination Under 37 CFR 1.114 A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 08/20/2025 has been entered. Election/Restrictions Claims 1-2, 4-8, 10, 12-19, 21-30, 33, 35 are pending. Claim 14 is withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 09/19/2024. Claims 1-2, 4-8, 10, 12-13, 15-19, 21-30, 33, 35 along with the elected species of DOTAP (cl. 10), squalene (cl. 13), metal oxide and iron oxide (cl. 17, 18, respectively) and surfactant (cl. 27) and enterovirus (cl. 1) are examined here. Priority The claim to provisional application 63/246978, filed on 09/22/2021, via its CON of PCT/US2022/076787, with the filing date of 09/21/2022, is recognized. Information Disclosure Statement The information disclosure statement (IDS) submitted on 8/20/2025 is filed before the mailing date of this Office Action. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. Drawings The objection to drawings is withdrawn; replacement sheets for Fig. 6C, 7A, 7B are submitted and par. 152 has deleted color designation. Claim Rejections - 35 USC § 112 The rejection of claims 1-2, 4-8, 10, 12-13, 15-19, 21-30, 33, 35 under 112(a) is withdrawn; claim 1 is amended to recite “alphavirus RNA-dependent RNA polymerase” and “an enterovirus” structural protein and “an enterovirus 3CD protease”. 35 U.S.C. 112(b): The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 21, 23 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 21, 23 recites the limitation "the surfactant" in line 1. There is insufficient antecedent basis for this limitation in the claim. Claim 1 recites two types of surfactants. 35 U.S.C. 112(d) The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 21, 23, 25 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 21 recites “the surfactant is a hydrophobic surfactant,” while claim 23 recites “the surfactant is a hydrophobic surfactant,” both hydrophobic and hydrophilic surfactants are already recited in claim 1 and do not further limit the claims. Claims 25 is directed to the lipid nanoparticle carrier comprises “a surfactant,” which is a broader genus of the species of cl. 1, which are limited to hydrophobic and hydrophilic surfactant of claim 1, and cl. 1 requires the lipid nanoparticle with two types of surfactants, while cl. 25 require only one surfactant, thus not further limiting claim 1. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. In the interest of compact prosecution, cl. 25, will be interpreted to require both hydrophilic and hydrophobic surfactants of cl. 1. Claim Rejections - 35 USC § 103 The rejection of claims 1-2, 4-8, 10, 12-13, 15-19, 21-30, 33, 35 under 103 is maintained. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1-2, 4-8, 10, 12-13, 15-19, 21-25 are rejected under 35 U.S.C. 103 as being unpatentable over Erasmus et al. (8/2020, Science Translation Med., 12, pg. 1-11, referred as Erasmus, shares co-inventors but outside one yr. exception, of record) and further in view of Yan et al. (2016, Vaccine, 34, 4196-4204, referred as Yan). Regarding instant cl. 1, 2, and 4, Erasmus discloses a virus-derived replicon RNA (repRNA of alphavirus, VEEV) vaccine for delivery of virus-like RNA particles incorporated with a lipid inorganic nanoparticle (LION) (pg. 1); discloses an ORF encoding a viral RNA-dependent RNA polymerase (see Fig. 1A, nsp4 is RdRp, relevant to instant cl. 1i), but with the structural protein genes replaced with an antigen-encoding gene (see Fig. 1A, pg. 1-2); demonstrated use of SARS-Covid-2 S protein(CoV2S) encoding sequence as an antigen-encoding gene (pg. 1-2); discloses LION, a highly stable cationic squalene emulsion with superparamagnetic iron oxide (Fe3O4) nanoparticles (SPIO) embedded in squalene, a hydrophobic oil phase (pg. 2, see Fig. 1). Fig. 1D of Erasmus PNG media_image1.png 170 317 media_image1.png Greyscale Erasmus discloses a cationic lipid, DOTAP in figure above; discloses the hydrophobic core, a squalene oil phase; discloses Span60 (a sorbitan monostearate, a hydrophobic surfactant) and Tween 80 (a polysorbate, a hydrophilic surfactant) (pg. 7, relevant to instant cl. 1). The LION is designed to enhance vaccine stability (can be stored at room temperature for 7 days and withstands RNAse exposure, see Fig. 1) and for intracellular delivery (pg. 2). Erasmus discloses a key component of LION is the cationic lipid 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), which enables electrostatic association with RNA molecules on LION’s surface (pg. 3, see fig. above, relevant to instant cl. 1). Erasmus discloses dsDNA plasmid vector with sequence of nonstructural ORF of VEEV strain TC-83 with sequence encoding SARS-CoV-2-antigen ligated in the vector (pg. 6) and the vector was linearized and transcribed to produce RNA molecule (relevant to instant cl. 2). Erasmus does not disclose a nucleic acid sequence encoding an enterovirus structural protein and an enterovirus 3CD virus protease, wherein the virus structural protein is a substrate for the virus protease. Yan discloses creating vectors incorporating various regions of enterovirus 71 (EV71) genome in a recombinant vesicular stomatis virus (rVSV) vector (abstract, pg. 4196). Using rVSV, a negative-strand RNA virus, as a backbone vector, Yan created various vectors expressing VP1, P1, 3CD, or P1-3CD of EV71 (pg. 4196, see Fig. 1A, left schematic below, relevant to instant cl. 1ii and 1iii, 4). The P1 nucleotide sequence expresses a structural EV protein, while 3CD nucleotide sequence expresses EV protease that cleaves P1 protein (par. 57 of instant specification discloses the inherent property of 3CD protease to cleave P1 into four capsid monomers, which includes VP1). PNG media_image2.png 170 672 media_image2.png Greyscale Based on the results of immunization studies with purified rVSVs comprising aforementioned genomic regions of EV71 in neonatal mice, Yan concluded that “mP1-3CD is a more expedient vaccine, and is a better choice than mVP1 and mP1/m3CD” (pg. 4201, Fig. 6E, see percent survival graph on right above, pg. 4202). mP1/m3CD is co-infected with mP1 and m3CD (at a ratio of mP1/m3CD - 9/1), i.e. separately as opposed to being expressed on the same vector (pg. 4197). Further, EV71 causes hand-foot-and mouth disease (HFMD), which is sometimes associated with fatal neurologic complications (pg. 4196). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, It would have been obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the VEEV plasmid vector in the LION/vector composition of Erasmus by substituting a nucleotide sequence of an EV71 genome that encodes P1 structural protein antigen and 3CD protease as taught by Yan for the antigen nucleotide sequence of Erasmus. Because Erasmus teaches a very stable and effective vaccine composition comprising a VEEV plasmid vector in the LION/vector composition that can be maintained at room temperature, and Yan demonstrates that immunization with delivery vector comprising 3CD and P1 sequences of EV71 results in improved survival as opposed to 3CD or P1 alone, a skilled artisan would reasonably expect success by substituting a nucleotide sequence of an EV71 genome that encodes P1 structural protein and 3CD protease as taught by Yan for the antigen nucleotide sequence of Erasmus for a stable vaccine that can be stored at room temperature for a reasonable duration and be used for immunization against debilitating EV71 virus. Thus, cl. 1, 2, and 4 are obvious. Regarding claim 5-7, Erasmus discloses LION has an intensity-weighted average diameter of 52 nm (pg. 3). Regarding instant cl. 8, 10, Erasmus discloses the oil and aqueous phases were mixed and emulsified using a homogenizer, and a key component of LION is the cationic lipid 1,2-dioleoyl-3-trimethylammonium propane (DOTAP), which enables electrostatic association with RNA molecules when combined by a simple 1:1 (v/v) mixing step (Fig. 1D, pg. 2, see figure above). Regarding instant cl. 12, 13, as noted above, Erasmus discloses that hydrophobic core comprises the oil squalene (see fig. above, pg. 2). Regarding instant cl. 15-18, the figure above of Erasmus illustrates inorganic iron oxide particles within the hydrophobic squalene (pg. 2). Regarding instant cl. 19, 21-25, LION is comprised of squalene oil, Span60 (a sorbitan monostearate) (relevant to instant cl. 21-22) and Tween 80 (a polysorbate) (relevant to instant cl. 23-24), a cationic lipid DOTAP chloride, and an oleic acid-coated iron oxide nanoparticles (pg. 7; see figure above, relevant to instant cl. 19, 25). Claims 33, 35 are rejected under 35 U.S.C. 103 as being unpatentable over Erasmus et al. (8/2020, Science Translation Med., 12, pg. 1-11, referred as Erasmus) and Yan et al. (2016, Vaccine, 34, 4196-4204, referred as Yan) as applied to claims 1-2, 4-8, 10, 12-13, 15-19, 21-25 above, and further in view of Zhang et al. (2018, Emerging Microbes and Infection, 7, pg. 1-9, referred as Zhang), as evidenced by sequence of EV-D68 strain (2014, GenBank: KM851225.1, ncbi.nlm.nih.gov/nuccore/KM851225, accessed 03/05/25) for cl. 35. Regarding instant cl. 35, the claim recites “the region encoding for the non-enveloped virus structural protein comprises a sequence of SEQ ID NO: 18,” and under BRI, the recitation of “a sequence of SEQ ID NO: 18” is interpreted as a nucleotide sequence encoding non-enveloped virus structural protein comprising any sequence of any length that is identical to a portion of SEQ ID NO: 18. Disclosure of Erasmus and Yan is noted above. Further, based on their results, Yan concluded that “mP1-3CD is a more expedient vaccine, and is a better choice than mVP1 and mP1/m3CD” (pg. 4201, Fig. 6E, see percent survival graph on right above, pg. 4202). Erasmus and Yan do not disclose EV-D68 nor the nucleic acid region encoding for the non-enveloped virus structural protein comprising a sequence of SEQ ID NO: 18. Zhang discloses a plasmid expression cassette expressing both 3CD and P1 of enterovirus-D68 (EV-D68, virus belonging to Picornaviridae family, pg. 1, relevant to instant cl. 33) strain used to transform a yeast strain to express 3CD protease protein and P1 polypeptide, which comprises three capsid subunit proteins (VP0, VP1, and VP3) of EV-D68 that co-assemble following cleavage by 3CD protease to form viral capsid shells (pg. 4, 1). Zhang discloses production of neutralizing antibodies against the VP0, VP1 and VP3 antigens that protects mice against lethal EV-D68 infection (pg. 5, Fig. 3). Zhang discloses that the EV-D68 strain is associated with severe respiratory illness and neurological complications in children (abstract); and once a rare infection in US, in 2014, there were 1153 confirmed cases with 14 deaths, making it the largest and most widespread of EV-D68 outbreaks recorded in the world (pg. 2). Zhang discloses an EV-D68 strain US/MO/14-18947, with GenBank ID: KM851225. Alignment of instant SEQ ID NO: 18 and, as evidenced by sequence of EV-D68 strain (2014, GenBank: KM851225.1, www.ncbi.nlm.nih.gov/nuccore/KM851225), and provides that EV-D68 sequence has a sequence that is identical to a portion of SEQ ID NO: 18 (see alignment below for underlined sequences for sequences that are identical, relevant to instant cl. 35). Further, Zhang demonstrates that passive transfer of anti-VLP sera protected all suckling mice against lethal infection while ones treated with control sera all died (pg. 6, Fig. 5, pg. 7). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the VEEV plasmid vector in the LION/vector composition of Erasmus in view of Yan and Zhang and arrive at the claimed invention with a reasonable expectation of success. Based on the success of Erasmus’s stable and effective vaccine composition comprising a LION particle with VEEV plasmid vector that can be maintained at room temperature, and Yan teaching improved survival an animal by immunizing with a vector carrying both 3CD protease and VP1 of enterovirus as opposed to 3CD or VP1 alone, and Zhang’s demonstration of protecting mice following vaccination with neutralization-sera against lethal EV-D68 infection, a skilled artisan would reasonably expect success by substituting an expression cassette expressing both 3CD- and P1- producing antigens of EV-D68 strain of Zhang for the antigen nucleotide sequence of Erasmus for a stable vaccine that can be stored at room temperature for a reasonable duration and used for immunization against EV68 virus. Thus, cl. 33, 35 are obvious. Claims 26-30 are rejected under 35 U.S.C. 103 as being unpatentable over Erasmus et al. (8/2020, Science Translation Med., 12, pg. 1-11, referred as Erasmus, in IDS), Yan, and Zhang et al. (2018, Emerging Microbes and Infection, 7, pg. 1-9) as applied to claims 1-2, 4-8, 10, 12-13, 15-19, 21-25 above, and further in view of Vargas et al. (2019, J. of Materials Chem., 7, 695-708). The disclosures of Erasmus, Yan and Zhang are noted above. It should be noted that Erasmus teaches iron oxide nanoparticle embedded in the hydrophobic oil phase (pg. 2, relevant to cl. 26 limitation “wherein the hydrophobic core further comprises one or more inorganic particles”). Erasmus and Yan do not disclose composition with a phosphate-terminated lipid of instant claims 26-30, or recited surfactant of instant claims 29-30. Vargas discloses various hybrid lipid nanoparticles (HLNPs) for biomedical applications, and notes various inorganic particles that can be associated with the nanoparticle, gold, silver, palladium; and iron oxide; and each has a benefit, for e.g. iron oxide, forming a super paramagnetic iron oxide particles (SPIONs) for magnetic field-guided drug delivery system (pg. 695-696, relevant to instant cl. 26); further discloses that the nanoparticles can be categorized into five types based on the localization of the nanoparticles within the lipid assembly, one being liposomes with surface bound nanoparticles or liposomes with core-encapsulated nanoparticles (pg. 696, relevant to cl. 26); discloses the use of surfactants, such as phospholipids, to stabilize the solid lipid core (pg. 702, relevant to cl. 29); discloses the use of TOPO ligands on CdSe/ZnS quantum dots for improved fluorescent imaging in cells (pg. 702, relevant to instant claims 26, 27 and 28); discloses oleic acid capped maghemite SPIONs embedded in DPPC liposomes for release of AMF-triggered release of fluorescent dyes (pg. 700, relevant to instant cl. 30). One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, It would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the nanoparticles containing heterologous construct of repRNA/LION particle and enterovirus capsid/protease sequence of Erasmus and Yan in view of Vargas and arrive at the claimed invention with a reasonable expectation of success. Because Erasmus teaches a very stable and effective vaccine composition comprising a VEEV plasmid vector in the LION/vector composition that can be maintained at room temperature, and Yan demonstrates that immunization with delivery vector comprising 3CD and P1 sequences of EV71 results in improved survival as opposed to 3CD or P1 alone, and Vargas teaching of using phospholipids for improved stabilization, and use of TOPO ligands with inorganic particles for improved imaging, a skilled artisan would reasonably expect success by modifying the repRNA/LION composition of Erasmus with addition of phospholipids for improved nanoparticle stability and addition of TOPO with disclosed inorganic particles and/or oleic acid surfactant for improved imaging as disclosed by Vargas. Thus, cl. 26-30 are obvious. Response to Arguments Applicant's arguments filed 08/20/2025 (“the Remarks”) have been fully considered but they are not persuasive. The Remarks argue the following: “the Office fails to provide express guidance from the cited publications to produce a composition comprising a nucleic acid that is in complex with a surface of a lipid nanoparticle carrier, wherein the nucleic acid encodes” for all three recited elements (pg. 9) and does not, specifically, “establish a reasonable expectation of success” since Office “has still not provided a sufficient, articulated reasoning for how or why one of skill in the art would have been motivated the vaccine in Erasmus to include a non-enveloped virus structural protein and protease as part of a nucleic acid in complex with a lipid nanoparticle carrier” (pg. 10). The nucleic acids of supporting Yan reference “encode for is in a completely different structural arrangement (additionally encoding for a carrier element)” (pg. 10). The Remarks note that carrier is of VSV vector and P1-3CD are contained within the carrier (pg. 10-11), which is in contrast to claimed invention, thus “has a significantly different structure than the vectors in the Yan publication” (pg. 11). “Thus, one contemplating incorporating nucleic acids the carrier [sic] of Erasmus would certainly not consider use of nucleic acids encoding for another carrier” (pg. 11). Regarding rejection of cl. 33, 35, the Remarks, first admit that “Zhang et al. is cited merely for providing the sequence of SEQ ID NO: 18” but argue that it does not cure the deficiency of Erasmus, since Zhang is silent with respect to a nucleic acid that encodes for an alphavirus RNA-dependent RNA polymerase (pg. 11). While for claims 26-30, the Remarks adds that Vargas does not cure the deficiencies due to the amended claim 1 (pg. 11-12). Regarding rejection of claims 26-30, the Remarks adds that Vargas does not cure the deficiencies due to the amended claim 1 (pg. 11-12). The arguments are not persuasive. Addressing argument A), Erasmus suggests that any antigen-encoding gene is possible by indicating “the structural protein genes are replaced with an antigen-encoding gene” (pg. 2) and cites a reference where another alphavirus vector was used and its structural protein-encoding region replaced with a bacterial CAT gene (see e.g., reference 20 of Erasmus, Xiong’s reference provides Sindbis virus, an alphavirus vector, incorporating a bacterial nucleic acid encoding protein (Xiong, 1989, Science, 243, pg. 1188-1191). Thus, incorporation of bacterial gene in alphavirus was also successful, as was incorporation of coronavirus sequences in alphavirus backbone of Erasmus. Further the recited claims do not require the recited sequences in any particular arrangement. Regardless, modern biotechnology teaches the ability to modify any vector with any sequence desired in any arrangement desired. Yan illustrates incorporating specific sequences (VP1, P1, 3CD-HA tagged, P1) of enterovirus in VSV carrier (see, e.g., Yan Figs in instant action as well as the Remarks, pg. 10). Zhang illustrates incorporating the same enterovirus P1 and 3CD sequence in a different carrier (a pPink-HC vector) modified to be expressed in a yeast. Thus, based on the teachings of the references there is a likelihood of reasonable success of incorporating at least the noted enterovirus sequences of either Zhang or Yan in the repRNA vector of Erasmus. A flexible, rational basis for combining prior art is the standard required by KSR, and the action has fulfilled the requirement. Each reference provides a rational basis for a skilled artisan to incorporate the sequences studied, both Yan and Zhang teach designing enterovirus vector to vaccinate against an increasingly debilitating enterovirus infection or even to produce antibodies, as taught by Zhang, pg. 2 (under Proteins, inactivated EV-D68 virus, and antibodies). Further both references disclose a need that currently there are no approved vaccine against either the EV71 or EV68 strain. Addressing B), in response to applicant's arguments against the references individually, one cannot show nonobviousness by attacking references individually where the rejections are based on combinations of references. See In re Keller, 642 F.2d 413, 208 USPQ 871 (CCPA 1981); In re Merck & Co., 800 F.2d 1091, 231 USPQ 375 (Fed. Cir. 1986). The Zhang reference teaches a different strain of enterovirus (EV-68) and teaches the sequence of SEQ ID NO: 18 and Erasmus teaches a repRNA/LION composition and Yan teaches the vector comprising both enterovirus-71 structural protein and 3CD protease. Addressing C), the Remarks fail to provide sufficient evidence as to how Vargas does not cure the deficiencies of Erasmus, Yan or Zhang. As noted in this action, Erasmus and Yan references, which still make amended cl. 1 obvious, and combined with Vargas make cl. 26-30 obvious. Thus the rejection of examined claims are obvious. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /KEYUR A VYAS/Examiner, Art Unit 1637 /Soren Harward/Primary Examiner, TC 1600 Alignment between instant SEQ ID NO: 8 (Db) and VEEV GenBank L01443.1 (Qy), relevant to instant cl. 34. Query Match 99.9%; Score 7553.6; DB 1; Length 7561; Best Local Similarity 99.9%; Matches 7556; Conservative 0; Mismatches 4; Indels 0; Gaps 0; Qy 1 ATAGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATAGGCGGCGCATGAGAGAAGCCCAGACCAATTACCTACCCAAAATGGAGAAAGTTCACG 60 Qy 61 TTGACATCGAGGAAGACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTG 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TTGACATCGAGGAAGACAGCCCATTCCTCAGAGCTTTGCAGCGGAGCTTCCCGCAGTTTG 120 Qy 121 AGGTAGAAGCCAAGCAGGTCACTGATAATGACCATGCTAATGCCAGAGCGTTTTCGCATC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 AGGTAGAAGCCAAGCAGGTCACTGATAATGACCATGCTAATGCCAGAGCGTTTTCGCATC 180 Qy 181 TGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGATCCTTGACATTGGAA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TGGCTTCAAAACTGATCGAAACGGAGGTGGACCCATCCGACACGATCCTTGACATTGGAA 240 Qy 241 GTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GTGCGCCCGCCCGCAGAATGTATTCTAAGCACAAGTATCATTGTATCTGTCCGATGAGAT 300 Qy 301 GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GTGCGGAAGATCCGGACAGATTGTATAAGTATGCAACTAAGCTGAAGAAAAACTGTAAGG 360 Qy 361 AAATAACTGATAAGGAATTGGACAAGAAAATGAAGGAGCTCGCCGCCGTCATGAGCGACC 420 |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| Db 361 AAATAACTGATAAGGAATTGGACAAGAAAATGAAGGAGCTGGCCGCCGTCATGAGCGACC 420 Qy 421 CTGACCTGGAAACTGAGACTATGTGCCTCCACGACGACGAGTCGTGTCGCTACGAAGGGC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CTGACCTGGAAACTGAGACTATGTGCCTCCACGACGACGAGTCGTGTCGCTACGAAGGGC 480 Qy 481 AAGTCGCTGTTTACCAGGATGTATACGCGGTTGACGGACCGACAAGTCTCTATCACCAAG 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 AAGTCGCTGTTTACCAGGATGTATACGCGGTTGACGGACCGACAAGTCTCTATCACCAAG 540 Qy 541 CCAATAAGGGAGTTAGAGTCGCCTACTGGATAGGCTTTGACACCACCCCTTTTATGTTTA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 CCAATAAGGGAGTTAGAGTCGCCTACTGGATAGGCTTTGACACCACCCCTTTTATGTTTA 600 Qy 601 AGAACTTGGCTGGAGCATATCCATCATACTCTACCAACTGGGCCGACGAAACCGTGTTAA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 AGAACTTGGCTGGAGCATATCCATCATACTCTACCAACTGGGCCGACGAAACCGTGTTAA 660 Qy 661 CGGCTCGTAACATAGGCCTATGCAGCTCTGACGTTATGGAGCGGTCACGTAGAGGGATGT 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CGGCTCGTAACATAGGCCTATGCAGCTCTGACGTTATGGAGCGGTCACGTAGAGGGATGT 720 Qy 721 CCATTCTTAGAAAGAAGTATTTGAAACCATCCAACAATGTTCTATTCTCTGTTGGCTCGA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CCATTCTTAGAAAGAAGTATTTGAAACCATCCAACAATGTTCTATTCTCTGTTGGCTCGA 780 Qy 781 CCATCTACCACGAGAAGAGGGACTTACTGAGGAGCTGGCACCTGCCGTCTGTATTTCACT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 CCATCTACCACGAGAAGAGGGACTTACTGAGGAGCTGGCACCTGCCGTCTGTATTTCACT 840 Qy 841 TACGTGGCAAGCAAAATTACACATGTCGGTGTGAGACTATAGTTAGTTGCGACGGGTACG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 TACGTGGCAAGCAAAATTACACATGTCGGTGTGAGACTATAGTTAGTTGCGACGGGTACG 900 Qy 901 TCGTTAAAAGAATAGCTATCAGTCCAGGCCTGTATGGGAAGCCTTCAGGCTATGCTGCTA 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 TCGTTAAAAGAATAGCTATCAGTCCAGGCCTGTATGGGAAGCCTTCAGGCTATGCTGCTA 960 Qy 961 CGATGCACCGCGAGGGATTCTTGTGCTGCAAAGTGACAGACACATTGAACGGGGAGAGGG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 CGATGCACCGCGAGGGATTCTTGTGCTGCAAAGTGACAGACACATTGAACGGGGAGAGGG 1020 Qy 1021 TCTCTTTTCCCGTGTGCACGTATGTGCCAGCTACATTGTGTGACCAAATGACTGGCATAC 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 TCTCTTTTCCCGTGTGCACGTATGTGCCAGCTACATTGTGTGACCAAATGACTGGCATAC 1080 Qy 1081 TGGCAACAGATGTCAGTGCGGACGACGCGCAAAAACTGCTGGTTGGGCTCAACCAGCGTA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 TGGCAACAGATGTCAGTGCGGACGACGCGCAAAAACTGCTGGTTGGGCTCAACCAGCGTA 1140 Qy 1141 TAGTCGTCAACGGTCGCACCCAGAGAAACACCAATACCATGAAAAATTACCTTTTGCCCG 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 TAGTCGTCAACGGTCGCACCCAGAGAAACACCAATACCATGAAAAATTACCTTTTGCCCG 1200 Qy 1201 TAGTGGCCCAGGCATTTGCTAGGTGGGCAAAGGAATATAAGGAAGATCAAGAAGATGAAA 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 TAGTGGCCCAGGCATTTGCTAGGTGGGCAAAGGAATATAAGGAAGATCAAGAAGATGAAA 1260 Qy 1261 GGCCACTAGGACTACGAGATAGACAGTTAGTCATGGGGTGTTGTTGGGCTTTTAGAAGGC 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GGCCACTAGGACTACGAGATAGACAGTTAGTCATGGGGTGTTGTTGGGCTTTTAGAAGGC 1320 Qy 1321 ACAAGATAACATCTATTTATAAGCGCCCGGATACCCAAACCATCATCAAAGTGAACAGCG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 ACAAGATAACATCTATTTATAAGCGCCCGGATACCCAAACCATCATCAAAGTGAACAGCG 1380 Qy 1381 ATTTCCACTCATTCGTGCTGCCCAGGATAGGCAGTAACACATTGGAGATCGGGCTGAGAA 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 ATTTCCACTCATTCGTGCTGCCCAGGATAGGCAGTAACACATTGGAGATCGGGCTGAGAA 1440 Qy 1441 CAAGAATCAGGAAAATGTTAGAGGAGCACAAGGAGCCGTCACCTCTCATTACCGCCGAGG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 CAAGAATCAGGAAAATGTTAGAGGAGCACAAGGAGCCGTCACCTCTCATTACCGCCGAGG 1500 Qy 1501 ACGTACAAGAAGCTAAGTGCGCAGCCGATGAGGCTAAGGAGGTGCGTGAAGCCGAGGAGT 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 ACGTACAAGAAGCTAAGTGCGCAGCCGATGAGGCTAAGGAGGTGCGTGAAGCCGAGGAGT 1560 Qy 1561 TGCGCGCAGCTCTACCACCTTTGGCAGCTGATGTTGAGGAGCCCACTCTGGAAGCCGATG 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||| || || | Db 1561 TGCGCGCAGCTCTACCACCTTTGGCAGCTGATGTTGAGGAGCCCACTCTGGAGGCAGACG 1620 Qy 1621 TCGACTTGATGTTACAAGAGGCTGGGGCCGGCTCAGTGGAGACACCTCGTGGCTTGATAA 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 TCGACTTGATGTTACAAGAGGCTGGGGCCGGCTCAGTGGAGACACCTCGTGGCTTGATAA 1680 Qy 1681 AGGTTACCAGCTACGATGGCGAGGACAAGATCGGCTCTTACGCTGTGCTTTCTCCGCAGG 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 AGGTTACCAGCTACGATGGCGAGGACAAGATCGGCTCTTACGCTGTGCTTTCTCCGCAGG 1740 Qy 1741 CTGTACTCAAGAGTGAAAAATTATCTTGCATCCACCCTCTCGCTGAACAAGTCATAGTGA 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 CTGTACTCAAGAGTGAAAAATTATCTTGCATCCACCCTCTCGCTGAACAAGTCATAGTGA 1800 Qy 1801 TAACACACTCTGGCCGAAAAGGGCGTTATGCCGTGGAACCATACCATGGTAAAGTAGTGG 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 TAACACACTCTGGCCGAAAAGGGCGTTATGCCGTGGAACCATACCATGGTAAAGTAGTGG 1860 Qy 1861 TGCCAGAGGGACATGCAATACCCGTCCAGGACTTTCAAGCTCTGAGTGAAAGTGCCACCA 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 TGCCAGAGGGACATGCAATACCCGTCCAGGACTTTCAAGCTCTGAGTGAAAGTGCCACCA 1920 Qy 1921 TTGTGTACAACGAACGTGAGTTCGTAAACAGGTACCTGCACCATATTGCCACACATGGAG 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 TTGTGTACAACGAACGTGAGTTCGTAAACAGGTACCTGCACCATATTGCCACACATGGAG 1980 Qy 1981 GAGCGCTGAACACTGATGAAGAATATTACAAAACTGTCAAGCCCAGCGAGCACGACGGCG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 GAGCGCTGAACACTGATGAAGAATATTACAAAACTGTCAAGCCCAGCGAGCACGACGGCG 2040 Qy 2041 AATACCTGTACGACATCGACAGGAAACAGTGCGTCAAGAAAGAACTAGTCACTGGGCTAG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 AATACCTGTACGACATCGACAGGAAACAGTGCGTCAAGAAAGAACTAGTCACTGGGCTAG 2100 Qy 2101 GGCTCACAGGCGAGCTGGTGGATCCTCCCTTCCATGAATTCGCCTACGAGAGTCTGAGAA 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 GGCTCACAGGCGAGCTGGTGGATCCTCCCTTCCATGAATTCGCCTACGAGAGTCTGAGAA 2160 Qy 2161 CACGACCAGCCGCTCCTTACCAAGTACCAACCATAGGGGTGTATGGCGTGCCAGGATCAG 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 CACGACCAGCCGCTCCTTACCAAGTACCAACCATAGGGGTGTATGGCGTGCCAGGATCAG 2220 Qy 2221 GCAAGTCTGGCATCATTAAAAGCGCAGTCACCAAAAAAGATCTAGTGGTGAGCGCCAAGA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 GCAAGTCTGGCATCATTAAAAGCGCAGTCACCAAAAAAGATCTAGTGGTGAGCGCCAAGA 2280 Qy 2281 AAGAAAACTGTGCAGAAATTATAAGGGACGTCAAGAAAATGAAAGGGCTGGACGTCAATG 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2281 AAGAAAACTGTGCAGAAATTATAAGGGACGTCAAGAAAATGAAAGGGCTGGACGTCAATG 2340 Qy 2341 CCAGAACTGTGGACTCAGTGCTCTTGAATGGATGCAAACACCCCGTAGAGACCCTGTATA 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2341 CCAGAACTGTGGACTCAGTGCTCTTGAATGGATGCAAACACCCCGTAGAGACCCTGTATA 2400 Qy 2401 TTGACGAAGCTTTTGCTTGTCATGCAGGTACTCTCAGAGCGCTCATAGCCATTATAAGAC 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2401 TTGACGAAGCTTTTGCTTGTCATGCAGGTACTCTCAGAGCGCTCATAGCCATTATAAGAC 2460 Qy 2461 CTAAAAAGGCAGTGCTCTGCGGGGATCCCAAACAGTGCGGTTTTTTTAACATGATGTGCC 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2461 CTAAAAAGGCAGTGCTCTGCGGGGATCCCAAACAGTGCGGTTTTTTTAACATGATGTGCC 2520 Qy 2521 TGAAAGTGCATTTTAACCACGAGATTTGCACACAAGTCTTCCACAAAAGCATCTCTCGCC 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2521 TGAAAGTGCATTTTAACCACGAGATTTGCACACAAGTCTTCCACAAAAGCATCTCTCGCC 2580 Qy 2581 GTTGCACTAAATCTGTGACTTCGGTCGTCTCAACCTTGTTTTACGACAAAAAAATGAGAA 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2581 GTTGCACTAAATCTGTGACTTCGGTCGTCTCAACCTTGTTTTACGACAAAAAAATGAGAA 2640 Qy 2641 CGACGAATCCGAAAGAGACTAAGATTGTGATTGACACTACCGGCAGTACCAAACCTAAGC 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2641 CGACGAATCCGAAAGAGACTAAGATTGTGATTGACACTACCGGCAGTACCAAACCTAAGC 2700 Qy 2701 AGGACGATCTCATTCTCACTTGTTTCAGAGGGTGGGTGAAGCAGTTGCAAATAGATTACA 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2701 AGGACGATCTCATTCTCACTTGTTTCAGAGGGTGGGTGAAGCAGTTGCAAATAGATTACA 2760 Qy 2761 AAGGCAACGAAATAATGACGGCAGCTGCCTCTCAAGGGCTGACCCGTAAAGGTGTGTATG 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2761 AAGGCAACGAAATAATGACGGCAGCTGCCTCTCAAGGGCTGACCCGTAAAGGTGTGTATG 2820 Qy 2821 CCGTTCGGTACAAGGTGAATGAAAATCCTCTGTACGCACCCACCTCAGAACATGTGAACG 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2821 CCGTTCGGTACAAGGTGAATGAAAATCCTCTGTACGCACCCACCTCAGAACATGTGAACG 2880 Qy 2881 TCCTACTGACCCGCACGGAGGACCGCATCGTGTGGAAAACACTAGCCGGCGACCCATGGA 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2881 TCCTACTGACCCGCACGGAGGACCGCATCGTGTGGAAAACACTAGCCGGCGACCCATGGA 2940 Qy 2941 TAAAAACACTGACTGCCAAGTACCCTGGGAATTTCACTGCCACGATAGAGGAGTGGCAAG 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2941 TAAAAACACTGACTGCCAAGTACCCTGGGAATTTCACTGCCACGATAGAGGAGTGGCAAG 3000 Qy 3001 CAGAGCATGATGCCATCATGAGGCACATCTTGGAGAGACCGGACCCTACCGACGTCTTCC 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3001 CAGAGCATGATGCCATCATGAGGCACATCTTGGAGAGACCGGACCCTACCGACGTCTTCC 3060 Qy 3061 AGAATAAGGCAAACGTGTGTTGGGCCAAGGCTTTAGTGCCGGTGCTGAAGACCGCTGGCA 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3061 AGAATAAGGCAAACGTGTGTTGGGCCAAGGCTTTAGTGCCGGTGCTGAAGACCGCTGGCA 3120 Qy 3121 TAGACATGACCACTGAACAATGGAACACTGTGGATTATTTTGAAACGGACAAAGCTCACT 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3121 TAGACATGACCACTGAACAATGGAACACTGTGGATTATTTTGAAACGGACAAAGCTCACT 3180 Qy 3181 CAGCAGAGATAGTATTGAACCAACTATGCGTGAGGTTCTTTGGACTCGATCTGGACTCCG 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3181 CAGCAGAGATAGTATTGAACCAACTATGCGTGAGGTTCTTTGGACTCGATCTGGACTCCG 3240 Qy 3241 GTCTATTTTCTGCACCCACTGTTCCGTTATCCATTAGGAATAATCACTGGGATAACTCCC 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3241 GTCTATTTTCTGCACCCACTGTTCCGTTATCCATTAGGAATAATCACTGGGATAACTCCC 3300 Qy 3301 CGTCGCCTAACATGTACGGGCTGAATAAAGAAGTGGTCCGTCAGCTCTCTCGCAGGTACC 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3301 CGTCGCCTAACATGTACGGGCTGAATAAAGAAGTGGTCCGTCAGCTCTCTCGCAGGTACC 3360 Qy 3361 CACAACTGCCTCGGGCAGTTGCCACTGGAAGAGTCTATGACATGAACACTGGTACACTGC 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3361 CACAACTGCCTCGGGCAGTTGCCACTGGAAGAGTCTATGACATGAACACTGGTACACTGC 3420 Qy 3421 GCAATTATGATCCGCGCATAAACCTAGTACCTGTAAACAGAAGACTGCCTCATGCTTTAG 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3421 GCAATTATGATCCGCGCATAAACCTAGTACCTGTAAACAGAAGACTGCCTCATGCTTTAG 3480 Qy 3481 TCCTCCACCATAATGAACACCCACAGAGTGACTTTTCTTCATTCGTCAGCAAATTGAAGG 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3481 TCCTCCACCATAATGAACACCCACAGAGTGACTTTTCTTCATTCGTCAGCAAATTGAAGG 3540 Qy 3541 GCAGAACTGTCCTGGTGGTCGGGGAAAAGTTGTCCGTCCCAGGCAAAATGGTTGACTGGT 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3541 GCAGAACTGTCCTGGTGGTCGGGGAAAAGTTGTCCGTCCCAGGCAAAATGGTTGACTGGT 3600 Qy 3601 TGTCAGACCGGCCTGAGGCTACCTTCAGAGCTCGGCTGGATTTAGGCATCCCAGGTGATG 3660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3601 TGTCAGACCGGCCTGAGGCTACCTTCAGAGCTCGGCTGGATTTAGGCATCCCAGGTGATG 3660 Qy 3661 TGCCCAAATATGACATAATATTTGTTAATGTGAGGACCCCATATAAATACCATCACTATC 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3661 TGCCCAAATATGACATAATATTTGTTAATGTGAGGACCCCATATAAATACCATCACTATC 3720 Qy 3721 AGCAGTGTGAAGACCATGCCATTAAGCTTAGCATGTTGACCAAGAAAGCTTGTCTGCATC 3780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3721 AGCAGTGTGAAGACCATGCCATTAAGCTTAGCATGTTGACCAAGAAAGCTTGTCTGCATC 3780 Qy 3781 TGAATCCCGGCGGAACCTGTGTCAGCATAGGTTATGGTTACGCTGACAGGGCCAGCGAAA 3840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3781 TGAATCCCGGCGGAACCTGTGTCAGCATAGGTTATGGTTACGCTGACAGGGCCAGCGAAA 3840 Qy 3841 GCATCATTGGTGCTATAGCGCGGCAGTTCAAGTTTTCCCGGGTATGCAAACCGAAATCCT 3900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3841 GCATCATTGGTGCTATAGCGCGGCAGTTCAAGTTTTCCCGGGTATGCAAACCGAAATCCT 3900 Qy 3901 CACTTGAAGAGACGGAAGTTCTGTTTGTATTCATTGGGTACGATCGCAAGGCCCGTACGC 3960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3901 CACTTGAAGAGACGGAAGTTCTGTTTGTATTCATTGGGTACGATCGCAAGGCCCGTACGC 3960 Qy 3961 ACAATCCTTACAAGCTTTCATCAACCTTGACCAACATTTATACAGGTTCCAGACTCCACG 4020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3961 ACAATCCTTACAAGCTTTCATCAACCTTGACCAACATTTATACAGGTTCCAGACTCCACG 4020 Qy 4021 AAGCCGGATGTGCACCCTCATATCATGTGGTGCGAGGGGATATTGCCACGGCCACCGAAG 4080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4021 AAGCCGGATGTGCACCCTCATATCATGTGGTGCGAGGGGATATTGCCACGGCCACCGAAG 4080 Qy 4081 GAGTGATTATAAATGCTGCTAACAGCAAAGGACAACCTGGCGGAGGGGTGTGCGGAGCGC 4140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4081 GAGTGATTATAAATGCTGCTAACAGCAAAGGACAACCTGGCGGAGGGGTGTGCGGAGCGC 4140 Qy 4141 TGTATAAGAAATTCCCGGAAAGCTTCGATTTACAGCCGATCGAAGTAGGAAAAGCGCGAC 4200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4141 TGTATAAGAAATTCCCGGAAAGCTTCGATTTACAGCCGATCGAAGTAGGAAAAGCGCGAC 4200 Qy 4201 TGGTCAAAGGTGCAGCTAAACATATCATTCATGCCGTAGGACCAAACTTCAACAAAGTTT 4260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4201 TGGTCAAAGGTGCAGCTAAACATATCATTCATGCCGTAGGACCAAACTTCAACAAAGTTT 4260 Qy 4261 CGGAGGTTGAAGGTGACAAACAGTTGGCAGAGGCTTATGAGTCCATCGCTAAGATTGTCA 4320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4261 CGGAGGTTGAAGGTGACAAACAGTTGGCAGAGGCTTATGAGTCCATCGCTAAGATTGTCA 4320 Qy 4321 ACGATAACAATTACAAGTCAGTAGCGATTCCACTGTTGTCCACCGGCATCTTTTCCGGGA 4380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4321 ACGATAACAATTACAAGTCAGTAGCGATTCCACTGTTGTCCACCGGCATCTTTTCCGGGA 4380 Qy 4381 ACAAAGATCGACTAACCCAATCATTGAACCATTTGCTGACAGCTTTAGACACCACTGATG 4440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4381 ACAAAGATCGACTAACCCAATCATTGAACCATTTGCTGACAGCTTTAGACACCACTGATG 4440 Qy 4441 CAGATGTAGCCATATACTGCAGGGACAAGAAATGGGAAATGACTCTCAAGGAAGCAGTGG 4500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4441 CAGATGTAGCCATATACTGCAGGGACAAGAAATGGGAAATGACTCTCAAGGAAGCAGTGG 4500 Qy 4501 CTAGGAGAGAAGCAGTGGAGGAGATATGCATATCCGACGACTCTTCAGTGACAGAACCTG 4560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4501 CTAGGAGAGAAGCAGTGGAGGAGATATGCATATCCGACGACTCTTCAGTGACAGAACCTG 4560 Qy 4561 ATGCAGAGCTGGTGAGGGTGCATCCGAAGAGTTCTTTGGCTGGAAGGAAGGGCTACAGCA 4620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4561 ATGCAGAGCTGGTGAGGGTGCATCCGAAGAGTTCTTTGGCTGGAAGGAAGGGCTACAGCA 4620 Qy 4621 CAAGCGATGGCAAAACTTTCTCATATTTGGAAGGGACCAAGTTTCACCAGGCGGCCAAGG 4680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4621 CAAGCGATGGCAAAACTTTCTCATATTTGGAAGGGACCAAGTTTCACCAGGCGGCCAAGG 4680 Qy 4681 ATATAGCAGAAATTAATGCCATGTGGCCCGTTGCAACGGAGGCCAATGAGCAGGTATGCA 4740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4681 ATATAGCAGAAATTAATGCCATGTGGCCCGTTGCAACGGAGGCCAATGAGCAGGTATGCA 4740 Qy 4741 TGTATATCCTCGGAGAAAGCATGAGCAGTATTAGGTCGAAATGCCCCGTCGAAGAGTCGG 4800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4741 TGTATATCCTCGGAGAAAGCATGAGCAGTATTAGGTCGAAATGCCCCGTCGAAGAGTCGG 4800 Qy 4801 AAGCCTCCACACCACCTAGCACGCTGCCTTGCTTGTGCATCCATGCCATGACTCCAGAAA 4860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4801 AAGCCTCCACACCACCTAGCACGCTGCCTTGCTTGTGCATCCATGCCATGACTCCAGAAA 4860 Qy 4861 GAGTACAGCGCCTAAAAGCCTCACGTCCAGAACAAATTACTGTGTGCTCATCCTTTCCAT 4920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4861 GAGTACAGCGCCTAAAAGCCTCACGTCCAGAACAAATTACTGTGTGCTCATCCTTTCCAT 4920 Qy 4921 TGCCGAAGTATAGAATCACTGGTGTGCAGAAGATCCAATGCTCCCAGCCTATATTGTTCT 4980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4921 TGCCGAAGTATAGAATCACTGGTGTGCAGAAGATCCAATGCTCCCAGCCTATATTGTTCT 4980 Qy 4981 CACCGAAAGTGCCTGCGTATATTCATCCAAGGAAGTATCTCGTGGAAACACCACCGGTAG 5040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4981 CACCGAAAGTGCCTGCGTATATTCATCCAAGGAAGTATCTCGTGGAAACACCACCGGTAG 5040 Qy 5041 ACGAGACTCCGGAGCCATCGGCAGAGAACCAATCCACAGAGGGGACACCTGAACAACCAC 5100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5041 ACGAGACTCCGGAGCCATCGGCAGAGAACCAATCCACAGAGGGGACACCTGAACAACCAC 5100 Qy 5101 CACTTATAACCGAGGATGAGACCAGGACTAGAACGCCTGAGCCGATCATCATCGAAGAGG 5160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5101 CACTTATAACCGAGGATGAGACCAGGACTAGAACGCCTGAGCCGATCATCATCGAAGAGG 5160 Qy 5161 AAGAAGAGGATAGCATAAGTTTGCTGTCAGATGGCCCGACCCACCAGGTGCTGCAAGTCG 5220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5161 AAGAAGAGGATAGCATAAGTTTGCTGTCAGATGGCCCGACCCACCAGGTGCTGCAAGTCG 5220 Qy 5221 AGGCAGACATTCACGGGCCGCCCTCTGTATCTAGCTCATCCTGGTCCATTCCTCATGCAT 5280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5221 AGGCAGACATTCACGGGCCGCCCTCTGTATCTAGCTCATCCTGGTCCATTCCTCATGCAT 5280 Qy 5281 CCGACTTTGATGTGGACAGTTTATCCATACTTGACACCCTGGAGGGAGCTAGCGTGACCA 5340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5281 CCGACTTTGATGTGGACAGTTTATCCATACTTGACACCCTGGAGGGAGCTAGCGTGACCA 5340 Qy 5341 GCGGGGCAACGTCAGCCGAGACTAACTCTTACTTCGCAAAGAGTATGGAGTTTCTGGCGC 5400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5341 GCGGGGCAACGTCAGCCGAGACTAACTCTTACTTCGCAAAGAGTATGGAGTTTCTGGCGC 5400 Qy 5401 GACCGGTGCCTGCGCCTCGAACAGTATTCAGGAACCCTCCACATCCCGCTCCGCGCACAA 5460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5401 GACCGGTGCCTGCGCCTCGAACAGTATTCAGGAACCCTCCACATCCCGCTCCGCGCACAA 5460 Qy 5461 GAACACCGTCACTTGCACCCAGCAGGGCCTGCTCGAGAACCAGCCTAGTTTCCACCCCGC 5520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5461 GAACACCGTCACTTGCACCCAGCAGGGCCTGCTCGAGAACCAGCCTAGTTTCCACCCCGC 5520 Qy 5521 CAGGCGTGAATAGGGTGATCACTAGAGAGGAGCTCGAGGCGCTTACCCCGTCACGCACTC 5580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5521 CAGGCGTGAATAGGGTGATCACTAGAGAGGAGCTCGAGGCGCTTACCCCGTCACGCACTC 5580 Qy 5581 CTAGCAGGTCGGTCTCGAGAACCAGCCTGGTCTCCAACCCGCCAGGCGTAAATAGGGTGA 5640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5581 CTAGCAGGTCGGTCTCGAGAACCAGCCTGGTCTCCAACCCGCCAGGCGTAAATAGGGTGA 5640 Qy 5641 TTACAAGAGAGGAGTTTGAGGCGTTCGTAGCACAACAACAATGACGGTTTGATGCGGGTG 5700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5641 TTACAAGAGAGGAGTTTGAGGCGTTCGTAGCACAACAACAATGACGGTTTGATGCGGGTG 5700 Qy 5701 CATACATCTTTTCCTCCGACACCGGTCAAGGGCATTTACAACAAAAATCAGTAAGGCAAA 5760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5701 CATACATCTTTTCCTCCGACACCGGTCAAGGGCATTTACAACAAAAATCAGTAAGGCAAA 5760 Qy 5761 CGGTGCTATCCGAAGTGGTGTTGGAGAGGACCGAATTGGAGATTTCGTATGCCCCGCGCC 5820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5761 CGGTGCTATCCGAAGTGGTGTTGGAGAGGACCGAATTGGAGATTTCGTATGCCCCGCGCC 5820 Qy 5821 TCGACCAAGAAAAAGAAGAATTACTACGCAAGAAATTACAGTTAAATCCCACACCTGCTA 5880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5821 TCGACCAAGAAAAAGAAGAATTACTACGCAAGAAATTACAGTTAAATCCCACACCTGCTA 5880 Qy 5881 ACAGAAGCAGATACCAGTCCAGGAAGGTGGAGAACATGAAAGCCATAACAGCTAGACGTA 5940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5881 ACAGAAGCAGATACCAGTCCAGGAAGGTGGAGAACATGAAAGCCATAACAGCTAGACGTA 5940 Qy 5941 TTCTGCAAGGCCTAGGGCATTATTTGAAGGCAGAAGGAAAAGTGGAGTGCTACCGAACCC 6000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 5941 TTCTGCAAGGCCTAGGGCATTATTTGAAGGCAGAAGGAAAAGTGGAGTGCTACCGAACCC 6000 Qy 6001 TGCATCCTGTTCCTTTGTATTCATCTAGTGTGAACCGTGCCTTTTCAAGCCCCAAGGTCG 6060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6001 TGCATCCTGTTCCTTTGTATTCATCTAGTGTGAACCGTGCCTTTTCAAGCCCCAAGGTCG 6060 Qy 6061 CAGTGGAAGCCTGTAACGCCATGTTGAAAGAGAACTTTCCGACTGTGGCTTCTTACTGTA 6120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6061 CAGTGGAAGCCTGTAACGCCATGTTGAAAGAGAACTTTCCGACTGTGGCTTCTTACTGTA 6120 Qy 6121 TTATTCCAGAGTACGATGCCTATTTGGACATGGTTGACGGAGCTTCATGCTGCTTAGACA 6180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6121 TTATTCCAGAGTACGATGCCTATTTGGACATGGTTGACGGAGCTTCATGCTGCTTAGACA 6180 Qy 6181 CTGCCAGTTTTTGCCCTGCAAAGCTGCGCAGCTTTCCAAAGAAACACTCCTATTTGGAAC 6240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6181 CTGCCAGTTTTTGCCCTGCAAAGCTGCGCAGCTTTCCAAAGAAACACTCCTATTTGGAAC 6240 Qy 6241 CCACAATACGATCGGCAGTGCCTTCAGCGATCCAGAACACGCTCCAGAACGTCCTGGCAG 6300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6241 CCACAATACGATCGGCAGTGCCTTCAGCGATCCAGAACACGCTCCAGAACGTCCTGGCAG 6300 Qy 6301 CTGCCACAAAAAGAAATTGCAATGTCACGCAAATGAGAGAATTGCCCGTATTGGATTCGG 6360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6301 CTGCCACAAAAAGAAATTGCAATGTCACGCAAATGAGAGAATTGCCCGTATTGGATTCGG 6360 Qy 6361 CGGCCTTTAATGTGGAATGCTTCAAGAAATATGCGTGTAATAATGAATATTGGGAAACGT 6420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6361 CGGCCTTTAATGTGGAATGCTTCAAGAAATATGCGTGTAATAATGAATATTGGGAAACGT 6420 Qy 6421 TTAAAGAAAACCCCATCAGGCTTACTGAAGAAAACGTGGTAAATTACATTACCAAATTAA 6480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6421 TTAAAGAAAACCCCATCAGGCTTACTGAAGAAAACGTGGTAAATTACATTACCAAATTAA 6480 Qy 6481 AAGGACCAAAAGCTGCTGCTCTTTTTGCGAAGACACATAATTTGAATATGTTGCAGGACA 6540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6481 AAGGACCAAAAGCTGCTGCTCTTTTTGCGAAGACACATAATTTGAATATGTTGCAGGACA 6540 Qy 6541 TACCAATGGACAGGTTTGTAATGGACTTAAAGAGAGACGTGAAAGTGACTCCAGGAACAA 6600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6541 TACCAATGGACAGGTTTGTAATGGACTTAAAGAGAGACGTGAAAGTGACTCCAGGAACAA 6600 Qy 6601 AACATACTGAAGAACGGCCCAAGGTACAGGTGATCCAGGCTGCCGATCCGCTAGCAACAG 6660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6601 AACATACTGAAGAACGGCCCAAGGTACAGGTGATCCAGGCTGCCGATCCGCTAGCAACAG 6660 Qy 6661 CGTATCTGTGCGGAATCCACCGAGAGCTGGTTAGGAGATTAAATGCGGTCCTGCTTCCGA 6720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6661 CGTATCTGTGCGGAATCCACCGAGAGCTGGTTAGGAGATTAAATGCGGTCCTGCTTCCGA 6720 Qy 6721 ACATTCATACACTGTTTGATATGTCGGCTGAAGACTTTGACGCTATTATAGCCGAGCACT 6780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6721 ACATTCATACACTGTTTGATATGTCGGCTGAAGACTTTGACGCTATTATAGCCGAGCACT 6780 Qy 6781 TCCAGCCTGGGGATTGTGTTCTGGAAACTGACATCGCGTCGTTTGATAAAAGTGAGGACG 6840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6781 TCCAGCCTGGGGATTGTGTTCTGGAAACTGACATCGCGTCGTTTGATAAAAGTGAGGACG 6840 Qy 6841 ACGCCATGGCTCTGACCGCGTTAATGATTCTGGAAGACTTAGGTGTGGACGCAGAGCTGT 6900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6841 ACGCCATGGCTCTGACCGCGTTAATGATTCTGGAAGACTTAGGTGTGGACGCAGAGCTGT 6900 Qy 6901 TGACGCTGATTGAGGCGGCTTTCGGCGAAATTTCATCAATACATTTGCCCACTAAAACTA 6960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6901 TGACGCTGATTGAGGCGGCTTTCGGCGAAATTTCATCAATACATTTGCCCACTAAAACTA 6960 Qy 6961 AATTTAAATTCGGAGCCATGATGAAATCTGGAATGTTCCTCACACTGTTTGTGAACACAG 7020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 6961 AATTTAAATTCGGAGCCATGATGAAATCTGGAATGTTCCTCACACTGTTTGTGAACACAG 7020 Qy 7021 TCATTAACATTGTAATCGCAAGCAGAGTGTTGAGAGAACGGCTAACCGGATCACCATGTG 7080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7021 TCATTAACATTGTAATCGCAAGCAGAGTGTTGAGAGAACGGCTAACCGGATCACCATGTG 7080 Qy 7081 CAGCATTCATTGGAGATGACAATATCGTGAAAGGAGTCAAATCGGACAAATTAATGGCAG 7140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7081 CAGCATTCATTGGAGATGACAATATCGTGAAAGGAGTCAAATCGGACAAATTAATGGCAG 7140 Qy 7141 ACAGGTGCGCCACCTGGTTGAATATGGAAGTCAAGATTATAGATGCTGTGGTGGGCGAGA 7200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7141 ACAGGTGCGCCACCTGGTTGAATATGGAAGTCAAGATTATAGATGCTGTGGTGGGCGAGA 7200 Qy 7201 AAGCGCCTTATTTCTGTGGAGGGTTTATTTTGTGTGACTCCGTGACCGGCACAGCGTGCC 7260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7201 AAGCGCCTTATTTCTGTGGAGGGTTTATTTTGTGTGACTCCGTGACCGGCACAGCGTGCC 7260 Qy 7261 GTGTGGCAGACCCCCTAAAAAGGCTGTTTAAGCTTGGCAAACCTCTGGCAGCAGACGATG 7320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7261 GTGTGGCAGACCCCCTAAAAAGGCTGTTTAAGCTTGGCAAACCTCTGGCAGCAGACGATG 7320 Qy 7321 AACATGATGATGACAGGAGAAGGGCATTGCATGAAGAGTCAACACGCTGGAACCGAGTGG 7380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7321 AACATGATGATGACAGGAGAAGGGCATTGCATGAAGAGTCAACACGCTGGAACCGAGTGG 7380 Qy 7381 GTATTCTTTCAGAGCTGTGCAAGGCAGTAGAATCAAGGTATGAAACCGTAGGAACTTCCA 7440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7381 GTATTCTTTCAGAGCTGTGCAAGGCAGTAGAATCAAGGTATGAAACCGTAGGAACTTCCA 7440 Qy 7441 TCATAGTTATGGCCATGACTACTCTAGCTAGCAGTGTTAAATCATTCAGCTACCTGAGAG 7500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7441 TCATAGTTATGGCCATGACTACTCTAGCTAGCAGTGTTAAATCATTCAGCTACCTGAGAG 7500 Qy 7501 GGGCCCCTATAACTCTCTACGGCTAACCTGAATGGACTACGACATAGTCTAGTCCGCCAA 7560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 7501 GGGCCCCTATAACTCTCTACGGCTAACCTGAATGGACTACGACATAGTCTAGTCCGCCAA 7560 Alignment between SEQ ID NO: 18 (Db) and enterovirus D68 strain US/MO/14-18947 partial genome (ncbi.nlm.nih.gov/nuccore/KM851225) (Relevant to instant cl. 35) Result Query No. Score Match Length DB ID Description ---------------------------------------------------------------------------- 1 1609.4 22.0 12956 1 NASEQ2_03052025_113200 c 2 25.8 0.4 12956 1 NASEQ2_03052025_113200 ALIGNMENTS RESULT 1 NASEQ2_03052025_113200 Query Match 22.0%; Score 1609.4; DB 1; Length 12956; Best Local Similarity 76.3%; Matches 1979; Conservative 0; Mismatches 616; Indels 0; Gaps 0; Qy 697 ATGGGAGCTCAGGTTACTAGACAACAAACTGGCACTCATGAAAATGCCAACATTGCCACA 756 ||||| |||||||| || || || ||||| || |||||||||||||||||||| || || Db 7562 ATGGGTGCTCAGGTAACCAGGCAGCAAACCGGTACTCATGAAAATGCCAACATAGCTACT 7621 Qy 757 AATGGATCTCATATCACATACAATCAGATAAACTTTTACAAGGATAGCTATGCGGCTTCA 816 ||||| || ||||| || |||||||| || || || ||||||||||| || || || || Db 7622 AATGGCTCCCATATTACGTACAATCAAATCAATTTCTACAAGGATAGTTACGCTGCGTCC 7681 Qy 817 GCCAGCAAGCAGGATTTTTCACAGGACCCATCAAAATTCACTGAACCAGTAGTGGAAGGT 876 || |||||||| || ||||| || || || || ||||| ||||| ||||| Db 7682 GCTTCTAAGCAGGACTTCAGTCAGGATCCTAGCAAGTTTACGGAACCCGTAGTTGAAGGC 7741 Qy 877 TTAAAAGCAGGGGCGCCAGTTTTGAAATCTCCTAGTGCTGAGGCATGTGGCTACAGTGAT 936 | || |||||||| || || | || || || ||||| ||||| || || ||| ||| Db 7742 CTTAAGGCAGGGGCACCTGTCCTTAAGTCACCGAGTGCGGAGGCTTGCGGTTACTCTGAC 7801 Qy 937 AGAGTATTACAGCTCAAATTAGGAAATTCAGCTATTGTCACCCAGGAAGCAGCGAACTAC 996 ||||| | ||||| || | || || || || || || || |||||||| || ||||| Db 7802 CGAGTACTGCAGCTTAAGCTCGGGAACTCTGCCATAGTTACGCAGGAAGCGGCAAACTAT 7861 Qy 997 TGCTGCGCTTATGGTGAATGGCCCAATTACTTACCAGACCATGAAGCAGTAGCCATTGAT 1056 |||||||| || || || ||||| || ||| | ||||||||||| || || || || || Db 7862 TGCTGCGCGTACGGGGAGTGGCCGAACTACCTGCCAGACCATGAGGCGGTCGCTATAGAC 7921 Qy 1057 AAACCTACACAACCAGAAACTGCTACAGATAGATTCTACACTTTGAAATCAGTCAAATGG 1116 || || |||||||| || || || || ||| | ||||| ||| | ||| || |||||| Db 7922 AAGCCAACACAACCTGAGACAGCCACGGATCGGTTCTATACTCTTAAAAGCGTAAAATGG 7981 Qy 1117 GAAACTGGAAGCACAGGATGGTGGTGGAAACTACCCGATGCACTGAATAATATAGGCATG 1176 || ||||| |||||||||||||||||| || || ||||| || || ||||| || ||| Db 7982 GAGACTGGCTCCACAGGATGGTGGTGGAAGCTCCCAGATGCCCTTAACAATATCGGGATG 8041 Qy 1177 TTTGGACAGAATGTGCAGCATCACTACCTATATAGATCTGGTTTCTTGATTCATGTGCAG 1236 ||||| |||||||| || || || ||||| ||| | ||| ||| | ||||| || ||| Db 8042 TTTGGCCAGAATGTTCAACACCATTACCTGTATCGCAGTGGCTTCCTCATTCACGTCCAG 8101 Qy 1237 TGTAATGCCACAAAATTCCATCAAGGTGCCTTATTAGTGGTAGCAATTCCAGAACATCAG 1296 |||||||||||||| || ||||| || || | | ||||| || || ||||| |||||| Db 8102 TGTAATGCCACAAAGTTTCATCAGGGGGCTCTCCTTGTGGTGGCGATCCCAGAGCATCAG 8161 Qy 1297 AGGGGAGCGCACAACACCAACACTAGCCCAGGGTTTGATGATATAATGAAAGGTGAAGAA 1356 ||||| || || || || || ||||| || || || ||||||||||||||||| || ||| Db 8162 AGGGGTGCACATAATACTAATACTAGTCCTGGTTTCGATGATATAATGAAAGGGGAGGAA 8221 Qy 1357 GGAGGGACCTTCAATCATCCATATGTCCTTGATGATGGAACATCATTGGCTTGTGCGACG 1416 |||||||| || |||||||| |||||||| ||||| || || |||||||| ||||||||| Db 8222 GGAGGGACGTTTAATCATCCTTATGTCCTGGATGACGGGACCTCATTGGCGTGTGCGACG 8281 Qy 1417 ATATTTCCACATCAGTGGATAAATCTGAGAACCAACAATTCAGCAACAATTGTTCTTCCC 1476 || || || || |||||||| ||||| | ||||| || || || || || ||||| Db 8282 ATCTTCCCTCACCAGTGGATTAATCTCCGGACCAATAACAGTGCGACTATCGTACTTCCA 8341 Qy 1477 TGGATGAATGCTGCTCCAATGGATTTCCCACTTAGACATAATCAGTGGACGCTAGCAATA 1536 |||||||| || ||||| |||||||| || || || |||||||||||||| | || || Db 8342 TGGATGAACGCGGCTCCGATGGATTTTCCCCTGAGGCATAATCAGTGGACATTGGCTATT 8401 Qy 1537 ATACCAGTGGTGCCATTAGGCACGCGTACAACATCAAGTATGGTCCCAATAACAGTTTCA 1596 || || || || || | || || | || || ||||| || ||||| || || Db 8402 ATTCCGGTCGTACCCCTGGGTACTAGAACCACTAGCTCAATGGTTCCCATAACTGTATCT 8461 Qy 1597 ATCGCTCCAATGTGTTGTGAGTTTAATGGACTTAGACACGCCATTACTCAAGGTGTCCCA 1656 || || |||||||| ||||| |||||||| || | ||||| || || ||||| || || Db 8462 ATTGCGCCAATGTGCTGTGAATTTAATGGGCTCCGGCACGCTATCACACAAGGCGTTCCT 8521 Qy 1657 ACATACCTTTTACCAGGCTCGGGACAATTCCTAACAACTGATGATCATAGCTCTGCACCA 1716 || || || || |||||||| || || ||||| || |||||||| |||||||| ||||| Db 8522 ACGTATCTCTTGCCAGGCTCAGGTCAGTTCCTCACTACTGATGACCATAGCTCCGCACCT 8581 Qy 1717 GCTCTCCCGTGTTTCAACCCAACTCCAGAAATGCATATCCCAGGGCAGGTCCGTAACATG 1776 || ||||| ||||| |||||||| || || ||||||||||||||||| ||||| |||||| Db 8582 GCCCTCCCCTGTTTTAACCCAACACCCGAGATGCATATCCCAGGGCAAGTCCGAAACATG 8641 Qy 1777 CTAGAAGTGGTCCAAGTGGAATCAATGATGGAGATTAATAACACAGAAAGTGCAGTTGGC 1836 || || || || || || ||||| ||||||||||| ||||||||||| ||||| || || Db 8642 CTTGAGGTTGTTCAGGTAGAATCTATGATGGAGATCAATAACACAGAGAGTGCGGTAGGG 8701 Qy 1837 ATGGAGCGTCTTAAGGTTGATATATCAGCATTGACAGATGTCGATCAATTGTTATTCAAC 1896 |||||||| ||||||||||| || || |||||||| ||||| || ||| | || || ||| Db 8702 ATGGAGCGCCTTAAGGTTGACATCTCCGCATTGACCGATGTTGACCAACTTTTGTTTAAC 8761 Qy 1897 ATTCCACTGGACATACAGTTGGATGGGCCACTTAGAAACACTTTAGTAGGAAACATATCT 1956 ||||| ||||| |||||| | ||||| || | | ||||| || || ||||| || || Db 8762 ATTCCCCTGGATATACAGCTCGATGGCCCCTTGCGGAACACGTTGGTCGGAAATATCTCC 8821 Qy 1957 AGATATTACACTCATTGGTCTGGATCCCTAGAAATGACGTTTATGTTTTGTGGCAGCTTC 2016 || || |||||||||||||| || || |||||||| ||||||||||| ||||| ||| Db 8822 AGGTACTACACTCATTGGTCCGGCAGTCTCGAAATGACATTTATGTTTTGCGGCAGTTTC 8881 Qy 2017 ATGGCAGCGGGAAAATTAATCCTGTGCTATACTCCTCCAGGTGGATCATGCCCGACAACC 2076 ||||||||||| ||| | |||||||| ||||| || ||||| || || || || || Db 8882 ATGGCAGCGGGCAAACTGATCCTGTGTTATACACCCCCAGGCGGTAGTTGTCCAACGACG 8941 Qy 2077 AGAGAGACCGCCATGTTAGGTACACATATTGTTTGGGATTTTGGATTACAATCTAGTGTA 2136 ||||||| || ||| | || |||||||| || ||||||||||| || ||||| || Db 8942 CGAGAGACGGCGATGCTCGGCACACATATAGTGTGGGATTTTGGCTTGCAATCCTCAGTT 9001 Qy 2137 ACCCTGATAATACCTTGGATTAGTGGATCCCACTACAGGATGTTTAATAATGATGCTAAG 2196 ||||| || ||||| ||||| || || ||| || || ||||| || ||||| ||||| Db 9002 ACCCTCATCATACCGTGGATAAGCGGCAGCCATTATAGAATGTTCAACAATGACGCTAAA 9061 Qy 2197 TCAACTAATGCCAACGTTGGCTATGTCACTTGTTTTATGCAGACCAATCTGATAGTCCCT 2256 || || ||||| || || ||||| || || ||||||||||| ||||| || || ||| Db 9062 AGTACGAACGCCAATGTGGGATATGTGACCTGCTTTATGCAGACGAATCTCATCGTACCT 9121 Qy 2257 AGTGAATCCTCTGACACGTGTTCCTTGATAGGGTTCATAGCAGCAAAAGATGATTTCTCC 2316 ||| ||||| ||||| || |||||||| |||||||| ||||| || |||||| Db 9122 TCTGAGTCCTCAGACACATGCAGTTTGATAGGTTTCATAGCCGCAAAGGACGATTTCAGT 9181 Qy 2317 CTCAGATTAATGAGAGACAGCCCTGACATTGGACAACTAGACCATTTACATGCAGCAGAG 2376 || ||| | ||| | ||||| || |||||||| ||||| || || | ||||| || ||| Db 9182 CTTAGACTTATGCGGGACAGTCCGGACATTGGTCAACTGGATCACCTTCATGCTGCGGAG 9241 Qy 2377 GCAGCCTACCAGATCGAGAGCATCATCAAAACAGCGACCGACACTGTGAAAAGTGAGATT 2436 ||||| || |||||||| || || ||||| || |||||||| || || ||||| Db 9242 GCAGCATATCAGATCGAATCAATAATTAAAACTGCTACCGACACAGTCAAGTCCGAGATA 9301 Qy 2437 AATGCTGAACTTGGTGTGGTCCCTAGCTTAAATGCAGTTGAAACAGGTGCAACTTCTAAC 2496 || |||||||| || || ||||| || | |||||||| ||||| || || |||||||| Db 9302 AACGCTGAACTGGGCGTCGTCCCGAGTCTTAATGCAGTGGAAACCGGAGCCACTTCTAAT 9361 Qy 2497 ACTGAACCAGAAGAAGCCATACAAACTCGCACAGTGATAAATCAGCACGGTGTATCCGAG 2556 ||||| ||||||||||| || |||||||| || ||||| || || ||||||||| |||| Db 9362 ACTGAGCCAGAAGAAGCAATTCAAACTCGAACTGTGATCAACCAACACGGTGTAAGCGAG 9421 Qy 2557 ACTCTAGTGGAGAATTTTCTCAGTAGAGCAGCTTTGGTATCAAAGAGAAGTTTTGAATAC 2616 ||| | || || ||||| ||| ||||| || ||||||||||| ||||||||||| || Db 9422 ACTTTGGTAGAAAATTTCCTCTCCAGAGCCGCCTTGGTATCAAAAAGAAGTTTTGAGTAT 9481 Qy 2617 AAAGATCATACTTCGTCTACAGCACGAGCAGACAAGAACTTTTTCAAATGGACAATTAAC 2676 ||||| || || ||||||||||| |||||||||||||| || |||||||| || || Db 9482 AAAGACCACACGAGCTCTACAGCACGCGCAGACAAGAACTTCTTTAAATGGACGATAAAT 9541 Qy 2677 ACCAGATCCTTTGTACAGTTAAGAAGAAAATTAGAATTATTCACATACCTTAGATTTGAT 2736 |||||| ||||||||| | | || ||||| || | ||||||||||| ||||||| Db 9542 ACCAGAAGTTTTGTACAGCTCCGCAGGAAATTGGAGCTCTTCACATACCTCCGATTTGAC 9601 Qy 2737 GCTGAGATCACTATACTCACAACTGTAGCAGTGAATGGTAGTGGTAATAATACATACGTG 2796 || || || || || | || || || || || ||||||||||| ||||| || ||||| Db 9602 GCGGAAATAACAATTTTGACCACAGTTGCGGTTAATGGTAGTGGAAATAACACGTACGTA 9661 Qy 2797 GGTCTTCCTGACTTGACACTTCAAGCAATGTTTGTACCCACTGGTGCTCTTACCCCAGAA 2856 || | ||||| ||||||| || || |||||||| || |||||||| || || || || Db 9662 GGCTTGCCTGATCTGACACTGCAGGCCATGTTTGTCCCTACTGGTGCACTCACTCCGGAG 9721 Qy 2857 AAGCAGGACTCATTCCACTGGCAGTCAGGCAGTAATGCTAGTGTATTCTTTAAAATCTCC 2916 || |||||||| ||||| |||||| || ||||| || ||||| ||||||||| Db 9722 AAACAGGACTCCTTCCATTGGCAGAGCGGGTCAAATGCGTCAGTGTTCTTCAAAATCTCC 9781 Qy 2917 GACCCCCCAGCCAGAATAACCATACCTTTTATGTGCATTAACTCAGCATACTCAGTTTTT 2976 || ||||| || || || || || || |||||||| || || || || |||||| Db 9782 GATCCCCCCGCGAGGATCACTATTCCCTTTATGTGTATAAATAGCGCCTATAGCGTTTTT 9841 Qy 2977 TATGATGGCTTTGCCGGATTTGAGAAAAACGGTCTGTATGGAATAAATCCAGCTGACACT 3036 || |||||||||||||| ||||| || || || |||| || || ||||| || || || Db 9842 TACGATGGCTTTGCCGGCTTTGAAAAGAATGGGTTGTACGGGATTAATCCGGCCGATACG 9901 Qy 3037 ATTGGTAACTTATGTGTTAGAATAGTGAATGAACACCAACCAGTTGGTTTCACAGTGACC 3096 || |||||| | ||||| | ||||| || |||||||| ||||| |||||||| || ||| Db 9902 ATAGGTAACCTGTGTGTACGCATAGTTAACGAACACCAGCCAGTGGGTTTCACTGTAACC 9961 Qy 3097 GTTAGGGTTTACATGAAGCCTAAACACATAAAAGCATGGGCACCACGACCACCACGAACT 3156 ||| | || |||||||| ||||| ||||| || || ||||||||| | ||||| |||| Db 9962 GTTCGAGTGTACATGAAACCTAAGCACATCAAGGCTTGGGCACCAAGGCCACCGAGAACC 10021 Qy 3157 CTGCCATATATGAGTATTGCAAATGCAAATTACAAAGGTAAAGAAAGAGCACCAAATGCG 3216 || ||||| ||||| ||||| ||||||||||| || || ||||| |||||||| || ||| Db 10022 CTCCCATACATGAGCATTGCTAATGCAAATTATAAGGGAAAAGAGAGAGCACCGAACGCG 10081 Qy 3217 CTCAGTGCTATAATTGGCAATAGAGACAGTGTCAAAACCATGCCTCATAATATAGTGAAC 3276 | ||| || || |||||| | ||| ||||| || ||||| ||||||||||| || Db 10082 TTGTCTGCAATTATCGGCAATCGGGACTCAGTCAAGACTATGCCACATAATATAGTCAAT 10141 Qy 3277 ACTGGTCCAGGCTTC 3291 || | || || | Db 10142 ACCTGACCCCTCTCC 10156
Read full office action

Prosecution Timeline

Mar 21, 2024
Application Filed
Oct 31, 2024
Non-Final Rejection mailed — §103, §112
Feb 25, 2025
Response Filed
Mar 20, 2025
Final Rejection mailed — §103, §112
Aug 20, 2025
Request for Continued Examination
Aug 22, 2025
Response after Non-Final Action
Jan 22, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12630839
METHODS AND COMPOSITIONS FOR THE TREATMENT OF FABRY DISEASE
6y 4m to grant Granted May 19, 2026
Patent 12624356
COMPOUNDS AND METHODS FOR MODULATING PLP1
2y 10m to grant Granted May 12, 2026
Patent 12612626
An siRNA compound that inhibits expression of APOC3
3y 10m to grant Granted Apr 28, 2026
Patent 12600967
An siRNA compound that inhibits complement factor B (CFB).
3y 9m to grant Granted Apr 14, 2026
Patent 12570974
OLIGONUCLEOTIDES FOR CONTROLLING TAU SPLICING, AND USES THEREOF
5y 2m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
52%
Grant Probability
99%
With Interview (+63.5%)
3y 6m (~1y 4m remaining)
Median Time to Grant
High
PTA Risk
Based on 66 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month