DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received on 07/03/2024. Claims 1-2, 5, 7-8, 12, 15-16, 20-21, 25, 37-39, 40, 42-43, 45, 48 are currently pending.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. This application is a CON of PCT/US2022/077228 filed on 09/29/2022, claims priority to PRO 63/250,575 filed on 09/30/2021.
Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code on page 25. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-2, 5, 7-8, 12, 15-16, 20-21, 25, 37-39, 40, 42-43, 45, 48 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 1, 7, and 45, it is noted that the claim recites “a polypeptide with factor VIII (FVIII) activity”. This language is considered to be indefinite because the claim recites a functional limitation without specifying which assay, what activity threshold, or what reference standard by which “FVIII activity” is measured and determined as qualifying. FVIII activity is assessed in the art by multiple distinct assay types, e.g., one-stage clotting (aPTT-based), chromogenic substrate, and rotational thromboelastometry (ROTEM), which are known to yield materially different activity values for the same molecule, particularly for bioengineered or sequence-modified FVIII variants, see Peters (J Thromb Haemost. 2013;11(1):132-41; Page 134, left column 3rd-6th ¶; Fig. 3-5, Table 2). Because the metes and bounds of the claim depend on which unspecified assay or threshold is applied, persons having ordinary skill in the art (PHOSITAs) cannot determine with reasonable certainty whether a given variant falls within or outside the claim based on the level of “FVIII activity” measured using a non-standard assay.
Claim 48 recites the limitation “the bleeding disorder…”. There is insufficient antecedent basis for this limitation in the claim. Claim 45, upon which claim 48 depends from, only recites “a subject”. It is unclear whether the subject is required to have a bleeding disorder.
Claims 2, 5, 8, 12, 15-16, 20-21, 25, 37-39, 40, 42-43 are also rejected for depending from a rejected claim 1 or 7 but failing to remedy the indefiniteness therein.
Claim Rejections - 35 USC § 112 Written Description
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-2, 5, 7-8, 12, 15-16, 20-21, 25, 37-39, 40, 42-43, 45, 48 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
The claimed invention directs to nucleic acid molecules encoding polypeptides with Factor VIII (FVIII) activity, genetic cassettes and vectors incorporating said molecules, and methods of increasing FVIII expression in a subject. FVIII and variants are large, multi-domain, structurally complex proteins that rely on correct folding, proper secretion, to exert procoagulant activity. Claims 1 and 7 encompass any nucleic acid molecule having at least 85% (or, further narrowed down in dependent claims, at least 90%) sequence identity to SEQ ID NO: 11, so long as the molecule “encodes a polypeptide with factor VIII (FVIII) activity”. For a sequence of approximately 4800 nucleotides, a 90% identity threshold permits on the order of 400+ nucleotide substitutions distributed across the sequence, defining an exceptionally large genus of variant sequences. Claim 45 encompasses even broader range, reciting at least 80% sequence identity of SEQ ID NO: 11. The claimed product genus relies on a functional limitation, i.e. having FVIII activity, whereas no common structure that underlines the functional limitation is disclosed. In another word, it claims what the product does instead of what the product is.
The specification appears to reduce to practice only the specific sequences of SEQ ID NO: 11 (Page 69, ¶[0283]), delivered via the lentiviral genetic cassette of Examples 1-5 administered in vivo to HemA mice or pigtail macaques (Page 69-72; Page 71, ¶[0288], FIG. 1). The specification provides no data correlating percent sequence identity to retained FVIII activity, no mutagenesis or structure-function mapping identifying which residues or nucleotide positions tolerate substitution, and no guidance enabling a PHOSITA to distinguish, within the claimed identity range, which variants retain function from the wildtype FVIII and which do not.
Regarding the state of the art, it is well established that codon optimization strategies can predictably increase mRNA translation efficiency and expression yield of a given protein. However, expression level is distinct from retention of the specific functional activity of the encoded polypeptide, and the state of the art establishes that this latter property remains unpredictable. Sauna (Nat Rev Genet. 2011 Aug 31;12(10):683-91) teaches that “Synonymous mutations, sometimes called ‘silent’ mutations, are now widely acknowledged to be able to cause changes in protein expression, conformation and function” (Page 683, Abstract, first 3 lines). Sauna further teaches that “Although examples of codon optimization resulting in spectacu-lar increases in protein levels have been published, it is not clear whether this increase is generally true for most genes” and that “some mutations that result … in a disease condition. In addition to generating misfolded proteins that are less active, synonymous substitutions can induce aggregation or present new epitopes on the protein, leading to immunogenicity”, highlighting the unpredictability of codon optimization even for seemingly low percentage sequence identity changes. These are strong evidence that there is a high degree of unpredictability in the art in retaining protein functions based on combinatorial mutations.
The disclosure of insufficient species of a broad genus, the high degree of variation in the art, and the failure to disclose correlation between structure in the specification and the claimed function led to the determination that independent claims 1, 7, 45 are overly broad with insufficient evidence of possession at the time of filing to one skilled in the art. Thus, claims 1, 7, 45 do not meet the written description requirement, and the specification demonstrates a clear lack of possession of the full genus as claimed.
Claims 2, 5, 8, 12, 15-16, 20-21, 25, 37-39, 40, 42-43, 48 are also rejected for depending from the rejected claims 1, 7, 45 and failing to remedy the lack of written description therein.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-2, 5, 7-8, 15-16, 20-21, 25, 37-39, 40, 42-43, 45, 48 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Tan (WO2017136358 A1, published on 08/10/2017).
Tan (2017) teaches an isolated nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide with FVIII activity, wherein the nucleotide sequence comprises a nucleic acid sequence of coFVIII-6-XTEN (SEQ ID NO: 72; FIG. 8C; Page 14, ¶[0085]), wherein a nucleotide sequence encoding an XTEN having 144 amino acid is inserted within the codon-optimized FVIII variant 6 (coFVIII-6) nucleotide sequence. This nucleic acid molecule shares 99% sequence identity with the claimed SEQ ID NO: 11, see alignment below for the only region that differs between the two sequences (Full sequence alignment see the attached NCBI Blast_Nucleotide Sequence_SEQ ID NO 11 vs Tan SEQ ID NO 72.pdf listed in PTO-892): Query: Instant SEQ ID NO: 11; Sbjct: Tan (2017) SEQ ID NO: 72.
PNG
media_image1.png
58
846
media_image1.png
Greyscale
Query 2281 TTCAGCCAGAAC---------ACATCAGAGAGCGCCACCCCTGAAAGTGGTCCCGGGAGC 2331
|||||||||||| |||||||||||||||||||||||||||||||||||||||
Sbjct 2281 TTCAGCCAGAACGGCGCGCCAACATCAGAGAGCGCCACCCCTGAAAGTGGTCCCGGGAGC 2340
Tan further teaches an isolated nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide with FVIII activity, wherein the nucleotide sequence comprises a nucleic acid sequence of coFVIII-6, set forth in SEQ ID NO: 71 (FIG. 1D; Claim 2 (iv)). This nucleic acid molecule shares 100% sequence identity, i.e. identical, with the claimed SEQ ID NO: 14, see alignment (Full sequence alignment see the attached NCBI Blast_Nucleotide Sequence_SEQ ID NO 14 vs Tan SEQ ID NO 71.pdf listed in PTO-892): Query: Instant SEQ ID NO: 14; Sbjct: Tan (2017) SEQ ID NO: 71.
PNG
media_image2.png
99
854
media_image2.png
Greyscale
Regarding claims 1 and 2, Tan (2017) teaches an isolated nucleic acid molecule comprising a nucleotide sequence (SEQ ID NO: 72) encoding a polypeptide with FVIII activity with >99.8% sequence identity of the claimed SEQ ID NO: 11, and 99.8% is > 90% or 85%.
Regarding claim 5, Tan teaches an isolated nucleic acid molecule comprising a nucleotide sequence (SEQ ID NO: 72) encoding a polypeptide with FVIII activity with also >99.8% (4758/4767) sequence identity of the 58-4815 nucleotide of the claimed SEQ ID NO: 11.
Regarding claims 7 and 8, Tan teaches an isolated nucleic acid molecule comprising a nucleotide sequence encoding a polypeptide with FVIII activity, wherein the nucleotide sequence comprises a nucleic acid sequence of SEQ ID NO: 71, which shares 100% sequence identity with the claimed SEQ ID NO: 14, and 100% is > 90% or 85%.
Regarding claim 15, Tan teaches an isolated nucleic acid molecule of claim 1, comprising a genetic cassette expressing a Factor VIII (FVIII) polypeptide comprising: (i) coFVIII-6-XTEN that comprises SEQ ID NO: 72 (Page 16, ¶[0095]), which has >99.8% sequence identity of the claimed SEQ ID NO: 11 based on alignment above; (ii) the disclosure includes expression of a transgene under the
control of a tissue specific promoter and/or enhancer (Page 98, ¶[0313]); (iii) transcription termination sequence will usually be located 3' to the coding sequence (Page 20, ¶[0107]).
Regarding claim 16, Tan further includes “… liver specific promoters include, but are not limited to, a mouse thyretin promoter (mTTR)” (Page 98, ¶[0313]).
Regarding claims 20 and 21, Tan further teaches mTTR enhancer in an example of a lentiviral vector plasmid (FIG.5; Page 13, ¶[0082]).
Regarding claim 25, Tan further teaches the isolated nucleic acid molecule of claim 15 (see above), further comprising:
(a) a polypurine track (PPT) on page 107 ¶[0345];
(b) a human CMV promoter region sequence in FIG. 9, a lentiviral vector plasmid map featuring a equal length (4824) codon-optimized variant of coFVIII-6-XTEN, coFVIII-52-XTEN, however the plasmid backbone contains the CMV promoter (CMVpr), as evidenced by Lionnet (Genome Biol. 2010;11(8):129; Page 2, left column, 2nd ¶, line 13), as equal length variants, both lentiviral vectors (LV) are mentioned in the specification (LV-coFVIII-6-XTEN on page 16, ¶[0095], and page 143, ¶[0462] Example 9), the LV vector is the same for direct comparisons (Pages 140, Example 6, ¶[0456], “Codon optimized FVIII variants were cloned into lentiviral plasmids, as illustrated in FIG. 9”; Page 141, Table 7).
(c) a 5' long terminal repeat (LTR) sequence, labeled RU5 in FIG. 9, as evidenced by Vink (Mol Ther. 2017;25(8):1790-1804; Page 1793, Fig. 2 legends, “RU5, R and U5 components of HIV-1 LTR”);
(d) a stem loop 4 sequence, labeled as SL4 in FIG. 9, as evidenced by Kerwood (Biochemistry. 2001 Dec 4;40(48):14518-29; Page 14518, Abstract, line 1) “stem-loop 4 (SL4) from the HIV-1 major packaging domain”;
(e) a primer binding site for SL123, labeled as PBS SL123 in FIG. 9, as evidenced by Kim (PLoS One. 2012;7(11):e50148; Page 7, right column, 2nd ¶, line 12);
The recitation “and/or” is interpreted as that the ensuing feature/element is not required.
Regarding claim 37, Tan further teaches the isolated nucleic acid molecule of claim 15 (see above), wherein the genetic cassette comprises, from 5’ to 3’:
(a) a 5' long terminal repeat (LTR) sequence, labeled RU5 in FIG. 9, as evidenced by Vink (Mol Ther. 2017;25(8):1790-1804; Page 1793, Fig. 2 legends, “RU5, R and U5 components of HIV-1 LTR”);
(b) a liver-specific modified mouse transthyretin (mTTR) promoter (FIG. 9);
(c) a nucleotide sequence encoding a FVIII protein comprising a nucleic acid sequence having at least 85% sequence identity to SEQ ID NO: 11, an equal length (4824nt) codon-optimized variant of coFVIII-52-XTEN, coFVIII-6-XTEN, set forth in SEQ ID NO: 72, which has >99.8% sequence identity with the claimed SEQ ID NO: 11 (see alignment above), the LV vector is the same for direct comparisons between these equal length codon-optimized variants (Pages 140, Example 6, ¶[0456], “Codon optimized FVIII variants were cloned into lentiviral plasmids, as illustrated in FIG. 9”; Page 141, Table 7).
(d) a 3' LTR sequence, based on the recitation “the vector includes a lentiviral vector which comprises a deletion of the U3 region of the 3' LTR. The deletion of the U3 region can be the complete deletion or a partial deletion” (Page 107, ¶[0343]), i.e. the “dR3RU5” refers to the self-inactivating (SIN) 3’ LTR between the WPREmut and SV40pA elements in FIG. 9, as evidenced by the “ΔU3R-U5” element in the same location in Vink (2017; see full citation above; Fig. 1).
Regarding claim 38, Tan further teaches a lentiviral vector comprising the isolated nucleic acid molecule of claim 1 in the recited LV-coFVIII-6-XTEN (Page 16, ¶[0095]; page 143, ¶[0462] Example 9).
Regarding claim 39, Tan further teaches host cells comprising the isolated nucleic acid molecule of claim 1 or a vector comprising the isolated nucleic acid molecule of claim 1 (see claim 1 teaching above) in claim 11 (Page 150).
Regarding claim 40, Tan further teaches polypeptide produced by the host cell of claim 11, i.e. the instant claim 1 (see teachings above regarding claim 39).
Regarding claim 42 and 43, Tan further teaches, under the section “Pharmaceutical Composition” on page 118, Tan recites “Compositions containing an isolated nucleic acid molecule, a polypeptide having FVIII activity encoded by the nucleic acid molecule, a vector, or a host cell of the present disclosure can contain a suitable pharmaceutically acceptable carrier” (¶[0383]).
Regarding claim 45, Tan further teaches “a method of increasing expression of a polypeptide with FVIII activity in a subject comprising administering the isolated nucleic acid molecule of any one of claims 1 to 8 or the vector of claim 9 or 10 to a subject in need thereof…” (Claim 14), and claim 2(iv) encompasses SEQ ID NO: 71, which has 100% sequence identity of the claimed SEQ ID NO: 14, see alignment above.
Regarding claim 48, with the interpretation that it claims a method of treating a subject having a bleeding disorder by increasing expression of a polypeptide with FVIII activity in said subject, Tan further teaches “treating a bleeding disorder comprising: administering to a subject in need thereof a nucleic acid molecule of any one of claims 1 to 8, the vector of claim 9 or 10” (Claim 15), encompassing SEQ ID NO: 71, which has 100% sequence identity of the claimed SEQ ID NO: 14, see alignment above, “wherein the bleeding disorder is hemophilia A” (Page 11, ¶[0069]).
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 7 and 12 are rejected under 35 U.S.C. 103 as being unpatentable over Tan (WO2017136358 A1, published on 08/10/2017; Cited on IDS filed on 08/15/2026), in view of Rossignoli (US20210214689A1, published on 07/15/2021).
Tan’s teachings have been discussed above as applied to claims 1-2, 5, 7-8, 15-16, 20-21, 25, 37-39, 40, 42-43, 45, 48. Tan further teaches vector elements, a synthetic ET promoter, set forth in SEQ ID NO: 69 (Page 14, ¶[0088], last line; FIG. 11Y), designed to enhance the expression of an isolated nucleic acid molecule of claim 1, comprising polypeptide with FVIII activity, i.e. coFVIII-6-XTEN that comprises SEQ ID NO: 72 (Page 16, ¶[0095]), which has >99.8% sequence identity of the claimed SEQ ID NO: 11 based on alignment above. Tan further teaches the relative positions of the ET promoter and the transgene by reciting that the “ET promoter, which is positioned upstream of the coFVIII-52 translation start site and which comprises a synthetic enhancer, an mTTR enhancer, and an mTTR promoter” (Page 13, ¶[0082]). This teaching leads to the elemental design that places the ET promoter sequence immediately 5’ to the TSS of the isolated nucleic acid molecule of claim 1, i.e. SEQ ID NO: 72 of Tan.
Tan does not teach the backbone of the lentiviral vector that encompasses the regulatory elements comprised in the claimed SEQ ID NO: 16.
However, Rossignoli (2021) teaches several lentiviral expression vectors that share the same lentiviral backbone across vectors with sequences set forth in SEQ ID NOs: 1, 4, 7 (1-5197nt, 6297-8242nt of SEQ ID NO: 1 is shared by all 3 vectors, see alignment file NCBI Blast_Nucleotide Sequence 17263953 SEQ ID NO 4, 7 vs 1.pdf attached and listed in PTO-892), see graphic summary below, and These vectors all share the same regulatory elements and vector backbone sequences.
PNG
media_image3.png
166
1085
media_image3.png
Greyscale
Given that the ET promoter sequence is taught to be placed immediately 5’ to the isolated nucleic acid molecule set forth in SEQ ID NO: 72 by Tan (Page 13, ¶[0082]), this transgene insert can combined with the regulatory sequences outside the transgene insert of 5198-6296nt of the vector set forth in SEQ ID NO: 1 of Rossignoli, i.e. 1-5197nt and 6297-8242nt part of SEQ ID NO: 1 of Rossignoli, and would have formed a functional composite lentiviral vector plasmid. Such a vector, comprising an isolated nucleic acid molecule, would have comprised the following sequence:
5’-[1-5197nt of SEQ ID NO: 1 of Rossignoli]-[1-577 of SEQ ID NO: 69 of Tan]-[1-4824nt of SEQ ID NO: 72 of Tan]-[ 6297-8242nt of SEQ ID NO: 1 of Rossignoli]-3’, forming a full size Prior Art Composite Vector (PACV) of 12544nt total plasmid sequence.
Based on NCBI BLAST alignment (See the attached NCBI Blast_Nucleotide Sequence SEQ ID NO 16 vs Prior Art Composite Vector.pdf listed on PTO-892), the full length sequence of SEQ ID NO: 16 is considered for the alignment calculation of sequence identity to the total region of PACV from 2217nt to 10580nt, a 8364nt total length of PACV that aligns with the 7769nt of SEQ ID NO: 16, in at least one embodiment of sequence identity calculation methods under the broadest reasonable interpretation, the sequence identity is (7769-7mismatches)/8364=92.8%.
Regarding claim 7 and 12, it would have been obvious to PHOSITAs before the effective filing date of the claimed invention to have combined the transgene insert of Tan, from 5’ to 3’, an ET promoter, set forth in SEQ ID NO: 69 of Tan, followed by a sequence encoding a polypeptide with FVIII activity, set forth in SEQ ID NO: 72 of Tan, with the backbone of a known lentiviral vector, taught by Rossignoli in SEQ ID NO: 1, to form a fully functional lentiviral vector for enhanced expression of a polypeptide with FVIII activity. It would have merely amounted to a simple combination of prior art elements according to known methods to yield predictable results. One would have been motivated to do so because Tan teaches that the ET promoter and the codon optimized FVIII variant sequence in lentiviral expression vectors led to expression of polypeptides with high FVIII activities in Hemophilia A model mice in vivo (Pages 139-143, Examples 3-9). One would have reasonable expectation of success because Rossignoli describes successful transgene expression in cell models using various transgenes inserted in the same vector backbone (Pages 5-10, Examples 1-3). As the sequence alignment discussed above, the result of the simple combination of the transgene insert of Tan with the lentiviral vector backbone of Rossignoli would have led to the creation of a PACV vector comprising an isolated nucleic acid molecule encoding a polypeptide with FVIII activity, which shares a 92.8% sequence identity with SEQ ID NO: 16. Since 92.8% is > 90% > 85% as claimed in claims 7 and 12, respectively, PHOSITAs would have arrived at the claimed inventions via a simple combination of Tan and Rossignoli.
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Delphinus D. Yu whose telephone number (571) 272-1576. The examiner can normally be reached Mon-Thr 7:30am to 4:30pm Fri 10am to 2pm ET.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil P Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/DELPHINUS DOU YI YU/Examiner, Art Unit 1636
/NEIL P HAMMELL/Supervisory Patent Examiner, Art Unit 1636
Prosecution Insights