Prosecution Insights
Last updated: October 04, 2026
Application No. 18/623,512

GENETICALLY ENHANCED MAIZE PLANTS

Non-Final OA §102§112§DOUBLEPATENT
Filed
Apr 01, 2024
Priority
Sep 28, 2020 — provisional 63/084,170 +2 more
Examiner
IBRAHIM, MEDINA AHMED
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Inari Agriculture Technology Inc.
OA Round
1 (Non-Final)
87%
Grant Probability
Favorable
1-2
OA Rounds
0m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 87% — above average
87%
Career Allowance Rate
1281 granted / 1466 resolved
+27.4% vs TC avg
Moderate +12% lift
Without
With
+12.2%
Interview Lift
resolved cases with interview
Typical timeline
2y 2m
Avg Prosecution
30 currently pending
Career history
1496
Total Applications
across all art units

Statute-Specific Performance

§101
8.0%
-32.0% vs TC avg
§103
14.2%
-25.8% vs TC avg
§102
15.1%
-24.9% vs TC avg
§112
52.2%
+12.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 1466 resolved cases

Office Action

§102 §112 §DOUBLEPATENT
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions Applicant’s election without traverse of Group I, claims 1-10, 12-14, 17, 20, 22 and 27-30, and the species of SEQ ID NO: 461 encoding SEQ ID NO: 462 in the reply filed 03/12/2026, and the election of species SEQ ID NO: 517 encoding SEQ ID NO:518 in the supplemental response of 04/01/2026 are acknowledged. Claims 1-10, 12-14, 17, 20, 22, and 27-30, are pending. Claims 1-10, 12-14, 17, 20, 22 and 27-30, drawn to SEQ ID NO: 461 (first gene) and 517 (second gene) encoding the polypeptide sequence of SEQ ID NO: 462 and 518, respectively, are examined. Copending Applications Applicants must bring to the attention of the Examiner, or other Office official involved with the examination of a particular application, information within their knowledge as to other copending United States applications, which are "material to patentability" of the application in question. MPEP 2001.06(b). See Dayco Products Inc. v. Total Containment Inc., 66 USPQ2d 1801 (CA FC 2003). Improper Markush Grouping Rejection Claims 4-5 and 9-10 are rejected on the basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117. The Markush grouping of the sequences of SEQ ID NO:433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 597, 1007, 1031, 1033, 1035, 1037, 1039, or 1041; 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, 599; 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 643, 645, 647, 649, 651, 653, 655, 657, 659, 661, 663, 665, 451, 667, 669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 1024, 1026, 1028, 1043, or 1045; is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: each polynucleotide sequence is disclosed by specific sequence identifier, showing structural differences. The polynucleotides/encoded polypeptides do not share a substantial structural feature and a common use that flows from the substantial structural feature. Further, the sequences of SEQ ID NO:433, 435, 437, 439, 441, 443, 445, 447, 449, 451, 453, 455, 457, 459, 461, 463, 465, 467, 469, 471, 473, 475, 477, 479, 481, 483, 485, 487, 489, 491, 493, 597, 1007, 1031, 1033, 1035, 1037, 1039, and 1041 are genes associated with abiotic stress tolerance. The sequences of SEQ ID NO: 497, 499, 501, 503, 505, 507, 509, 511, 513, 515, 517, 519, 521, 523, 525, 527, 529, 531, 533, 535, 537, 539, 541, 543, 545, 547, 549, 551, 553, 555, 557, 559, 561, 563, 565, 567, 569, 571, 573, 575, 577, 579, 581, 583, 585, 587, 589, 591, 593, 595, 597, and 599 are genes associated with improved architecture trait. The sequences of SEQ ID NO: 601, 603, 605, 607, 609, 611, 613, 615, 617, 619, 621, 623, 625, 627, 629, 631, 633, 635, 637, 639, 643, 645, 647, 649, 651, and 653 are genes associated with an improved biotic stress tolerance. The sequences of SEQ ID NO: 655, 657, 659, 661, 663, are 665 are genes associated with an improved photosynthesis trait. The sequences of 451, 667, 669, 671, 673, 675, 677, 679, 681, 683, 685, 687, 689, 691, 693, 695, 697, 699, 701, 703, 705, 707, 709, 711, 713, 715, 717, 719, 721, 723, 725, 727, 729, 731, 733, 735, 737, 739, 741, 743, 745, 747, 749, 751, 753, 755, 757, 759, 1024, 1026, 1028, 1043, and 1045 are genes associated with an improved resource partitioning trait. To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use. Claim Rejections - 35 USC § 112 The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 1-10, 12-14, 17, 20, 22 and 27-30 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. The claims are drawn to a modified Zea sp. plant comprising at least one targeted modification in a first and/or second gene resulting in an increase in expression of the first gene relative to a first reference plant lacking the modification, wherein the targeted modification comprises an insertion of a transcription enhancing polynucleotide in the first and/or second gene such that the modified first gene contains the polynucleotide sequence of SEQ ID NO: 1030, wherein the increase of expression in the first and/or second gene is associated with an improvement in an agronomically relevant trait relative to the first reference plant lacking the modification, wherein the agronomically relevant trait is improved abiotic stress tolerance, improved architecture trait. Improved biotic stress tolerance, improved photosynthesis trait, an improved resource partitioning trait, improved nutrient use efficiency, or improved senescence, wherein the promoter of the modified first and/or second gene contains the polynucleotide sequence of SEQ ID NO: 1030, wherein the polynucleotide sequence of SEQ ID NO: 1030 is located about 10, 20, 30, or 40 base pairs (bp) to about 100, 240, 300, 400, 500, 1000, 2000, 3000, or 5000 bp of the transcriptional start site of the first gene; said plant wherein the first gene is gene associated with an improved abiotic stress tolerance that comprises a DNA sequence that is at least 60% identical to SEQ ID NO: 461 or encodes a polypeptide that is at least 60% identical to SEQ ID NO: 462; and wherein the second gene is a gene associated with an improved architecture trait and that comprises a DNA sequence that is at least 60% identical to SEQ ID NO: 517 or encodes a polypeptide that is at least 60% identical to SEQ ID NO: 518 . The claims are also drawn to a method of plant or seed production by introducing a transgene conferring the desired trait into said plant. These are genus claims. The specification describes a modified Zea sp. plant comprising a targeted modification in a first gene and second gene by insertion of the polynucleotide sequence of SEQ ID NO: 1030 in the regulatory region of each of said first and second gene, wherein the first gene comprises the DNA sequence of SEQ ID NO: 461 or a DNA sequence encoding SEQ ID NO: 462 (as the elected species ), and the second gene comprising the DNA sequence of SEQ ID NO: 517 or a DNA sequence encoding SEQ ID NO: 518 (as the elected species). The specification , however, fails to describe where and how to modify SEQ ID NO: 461 or 517 to obtain DNA sequences having 60% identity to SEQ ID NO: 461 or SEQ ID NO: 517, DNA sequences encoding polypeptide sequences having 60% identity to SEQ ID NO: 462 or 518 and that retain associated trait, i.e., improved abiotic stress tolerance or improved architecture trait, respectively. MPEP 2163 and related case laws state that the written description requirement may be satisfied through sufficient description of a representative number of species by disclosing relevant and identifying characteristics such as structural or other physical and/or chemical properties, by disclosing functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the invention as claimed. See E/i Lilly,119 F.3d at 1568, 43 USPQ2d at 1406. The Federal Circuit court stated that a written description of an invention "requires a precise definition, such as by structure, formula [or} chemical name, of the claimed subject matter sufficient to distinguish it from other material". University of California v. Eli Lilly and Co., 43 USPQ2d 1398 (Fed. Cir. 1997). The court also stated "naming a type of material generally known to exist, in the absence of knowledge as to what that material consists of is not a description of that material". Id. Further, the court stated that to adequately describe a claimed genus, Applicant must describe a representative number of the species of the claimed genus, and that one of skill in the art should be able to "visualize or recognize the identity of members of the genus". Id. Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406; Amgen, Inc. v. Chugai Pharm., 927 F.2d 1200, 1206, 18 USPQ2d 1016, 1021 (Fed. Cir. 1991) (one must define a compound by "whatever characteristics sufficiently distinguish it"). In the instant case, there is no structure associated with function recited with regard to the members of the genus of polypeptides and the encoding polynucleotides and the specification fails to provide any polypeptide structure having at least 60% identity to SEQ ID NO: 462 or 518 and having associated function. No information beyond the structure of the gene comprising the DNA sequence of SEQ ID NO: 461 and 507 (as the elected species). The genus of polynucleotides and encodes polypeptides having sequences with 60% identity to SEQ ID NO: 461, 517 and 462, 518 recited in the claims are extremely large, structurally and functional variable genus. The specification fails to describe where and how to modify SEQ ID NO: 461 or 517 to obtain DNA sequences having 60% identity to SEQ ID NO: 461 or SEQ ID NO: 517, DNA sequences encoding polypeptide sequences having 60% identity to SEQ ID NO: 462 or 518 and that retain the associated function. The state of the prior art is that making substitutions of amino acids in a protein produces unpredictable results. For example, Hill et al (Functional analysis of conserved histidines in ADP-glucose pyrophosphorylase from Escherichia coli. Biochem. Biophys. Res. Comm. 244:573-577, 1998) indicates that ADP-glucose pyrophosphorylase activity across several species can be unaffected or significantly affected depending on the position and the change of particular amino acid(s). If the three His are substituted with the "nonconservative" amino acid glutamine, there is little effect on enzyme activity. But if ONE of the His is substituted with a "conservative" amino acid arginine, the ADP-glucose pyrophosphorylase activity is drastically reduced (page 574, Table 1). For another example, Guo et al (Protein tolerance to random amino acid change, Proc. Natl. Acad. Sci. USA 101:9205-9210, 2004) shows that proteins are fairly tolerant to mutations resulting in single amino acid changes, but not to number of substitutions additively that leads to inactivity (page 9209, right column, 2nd paragraph). The specification has not described a representative number of species of nucleic acid and polypeptide sequences of the genus recited in the claims. A substantial variation in structures and in function are expected among the nucleic acid and polypeptide sequences having at least 60%identity to SEQ ID NO: 461-462 and 517-518. The specification describes a modified Zea sp. plant comprising modified first and second genes comprising the DNA sequence of SEQ ID NO: 461 and 517 (as the elected species) with insertion of the transcription enhancing polynucleotide sequence of SEQ ID NO: 1030 that increased expression of the first and second genes and methods of producing Zea sp. plants/seeds by selfing or crossing said modified Zea sp. plants with second Zea sp. plants lacking the modified genes. Furthermore, the specification fails to describe structural features common to members of the claimed genus of polynucleotide/polypeptide sequences having at least 60% identity to SEQ ID NO: 461-462 and 517-518. Therefore, the specification has not met either of the two elements of the written description requirement as set forth in the court's decision in Eli Lilly, and has not shown her/his possession of the claimed genus at the time of the application. Since the specification fails to adequacy describe the polynucleotide/polypeptide sequences sequences as broadly claimed, plants comprising said sequences, and methods that employ with said plants or sequences are similarly not described. Therefore, the specification fails to sufficiently describe the claimed invention in such full, clear, concise, and exact terms that a skilled artisan would recognize that Applicant was in possession of the invention as broadly claimed at the time of filing. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-3, 6-8, and 12, 14, 17, 20, 22 and 27-30 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 9-13, 20, and 26 of U.S. Patent No. 11,198,885 (Applicant’s IDS). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of both the instant application and issued patent are drawn to maize plant or plant part, seed, a tissue culture comprising the polynucleotide or transcription increasing element (SEQ ID NO: 1030 in the instant claims; and SEQ ID NO: 3 in the issued patent) in a promoter to increase expression of an encoding gene/polynucleotide; a method of growing said maize plant having the expression/transcription increasing element, wherein the expression of the encoding polynucleotide is increased as compared to a plant lacking the expression/transcription enhancing element. In addition to the wording used in the claims, the only other difference between the instant claims and the claims of the issued is that the transcription/expression enhancing polynucleotide is identified as SEQ ID NO: 1030 in the instant claims and as SEQ ID NO: 3 in the issued patent. Further, since the instant claims are broadly drawn to a Zea sp. and the claims of the issued patent recite maize, the claims of instant application define genus encompassing the species of the issued patent claims. Claims 1-3, 6-8, 12-14, 17, 20, 22 and 27-30 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 9-13, 20, and 26 of U.S. Patent No. 11,976, 291 (Applicant’s IDS). Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of both the instant application and issued patent are drawn to maize plant or plant part, seed, a tissue culture comprising the polynucleotide or transcription increasing element (SEQ ID NO: 1030 in a promoter to increase expression of an encoding gene/polynucleotide; a method of growing said maize plant having the expression/transcription increasing element, wherein the expression of the encoding polynucleotide is increased as compared to a plant lacking the expression/transcription enhancer element. Therefore, the claims of the instant application and the claims of the issued patent are obvious each other. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 12-14 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Chomet et al (US 8,895,818 B2). The claims are drawn to a modified Zea sp. cell obtained from the modified Zea sp. plant with an improved trait and comprising increased expression of a targeted gene comprising an insertion of the transcription enhancing polynucleotide of SEQ ID NO: 1030, seed, a tissue culture from the modified Ze asp. cell. The claims do not recite the modified cell, the seed, or the tissue culture retain SEQ ID NO: 1030 in the targeted gene. Chomet et al teach a transformed corn plant comprising a DNA construct for increased yield and herbicide resistance in the corn plant as compared to a control plant that does not contain, and plant cell, tissue culture and seed thereof. Since the claimed modified Zea sp cell, part or seed, tissue culture do not necessarily retain SEQ ID NO: 1030 in the targeted gene, the claims read on the prior art maize plant, plant cell, tissue culture and seed thereof. The following amendment would obviate the art rejection: At claim 12, it is suggested that ---, wherein the modified Zea sp. cell comprises the transcription enhancing polynucleotide of SEQ ID NO: 1030----. At claim 14, it is suggested that ---, wherein the plant part or seed comprises the transcription enhancing polynucleotide of SEQ ID NO: 1030----. Pertinent References The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Guo et al (US PAT. No. 7, 550, 575) teach a gene comprising the DNA sequence encoding SEQ ID NO: 462 of the instant claims. Flavell et al ( US PAT. No. 11, 603, 536 teach the SEQ ID NO: 461 and 517 of the claims. See the alignment of sequences shown below: A DNA encoding SEQ ID NO: 462. RESULT 1 US-11-692-977-44 (NOTE: this sequence has 3 duplicates in the database searched) Sequence 44, US/11692977 Patent No. 7550575 GENERAL INFORMATION APPLICANT: Guo, Mei APPLICANT: Rupe, Mary APPLICANT: Bruce, Wesley APPLICANT: Gupta, Rajeev APPLICANT: Simmons, Carl TITLE OF INVENTION: Maize Genes For Controlling Plant Growth TITLE OF INVENTION: And Organ Size And Their Use In Improving Crop Plants PRIOR FILING DATE: 2006-03-31 NUMBER OF SEQ ID NOS: 71 SEQ ID NO 44 LENGTH: 357 TYPE: DNA ORGANISM: Zea mays Length: 357 Score: 592.00 Matches: 118 Percent Similarity: 100.0% Conservative: 0 Best Local Similarity: 100.0% Mismatches: 0 Query Match: 100.0% Indels: 0 Gaps: 0 US-18-623-512A-462 (1-118) x US-11-692-977-44 (1-357) Qy 1 MetMetLeuHisCysThrPheAlaIleSerGluAlaProAlaArgAlaLeuAlaLeuGly 20 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGATGCTGCACTGCACATTTGCTATATCTGAGGCTCCTGCGCGCGCCTTGGCCCTTGGC 60 Qy 21 GlnValSerValMetArgAlaMetProGlnGluGluGluAlaAlaValAlaThrThrThr 40 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CAGGTGTCTGTCATGCGGGCGATGCCGCAGGAAGAAGAAGCCGCGGTGGCGACGACGACC 120 Qy 41 MetAlaGlyGlyLysValAlaAlaLeuLeuAlaThrAlaAlaAlaLeuLeuLeuLeuLeu 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 ATGGCCGGGGGCAAGGTGGCGGCGCTGCTGGCCACGGCGGCCGCGCTGCTGCTGCTGCTC 180 Qy 61 ProLeuAlaLeuProProLeuProProProProThrGlnLeuLeuPheValProValVal 80 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 CCGCTGGCGCTGCCGCCGCTGCCGCCGCCGCCCACGCAGCTGTTGTTCGTCCCCGTGGTC 240 Qy 81 LeuLeuLeuLeuValAlaSerLeuAlaPheCysProAlaAlaThrSerSerProSerPro 100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TTGCTGCTCCTCGTGGCGTCCCTCGCGTTCTGCCCCGCCGCGACCTCCTCGCCGTCGCCG 300 Qy 101 MetHisAlaAlaAspHisGlySerPheGlyThrThrGlySerProHisLeuCys 118 |||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 ATGCATGCCGCCGACCACGGGTCGTTCGGGACCACTGGATCACCGCACCTATGT 354 The DNA sequence of SEQ ID NO: 461 RESULT 1 US-16-146-871-461 (NOTE: this sequence has 1 duplicate in the database searched) Sequence 461, US/16146871 Patent No. 11603536 GENERAL INFORMATION APPLICANT: Inari Agriculture, Inc. APPLICANT: Flavell, Richard Bailey APPLICANT: Niu, Yajie APPLICANT: Nuccio, Michael Lee APPLICANT: Shultz, Randall William APPLICANT: Sosso, Davide APPLICANT: Unson, Maria Margarita D. APPLICANT: Casey, John P. Jr. APPLICANT: Martin, Barry Andrew TITLE OF INVENTION: NOVEL MAIZE CELLS AND MAIZE PLANTS FILE REFERENCE: 10008US1 / 33864-41259US CURRENT APPLICATION NUMBER: US/16/146,871 CURRENT FILING DATE: 2018-09-28 PRIOR APPLICATION NUMBER: US 62/566,180 PRIOR FILING DATE: 2017-09-29 NUMBER OF SEQ ID NOS: 1023 SEQ ID NO 461 LENGTH: 2667 TYPE: DNA ORGANISM: Zea mays Query Match 100.0%; Score 2667; Length 2667; Best Local Similarity 100.0%; Matches 2667; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 TTGCACTGTTTGTACAGTGAAGTTTTAAATAAAGAGTAAGATAGGAAGTGAGATAAAGAG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 TTGCACTGTTTGTACAGTGAAGTTTTAAATAAAGAGTAAGATAGGAAGTGAGATAAAGAG 60 Qy 61 TATTCTGGAGATAGTCTTATACATCACCGTAGCAACGCATGAATATATACCTAGTTAATA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TATTCTGGAGATAGTCTTATACATCACCGTAGCAACGCATGAATATATACCTAGTTAATA 120 Qy 121 TTATATGATTTAAATTTTATCTTAAAATACTTGACGCTCTATGAGTTTAGTAGTTTATAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TTATATGATTTAAATTTTATCTTAAAATACTTGACGCTCTATGAGTTTAGTAGTTTATAA 180 Qy 181 TACATATTTATCTTCTTCTAATACATGAACATCCTTTTTAGAATACGTCATAGGACGATC 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TACATATTTATCTTCTTCTAATACATGAACATCCTTTTTAGAATACGTCATAGGACGATC 240 Qy 241 ACCGGTACGGAGGATCTAGGCAAACAACATAAGAATCGAGCGAGTGCTAAGAGCATCTCT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 ACCGGTACGGAGGATCTAGGCAAACAACATAAGAATCGAGCGAGTGCTAAGAGCATCTCT 300 Qy 301 AAAAGACTAATAAAATAGCTCGTAAAGTTAAATTTTAGATAATCAAGAGTAAAATAACTA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 AAAAGACTAATAAAATAGCTCGTAAAGTTAAATTTTAGATAATCAAGAGTAAAATAACTA 360 Qy 361 TTCAACAGACTCGCTATTTGGCTCATCAATATACTTTTCAAATTGACTCTCTCACTATTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 TTCAACAGACTCGCTATTTGGCTCATCAATATACTTTTCAAATTGACTCTCTCACTATTT 420 Qy 421 AAACTTGGCTAGCCACTATGACTAACTAAACTAGATAGATATTTTGGTGGAGGAAGATGC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AAACTTGGCTAGCCACTATGACTAACTAAACTAGATAGATATTTTGGTGGAGGAAGATGC 480 Qy 481 TATATATAGAGTGTAATATTTATAAAATGATAAATATAAAGCTAAAAATAAAGAGTTACT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 TATATATAGAGTGTAATATTTATAAAATGATAAATATAAAGCTAAAAATAAAGAGTTACT 540 Qy 541 TCTCTAAGCACGGCTGGATTTCAGGCCTCTAGTCCTCTACTAGTACTAGCTACACGACGT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 TCTCTAAGCACGGCTGGATTTCAGGCCTCTAGTCCTCTACTAGTACTAGCTACACGACGT 600 Qy 601 GCACGCACGCATCACAGCATCAACAACTAGACACGCACACGCTGCACGCGGCCGGGGAAC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 GCACGCACGCATCACAGCATCAACAACTAGACACGCACACGCTGCACGCGGCCGGGGAAC 660 Qy 661 CCACTGATTCCCCCTTCCCCGCGCGCGGTTTGATTTCCTTTCCTGGTACGGATCCATATC 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 CCACTGATTCCCCCTTCCCCGCGCGCGGTTTGATTTCCTTTCCTGGTACGGATCCATATC 720 Qy 721 ATAGTACATAGATCCAGTAGAATAGAAGGTGATCCGACCGCCGGCGCTTGCGTTGTTTTT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 ATAGTACATAGATCCAGTAGAATAGAAGGTGATCCGACCGCCGGCGCTTGCGTTGTTTTT 780 Qy 781 CCCGGTCCATTGAACCTGCCAACCCTCCTAACCACAGGCACGCCAAACCGCGGGCTCCGG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 CCCGGTCCATTGAACCTGCCAACCCTCCTAACCACAGGCACGCCAAACCGCGGGCTCCGG 840 Qy 841 CCACCACCCCCACCACCACCGCCACCTGCCCTGCCGCACCTCTCCAACCCCAAATCCAGG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 CCACCACCCCCACCACCACCGCCACCTGCCCTGCCGCACCTCTCCAACCCCAAATCCAGG 900 Qy 901 GGGGGCACCATGCGTGCATCGATCCATCGCTGGCGCGCGGGTCCGGCGGGGCGGTCTGTG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GGGGGCACCATGCGTGCATCGATCCATCGCTGGCGCGCGGGTCCGGCGGGGCGGTCTGTG 960 Qy 961 AGGGCAAATTTATATAGGTCTAGTGGGTACCCGGCTACGGATAGATATGATGCTGCACTG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 AGGGCAAATTTATATAGGTCTAGTGGGTACCCGGCTACGGATAGATATGATGCTGCACTG 1020 Qy 1021 CACATTTGCTATATCTGAGGCTCCTGCGCGCGCCTTGGCCCTTGGCCAGGTGTCTGTCAT 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 CACATTTGCTATATCTGAGGCTCCTGCGCGCGCCTTGGCCCTTGGCCAGGTGTCTGTCAT 1080 Qy 1081 GCGGGCGATGCCGCAGGAAGAAGAAGCCGCGGTGGCGACGACGACCATGGCCGGGGGCAA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GCGGGCGATGCCGCAGGAAGAAGAAGCCGCGGTGGCGACGACGACCATGGCCGGGGGCAA 1140 Qy 1141 GGTGGCGGCGCTGCTGGCCACGGCGGCCGCGCTGCTGCTGCTGCTCCCGCTGGCGCTGCC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GGTGGCGGCGCTGCTGGCCACGGCGGCCGCGCTGCTGCTGCTGCTCCCGCTGGCGCTGCC 1200 Qy 1201 GCCGCTGCCGCCGCCGCCCACGCAGCTGTTGTTCGTCCCCGTGGTCTTGCTGCTCCTCGT 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 GCCGCTGCCGCCGCCGCCCACGCAGCTGTTGTTCGTCCCCGTGGTCTTGCTGCTCCTCGT 1260 Qy 1261 GGCGTCCCTCGCGTTCTGCCCCGCCGCGACCTCCTCGCCGTCGCCGATGCATGCCGCCGA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 GGCGTCCCTCGCGTTCTGCCCCGCCGCGACCTCCTCGCCGTCGCCGATGCATGCCGCCGA 1320 Qy 1321 CCACGGGTCGTTCGGGACCACTGGATCACCGCACCTATGTTGACGCTGACGATGAGAGGT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CCACGGGTCGTTCGGGACCACTGGATCACCGCACCTATGTTGACGCTGACGATGAGAGGT 1380 Qy 1381 CTCGTCGATCGACGGTCGGCTTGCAATGGCGCGTCGGAATCAAGCAGTTCGCAGTTCGCA 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 CTCGTCGATCGACGGTCGGCTTGCAATGGCGCGTCGGAATCAAGCAGTTCGCAGTTCGCA 1440 Qy 1441 CACGCATGCATATGCCTGACGACGATGCCATGGATCGGAGCGAGGAAAAAAAATGTACAG 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 CACGCATGCATATGCCTGACGACGATGCCATGGATCGGAGCGAGGAAAAAAAATGTACAG 1500 Qy 1501 TACAGGGTAAACTTGCTAGTAGAGTAATTGGATTGCTTAGGCGCTTATAGCTTAGCTGCG 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 TACAGGGTAAACTTGCTAGTAGAGTAATTGGATTGCTTAGGCGCTTATAGCTTAGCTGCG 1560 Qy 1561 GCCTTGTAGCGTGAGTGTGCGTAACAGTGCTCTGGTTCTTTCTTTCCATTCTCATCAGCT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 GCCTTGTAGCGTGAGTGTGCGTAACAGTGCTCTGGTTCTTTCTTTCCATTCTCATCAGCT 1620 Qy 1621 GATTGATCAGCTGACGTACATCATGATTTACTCATCCGGTTCCCTCCTCCTCCTTCGAAT 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 GATTGATCAGCTGACGTACATCATGATTTACTCATCCGGTTCCCTCCTCCTCCTTCGAAT 1680 Qy 1681 TCTCATCATCCGGTGATTCATGGCGAAAGGGGCTCTACCTGTGTTGTTAGATAGTCTAAG 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 TCTCATCATCCGGTGATTCATGGCGAAAGGGGCTCTACCTGTGTTGTTAGATAGTCTAAG 1740 Qy 1741 TAGCACTCGTCACTGGGTTTGACTCCCCATGAGATCAAATTTTAGTTTATGGTTAAAAAA 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 TAGCACTCGTCACTGGGTTTGACTCCCCATGAGATCAAATTTTAGTTTATGGTTAAAAAA 1800 Qy 1801 ATCTCTTCGTTTGTCCCATGCCAAAACACGGGTCTAAGGCTCTGCCTCAGTCGCGGTCGT 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 ATCTCTTCGTTTGTCCCATGCCAAAACACGGGTCTAAGGCTCTGCCTCAGTCGCGGTCGT 1860 Qy 1861 TCTCACATGGTTTTTTATGTCGCTGTGTATGGGTGGACCAGATGCTTAGGGCTTGTTCGG 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 TCTCACATGGTTTTTTATGTCGCTGTGTATGGGTGGACCAGATGCTTAGGGCTTGTTCGG 1920 Qy 1921 TTCTACCCCAATCCATATGGATTGAGGGGGATTGAGGGGGTTTTAATCCATAGTAAGTCA 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 TTCTACCCCAATCCATATGGATTGAGGGGGATTGAGGGGGTTTTAATCCATAGTAAGTCA 1980 Qy 1981 AAATCCCCTCCAATCCGTATCAATCCCCCAATCTATATGGATTGAAAATAACCGAACAAG 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 AAATCCCCTCCAATCCGTATCAATCCCCCAATCTATATGGATTGAAAATAACCGAACAAG 2040 Qy 2041 CCCTTAGGGGTTTTCTCGACCTATGTGAGAAGATCTTCTTAATATAATACTCGAGGGTTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 CCCTTAGGGGTTTTCTCGACCTATGTGAGAAGATCTTCTTAATATAATACTCGAGGGTTG 2100 Qy 2101 TCTTACCCCCGCAGGTCGAGTTTTTTTTATCCAGTGATTCATGCAGCTTGTCGTCGATTC 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 TCTTACCCCCGCAGGTCGAGTTTTTTTTATCCAGTGATTCATGCAGCTTGTCGTCGATTC 2160 Qy 2161 TTTTCCTCACCCATACCATCGGATCACATTGTGTTTTGGGGGAATTTCCTGATTTATATT 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 TTTTCCTCACCCATACCATCGGATCACATTGTGTTTTGGGGGAATTTCCTGATTTATATT 2220 Qy 2221 CCACAAGATGTGTGGGCTGTGTTTCGCCTTAAACTCAAGCATACGGTGCGGCCTTGCACA 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 CCACAAGATGTGTGGGCTGTGTTTCGCCTTAAACTCAAGCATACGGTGCGGCCTTGCACA 2280 Qy 2281 ACCTATTTAACTAGGGTCCGGGTCCGTTGAAGCCTAATGAATAGATGGTTGTAAATACTT 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2281 ACCTATTTAACTAGGGTCCGGGTCCGTTGAAGCCTAATGAATAGATGGTTGTAAATACTT 2340 Qy 2341 TTTTTCCCTGTGACTAAACATTTTTAACGAGACAGTCATAGAATAGCTCAGTTTTATATT 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2341 TTTTTCCCTGTGACTAAACATTTTTAACGAGACAGTCATAGAATAGCTCAGTTTTATATT 2400 Qy 2401 GGTCACATATGTTTTGTACTTTTATTTATGTTTTATTTCATGTGATTTACATTATGACAT 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2401 GGTCACATATGTTTTGTACTTTTATTTATGTTTTATTTCATGTGATTTACATTATGACAT 2460 Qy 2461 TTTGGACTACTCTGGCACACTTAAGTATTTGTGGGGCGTGTCGTGGACCGATGCCTCCGC 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2461 TTTGGACTACTCTGGCACACTTAAGTATTTGTGGGGCGTGTCGTGGACCGATGCCTCCGC 2520 Qy 2521 CCGCAGATTGACACAACACGACCTATAATTAGAGTTGTGCTTTAGTGGGTCGTGCCTTGG 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2521 CCGCAGATTGACACAACACGACCTATAATTAGAGTTGTGCTTTAGTGGGTCGTGCCTTGG 2580 Qy 2581 TGGGTCGTACTTTAATATATCTGGCCGTGTCGGACCGAACCGACCTAGATGTACATGTAT 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2581 TGGGTCGTACTTTAATATATCTGGCCGTGTCGGACCGAACCGACCTAGATGTACATGTAT 2640 Qy 2641 CGGTGCCGTGAGGCAACCCCTTGTCTT 2667 ||||||||||||||||||||||||||| Db 2641 CGGTGCCGTGAGGCAACCCCTTGTCTT 2667 SEQ ID NO: 517 RESULT 1 US-16-146-871-517 (NOTE: this sequence has 1 duplicate in the database searched) Sequence 517, US/16146871 Patent No. 11603536 GENERAL INFORMATION APPLICANT: Inari Agriculture, Inc. APPLICANT: Flavell, Richard Bailey APPLICANT: Niu, Yajie APPLICANT: Nuccio, Michael Lee APPLICANT: Shultz, Randall William APPLICANT: Sosso, Davide APPLICANT: Unson, Maria Margarita D. APPLICANT: Casey, John P. Jr. APPLICANT: Martin, Barry Andrew TITLE OF INVENTION: NOVEL MAIZE CELLS AND MAIZE PLANTS FILE REFERENCE: 10008US1 / 33864-41259US CURRENT APPLICATION NUMBER: US/16/146,871 CURRENT FILING DATE: 2018-09-28 PRIOR APPLICATION NUMBER: US 62/566,180 PRIOR FILING DATE: 2017-09-29 NUMBER OF SEQ ID NOS: 1023 SEQ ID NO 517 LENGTH: 3749 TYPE: DNA ORGANISM: Zea mays Query Match 100.0%; Score 3749; Length 3749; Best Local Similarity 100.0%; Matches 3749; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 AAATTGCATTTAACCTGCTTCAACAAGAGTACTAGATACTCTCCCTGTCAGAAGCAAGTC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 AAATTGCATTTAACCTGCTTCAACAAGAGTACTAGATACTCTCCCTGTCAGAAGCAAGTC 60 Qy 61 TCCCCTTGTAAATGATGTTAAGACGCCATGGCTCACCGCCTTGCTACCCAGTACCCACTA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 TCCCCTTGTAAATGATGTTAAGACGCCATGGCTCACCGCCTTGCTACCCAGTACCCACTA 120 Qy 121 CCCAATCCAGCCACCCAGGCCTTCCTGGTCTAAACTCAAGTAATTCAGCTGTAATTTTTT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CCCAATCCAGCCACCCAGGCCTTCCTGGTCTAAACTCAAGTAATTCAGCTGTAATTTTTT 180 Qy 181 TTCCTATTCTTACTTTGCGACATCTGCAATTTCTGAATTCAAATGAAGAAACAACACCCA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TTCCTATTCTTACTTTGCGACATCTGCAATTTCTGAATTCAAATGAAGAAACAACACCCA 240 Qy 241 TGCAACAAATAGACCACAAAGAAGGCAGTAACTAGTATCGAACTAGCTCAGATTTGAAGT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TGCAACAAATAGACCACAAAGAAGGCAGTAACTAGTATCGAACTAGCTCAGATTTGAAGT 300 Qy 301 ACTTGCACAGAACAAAAGAAAAGGCTCCAGCCATTCCTTCGGTAATAACAGAAGAGTCAT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 ACTTGCACAGAACAAAAGAAAAGGCTCCAGCCATTCCTTCGGTAATAACAGAAGAGTCAT 360 Qy 361 GTCCCTTCCATGACGAGAACTACCTCATCAGCATCAGCTGAAGATTCCACTTATTCATGG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 GTCCCTTCCATGACGAGAACTACCTCATCAGCATCAGCTGAAGATTCCACTTATTCATGG 420 Qy 421 TGTTAATGCACCCAACCTCACAATCACAGCCTTGCAAATGCGACGTGTTTCGTTATTCCT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 TGTTAATGCACCCAACCTCACAATCACAGCCTTGCAAATGCGACGTGTTTCGTTATTCCT 480 Qy 481 ACTGTGATTTATCTGTGATCCCTAGGTTTAAATGGTATAAGTCCATAGATCTTCTGTACA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 ACTGTGATTTATCTGTGATCCCTAGGTTTAAATGGTATAAGTCCATAGATCTTCTGTACA 540 Qy 541 GCATGTGGGTTCTCAACAAGTGGAAATACAGCTCAACGCCAGTGTATGGCGTTTACTTGG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GCATGTGGGTTCTCAACAAGTGGAAATACAGCTCAACGCCAGTGTATGGCGTTTACTTGG 600 Qy 601 AAGAACATGCACTGAGTATGCAGCACAAATTTTCAGACTAGACTAGAAGAGGGAAATGTC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 AAGAACATGCACTGAGTATGCAGCACAAATTTTCAGACTAGACTAGAAGAGGGAAATGTC 660 Qy 661 GAACCTGATATGCTCTTGCAAGGAAAACAAAACGTACTAAAATGCACCTCATTGTTCACA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GAACCTGATATGCTCTTGCAAGGAAAACAAAACGTACTAAAATGCACCTCATTGTTCACA 720 Qy 721 CCACTACAGCTGGTTGCACTAAAGCTGCCAGTGGTTTACATGCTTTTATTACTCCAGCAA 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 CCACTACAGCTGGTTGCACTAAAGCTGCCAGTGGTTTACATGCTTTTATTACTCCAGCAA 780 Qy 781 ACCCCAGCAATGTTAATAACTAAGTTGCTAAAGCATATATGCAACCTGAAACACCACAGA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 ACCCCAGCAATGTTAATAACTAAGTTGCTAAAGCATATATGCAACCTGAAACACCACAGA 840 Qy 841 GATCATGATTTGGCAAAGAAGCACAATTCAGCTATCTGGGTGACGTATGACATGACAATG 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 GATCATGATTTGGCAAAGAAGCACAATTCAGCTATCTGGGTGACGTATGACATGACAATG 900 Qy 901 GTATCTCAAATGCTAGAAGTTGAATAAGACAGCCTTCCTCAACTCCAGTATAAATAGTTC 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 GTATCTCAAATGCTAGAAGTTGAATAAGACAGCCTTCCTCAACTCCAGTATAAATAGTTC 960 Qy 961 ATGCTCAGACTGCAGCTTCCTCAGTCCCATAGGGAGGAAGTTGAGAGTTCTAATAAGAGC 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 ATGCTCAGACTGCAGCTTCCTCAGTCCCATAGGGAGGAAGTTGAGAGTTCTAATAAGAGC 1020 Qy 1021 AACGGCCAATACCATTAGCGAGTTATTTTTCTGCAATATATGTCAGCAACCGATCATTTG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 AACGGCCAATACCATTAGCGAGTTATTTTTCTGCAATATATGTCAGCAACCGATCATTTG 1080 Qy 1081 GTTATGGCTCGTGTCATACAGGATGTATTGGATCCCTTTACACCAACCATTCCACTAAGA 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 GTTATGGCTCGTGTCATACAGGATGTATTGGATCCCTTTACACCAACCATTCCACTAAGA 1140 Qy 1141 ATAACGTACAACAATAGGCTACTTCTGCCAAGTGCTGAGCTAAAGCCATCCGCGGTTGTA 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 ATAACGTACAACAATAGGCTACTTCTGCCAAGTGCTGAGCTAAAGCCATCCGCGGTTGTA 1200 Qy 1201 AGTAAACCACGAGTCGATATCGGTGGCAGTGACATGAGGGCTTTCTACACCCTGGTAAGC 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 AGTAAACCACGAGTCGATATCGGTGGCAGTGACATGAGGGCTTTCTACACCCTGGTAAGC 1260 Qy 1261 CAAGCAATTTACAGATAATGATACCATTTTGGAGAATTTATGCCAATTCATTTGGTATGT 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 CAAGCAATTTACAGATAATGATACCATTTTGGAGAATTTATGCCAATTCATTTGGTATGT 1320 Qy 1321 TACACATAAAAGTATTATGCACTTTGTAATGGATTTATCAATATTAGTTTGAACAAATTT 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 TACACATAAAAGTATTATGCACTTTGTAATGGATTTATCAATATTAGTTTGAACAAATTT 1380 Qy 1381 AATAAGAACAAAATGCCTAAATCTTGCAGTATATAAACATGTATATATGCTAACTTGTTT 1440 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1381 AATAAGAACAAAATGCCTAAATCTTGCAGTATATAAACATGTATATATGCTAACTTGTTT 1440 Qy 1441 GTCTTCGACTTGAAAAGGTACTGATTGACCCGGATGCCCCAAGTCCAAGCCATCCATCAC 1500 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1441 GTCTTCGACTTGAAAAGGTACTGATTGACCCGGATGCCCCAAGTCCAAGCCATCCATCAC 1500 Qy 1501 TAAGGGAGTACTTGCACTGGTAAAAAAAGCGCAATATGTTCCACTTCCTAGATTTGGTTC 1560 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1501 TAAGGGAGTACTTGCACTGGTAAAAAAAGCGCAATATGTTCCACTTCCTAGATTTGGTTC 1560 Qy 1561 TTTTTCGCTTTGCCTTATTATGATATTGGTCCACTATTGTGTAGGATGGTGACAGATATT 1620 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1561 TTTTTCGCTTTGCCTTATTATGATATTGGTCCACTATTGTGTAGGATGGTGACAGATATT 1620 Qy 1621 CCAGAAACAACTAGTGTCAACTTTGGTAAGAATGCATATAGTTATCTGTCATTCCATTGT 1680 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1621 CCAGAAACAACTAGTGTCAACTTTGGTAAGAATGCATATAGTTATCTGTCATTCCATTGT 1680 Qy 1681 GTTTCTGCTGAATATAGTATCTGTGGAGCTTAGGTTGTAGTCTCTTCTTGCTTCTCAGAC 1740 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1681 GTTTCTGCTGAATATAGTATCTGTGGAGCTTAGGTTGTAGTCTCTTCTTGCTTCTCAGAC 1740 Qy 1741 CTATTGGCTACCATTGAACTGATGCAGATAAGGATGCAATTAATACATGAAATCAGCAAC 1800 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1741 CTATTGGCTACCATTGAACTGATGCAGATAAGGATGCAATTAATACATGAAATCAGCAAC 1800 Qy 1801 CATAGGCTGAATGCTAGACCAACTTGTTAGGTGAATGCAATATGGCAGCTTACCGCTTAC 1860 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1801 CATAGGCTGAATGCTAGACCAACTTGTTAGGTGAATGCAATATGGCAGCTTACCGCTTAC 1860 Qy 1861 ATGCATAGTAATATCATGAAATCCACTAACTTAGTACCATAACTAAAGAAGCAATCTGGT 1920 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1861 ATGCATAGTAATATCATGAAATCCACTAACTTAGTACCATAACTAAAGAAGCAATCTGGT 1920 Qy 1921 AGAACTCACTTTCAATCCAGCCCATTACTAGAGACTGGATTATCGATATTAAACACAAAC 1980 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1921 AGAACTCACTTTCAATCCAGCCCATTACTAGAGACTGGATTATCGATATTAAACACAAAC 1980 Qy 1981 AAGTATTTAACAGTGTAATAAACTGGTATACGTATGATTCACAGTGCCCCTGTTTGTTCT 2040 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1981 AAGTATTTAACAGTGTAATAAACTGGTATACGTATGATTCACAGTGCCCCTGTTTGTTCT 2040 Qy 2041 TTAATTGGTTGGTAACCTTGAGGTGTCAATTTCAGCAGAACTAAGGTTCATTTACAGTTG 2100 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2041 TTAATTGGTTGGTAACCTTGAGGTGTCAATTTCAGCAGAACTAAGGTTCATTTACAGTTG 2100 Qy 2101 CCATACTAAAGTTACTCAAGTACACTTTTTAGTTTACATAGTTTTTTCATACTCGATTTT 2160 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2101 CCATACTAAAGTTACTCAAGTACACTTTTTAGTTTACATAGTTTTTTCATACTCGATTTT 2160 Qy 2161 ACCTGAGACTTTGAAACCGATATTGGAAACAAAGCAGCCATTAATTTTGTCAAACAAGAG 2220 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2161 ACCTGAGACTTTGAAACCGATATTGGAAACAAAGCAGCCATTAATTTTGTCAAACAAGAG 2220 Qy 2221 GAGCTATATTTAAAGGCTTCTCTTTGTCTAAATTGAAAGAATTAAAAACAATAAATGACG 2280 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2221 GAGCTATATTTAAAGGCTTCTCTTTGTCTAAATTGAAAGAATTAAAAACAATAAATGACG 2280 Qy 2281 ACGCTTCCACATACTTCAGTGCTCCTTGAACTATTCAGTATATAATGTCAGGATGCTCTC 2340 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2281 ACGCTTCCACATACTTCAGTGCTCCTTGAACTATTCAGTATATAATGTCAGGATGCTCTC 2340 Qy 2341 GCAGGCCAAGAGCTAATATTTTATGAGAGGCCGGACCCAAGATCTGGCATCCACAGGCTG 2400 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2341 GCAGGCCAAGAGCTAATATTTTATGAGAGGCCGGACCCAAGATCTGGCATCCACAGGCTG 2400 Qy 2401 GTATTTGTGCTGTTCCGTCAACTTGGCAGGGGGACAGTTTTTGCACCAGAAATGCGCCAC 2460 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2401 GTATTTGTGCTGTTCCGTCAACTTGGCAGGGGGACAGTTTTTGCACCAGAAATGCGCCAC 2460 Qy 2461 AACTTCAACTGCAGAAGCTTTGCACGGCAATATCACCTCAGCATTGCCACCGCTACATAT 2520 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2461 AACTTCAACTGCAGAAGCTTTGCACGGCAATATCACCTCAGCATTGCCACCGCTACATAT 2520 Qy 2521 TTCAACTGTCAAAGGGAAGGTGGATCCGGCGGAAGAAGGTTTAGGGAAGAGTAGAAACCA 2580 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2521 TTCAACTGTCAAAGGGAAGGTGGATCCGGCGGAAGAAGGTTTAGGGAAGAGTAGAAACCA 2580 Qy 2581 TAGGCCACTGCATGGTCACACTATAGAAATATCATCAATAATGTGCACTATATTGAATCA 2640 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2581 TAGGCCACTGCATGGTCACACTATAGAAATATCATCAATAATGTGCACTATATTGAATCA 2640 Qy 2641 ATGCACCACCTCTATATGCTGAATGTTATGTATCTCAAACTATGATTGTACTGACTTGAA 2700 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2641 ATGCACCACCTCTATATGCTGAATGTTATGTATCTCAAACTATGATTGTACTGACTTGAA 2700 Qy 2701 AGGTTGAGAGCTTAGTCTCTTAGCAGAATATAGCACAATATTACTAGTATGTTCCATGAT 2760 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2701 AGGTTGAGAGCTTAGTCTCTTAGCAGAATATAGCACAATATTACTAGTATGTTCCATGAT 2760 Qy 2761 TAATCAGACAAAGTATTCTCCTTGGAGAAGCAAGTACAGTCTCAGGATCTTACTAGAGTA 2820 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2761 TAATCAGACAAAGTATTCTCCTTGGAGAAGCAAGTACAGTCTCAGGATCTTACTAGAGTA 2820 Qy 2821 CCTGCTTGTTTCAACAGGTATTAAACAAACTCAGCAGTCTGAATTATCCAAAGTATATTT 2880 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2821 CCTGCTTGTTTCAACAGGTATTAAACAAACTCAGCAGTCTGAATTATCCAAAGTATATTT 2880 Qy 2881 CATGGAAAACAATCACAGCATCACATAGTGTATATTATTCCTTGCTCCAATCAGAAGAGC 2940 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2881 CATGGAAAACAATCACAGCATCACATAGTGTATATTATTCCTTGCTCCAATCAGAAGAGC 2940 Qy 2941 ACATTATACCTTATTCACATTCAAAGTATTGTGCCCCAGTTGCTTAGAAAGTAGTCAACA 3000 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2941 ACATTATACCTTATTCACATTCAAAGTATTGTGCCCCAGTTGCTTAGAAAGTAGTCAACA 3000 Qy 3001 AGACGCTATAAAGCATTACAAATTCTCAGAATTAACTTACAGCAGAATCACCTTGGAGAG 3060 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3001 AGACGCTATAAAGCATTACAAATTCTCAGAATTAACTTACAGCAGAATCACCTTGGAGAG 3060 Qy 3061 GAAACTAATCACTTCTTCTCAAGATGGCACACCTCCACCAATTCCCATGACTCCAAGCTT 3120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3061 GAAACTAATCACTTCTTCTCAAGATGGCACACCTCCACCAATTCCCATGACTCCAAGCTT 3120 Qy 3121 ATATCTATGGCATCCTTCTATAAAGCACAAGCTCAGTGATATCAAACTCTATTCCACAGA 3180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3121 ATATCTATGGCATCCTTCTATAAAGCACAAGCTCAGTGATATCAAACTCTATTCCACAGA 3180 Qy 3181 TATCCTTGATCAGCTCATCTATCTTCTTCTTTGCCTCCTCATCAATTCATCATCATCATC 3240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3181 TATCCTTGATCAGCTCATCTATCTTCTTCTTTGCCTCCTCATCAATTCATCATCATCATC 3240 Qy 3241 TGTAAAGTCTCCATATAAGAGTCTGACGTGCGGCAACCAAGTGTCAGTACTAAGTAGTCA 3300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3241 TGTAAAGTCTCCATATAAGAGTCTGACGTGCGGCAACCAAGTGTCAGTACTAAGTAGTCA 3300 Qy 3301 ATAGCATGTGATTTTTCACTCAGGAACAGAATTCAGCTGGTACACTCACGAGTTTTTCTC 3360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3301 ATAGCATGTGATTTTTCACTCAGGAACAGAATTCAGCTGGTACACTCACGAGTTTTTCTC 3360 Qy 3361 CTATAACCGAAGTCGGCACAGCAGTGATCGCTCGCTCCCACCTCCTAACAAAATTCAGAT 3420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3361 CTATAACCGAAGTCGGCACAGCAGTGATCGCTCGCTCCCACCTCCTAACAAAATTCAGAT 3420 Qy 3421 AATTTGATATAAGAGAGCCAAATGATCCCAATGCACAAGCACAATACAATACTGCATCAG 3480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3421 AATTTGATATAAGAGAGCCAAATGATCCCAATGCACAAGCACAATACAATACTGCATCAG 3480 Qy 3481 CATTTCCTCTGGATTTCAAACCTGCTGGAAGTTTGAAACTCGGAGCAAAACAAACTTAAC 3540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3481 CATTTCCTCTGGATTTCAAACCTGCTGGAAGTTTGAAACTCGGAGCAAAACAAACTTAAC 3540 Qy 3541 TACGGAACTAGTACGAGGAGAAGAGATGCTTAACCTCGGGGGTGGGCTCCAGAAGGAGGT 3600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3541 TACGGAACTAGTACGAGGAGAAGAGATGCTTAACCTCGGGGGTGGGCTCCAGAAGGAGGT 3600 Qy 3601 AGACGCACACGCACTGGTAGAAGAAGCTGCCACGGGCAAGCCCCGTAACACGGACTGTGT 3660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3601 AGACGCACACGCACTGGTAGAAGAAGCTGCCACGGGCAAGCCCCGTAACACGGACTGTGT 3660 Qy 3661 AAGGTTGGACGCCGGCGGGGAGTACCTCGACGGCTTCCAAGCGGCTGGAACTGGAAGGCG 3720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3661 AAGGTTGGACGCCGGCGGGGAGTACCTCGACGGCTTCCAAGCGGCTGGAACTGGAAGGCG 3720 Qy 3721 GGGCCGCCCGGCCGACTAACGCCGCACGC 3749 ||||||||||||||||||||||||||||| Db 3721 GGGCCGCCCGGCCGACTAACGCCGCACGC 3749 Conclusion No claim is allowed. Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to MEDINA AHMED IBRAHIM whose telephone number is (571)272-0797. The examiner can normally be reached Monday-Friday, 9:00 - 6:00. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, BRATISLAV STANKOVIC can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. MEDINA AHMED. IBRAHIM Primary Examiner Art Unit 1662 /MEDINA A IBRAHIM/Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Apr 01, 2024
Application Filed
May 27, 2026
Non-Final Rejection mailed — §102, §112, §DOUBLEPATENT (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12721291
Albugo-Candida-Resistant Brassica Oleracea Plants
3y 0m to grant Granted Sep 01, 2026
Patent 12703868
METHODS AND COMPOSITIONS FOR MULTIPLEXED EDITING OF PLANT CELL GENOMES
4y 0m to grant Granted Aug 11, 2026
Patent 12703871
MAIZE EVENT DP-004114-3 AND METHODS FOR DETECTION THEREOF
3y 6m to grant Granted Aug 11, 2026
Patent 12696861
MELON VARIETY NUN 76730 MEM
3y 8m to grant Granted Aug 04, 2026
Patent 12692555
MARKER ASSISTED SELECTION OF TRAITS FOR PRODUCING MEAL FROM BRASSICA NAPUS
3y 1m to grant Granted Jul 28, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
87%
Grant Probability
99%
With Interview (+12.2%)
2y 2m (~0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 1466 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month