Prosecution Insights
Last updated: September 17, 2026
Application No. 18/623,963

THERAPEUTIC USES AND METHODS

Non-Final OA §103§112§DP
Filed
Apr 01, 2024
Priority
May 04, 2018 — AU 2018901531 +2 more
Examiner
ALLEN, SARAH ELIZABETH
Art Unit
Tech Center
Assignee
Antisense Therapeutics Ltd.
OA Round
1 (Non-Final)
58%
Grant Probability
Moderate
1-2
OA Rounds
1y 1m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 58% of resolved cases
58%
Career Allowance Rate
15 granted / 26 resolved
-2.3% vs TC avg
Strong +48% interview lift
Without
With
+47.8%
Interview Lift
resolved cases with interview
Typical timeline
3y 6m
Avg Prosecution
41 currently pending
Career history
86
Total Applications
across all art units

Statute-Specific Performance

§101
6.4%
-33.6% vs TC avg
§103
36.9%
-3.1% vs TC avg
§102
12.5%
-27.5% vs TC avg
§112
26.8%
-13.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 26 resolved cases

Office Action

§103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Claims 3-17 are pending and under consideration. Priority Acknowledgment is made of applicant’s claim for foreign priority under 35 U.S.C. 119 (a)-(d). The certified copy has been filed in parent Application No. 16/404,561, filed on 05/06/2019. The earliest effective filing date to which the instant application is entitled is 05/04/2018. Information Disclosure Statement The information disclosure statement filed 04/01/2024 fails to comply with 37 CFR 1.98(a)(2), which requires a legible copy of each cited foreign patent document; each non-patent literature publication or that portion which caused it to be listed; and all other information or that portion which caused it to be listed. It has been placed in the application file, but the information referred to therein has not been considered, as indicated in the PTO-1449 mailed with this action. Specification The abstract of the disclosure is objected to because the final line of the abstract filed 04/01/2024 includes a typographical error. The final line of the abstract filed 04/01/2024 reads “CD49d ((the alpha 4 chain of VLA-4)” (bolded and underlined emphasis added), which erroneously includes double parentheses. It would be remedial to remove the extra parenthesis. A corrected abstract of the disclosure is required and must be presented on a separate sheet, apart from any other text. See MPEP § 608.01(b). Drawings The drawings are objected to because: 37 CFR 1.84 (u)(1) states “View numbers must be preceded by the abbreviation "FIG."” In the current case, the view numbers for Figures 1-7 are preceded by the word "Figure" instead of the abbreviation "FIG.". It would be remedial to replace “Figure” with “FIG.”, as required by 37 CFR 1.84 (u)(1). Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Nucleotide and/or Amino Acid Sequence Disclosures REQUIREMENTS FOR PATENT APPLICATIONS CONTAINING NUCLEOTIDE AND/OR AMINO ACID SEQUENCE DISCLOSURES Items 1) and 2) provide general guidance related to requirements for sequence disclosures. 37 CFR 1.821(c) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.821(a) must contain a "Sequence Listing," as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.821 - 1.825. This "Sequence Listing" part of the disclosure may be submitted: In accordance with 37 CFR 1.821(c)(1) via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter "Legal Framework") as an ASCII text file, together with an incorporation-by-reference of the material in the ASCII text file in a separate paragraph of the specification as required by 37 CFR 1.823(b)(1) identifying: the name of the ASCII text file; ii) the date of creation; and iii) the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(1) on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation-by-reference of the material in the ASCII text file according to 37 CFR 1.52(e)(8) and 37 CFR 1.823(b)(1) in a separate paragraph of the specification identifying: the name of the ASCII text file; the date of creation; and the size of the ASCII text file in bytes; In accordance with 37 CFR 1.821(c)(2) via the USPTO patent electronic filing system as a PDF file (not recommended); or In accordance with 37 CFR 1.821(c)(3) on physical sheets of paper (not recommended). When a “Sequence Listing” has been submitted as a PDF file as in 1(c) above (37 CFR 1.821(c)(2)) or on physical sheets of paper as in 1(d) above (37 CFR 1.821(c)(3)), 37 CFR 1.821(e)(1) requires a computer readable form (CRF) of the “Sequence Listing” in accordance with the requirements of 37 CFR 1.824. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed via the USPTO patent electronic filing system as a PDF, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the PDF copy and the CRF copy (the ASCII text file copy) are identical. If the "Sequence Listing" required by 37 CFR 1.821(c) is filed on paper or read-only optical disc, then 37 CFR 1.821(e)(1)(ii) or 1.821(e)(2)(ii) requires submission of a statement that the "Sequence Listing" content of the paper or read-only optical disc copy and the CRF are identical. Specific deficiencies and the required response to this Office Action are as follows: Specific deficiency – Nucleotide and/or amino acid sequences appearing in the specification are not identified by sequence identifiers in accordance with 37 CFR 1.821(d). See page 4, line 10; page 6, lines 14 and 34; page 9, line 29; page 10, lines 10 and 26; and page 11, line 16. Additionally, the sequences disclosed at page 13, lines 29-31 of the instant specification are inconsistent with the sequence listing. The instant specification discloses that instant SEQ ID NO: 2 corresponds to ISIS 348574 (ATATTTTTCCACCTGTGCCC; page 54, line 13). This is not consistent with the sequence of the sequence listing, which sets forth that SEQ ID NO: 2 corresponds to ctgagtctgttttccattct. The instant specification further indicates that SEQ ID NO: 1 corresponds to ATL1102. However, instant SEQ ID NO: 1 does not align with ATL1102, as shown in the alignment of the Appendix. Instead, it appears that instant SEQ ID NO: 2 corresponds to ATL1102 rather than instant SEQ ID NO: 1, as shown in the alignment of the Appendix. See section Claim Interpretation for more details. It would be remedial to ensure that the sequence listing is accurate and consistent with the claims. It would be remedial to ensure that the instant sequence listing is consistent with the disclosure of the instant specification, and with the instant claim set. Required response – Applicant must provide: A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3) and 1.125 inserting the required sequence identifiers, consisting of: A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version); A copy of the amended specification without markings (clean version); and A statement that the substitute specification contains no new matter. Claim Interpretation As set forth above (see section Nucleotide and/or Amino Acid Sequence Disclosures), the instant specification indicates that SEQ ID NO: 1 corresponds to ATL1102. However, instant SEQ ID NO: 1 does not align with ATL1102, as shown in the alignment of the Appendix. Instead, it appears that instant SEQ ID NO: 2 corresponds to ATL1102 rather than instant SEQ ID NO: 1, as shown in the alignment of the Appendix. The Examiner notes that the raw sequence of ATL1102 reflected in the alignment of the Appendix does not properly notate the modified residues of ATL1102. As reviewed in Limmroth et al., 2014, the full, properly annotated sequence of ATL1102 is 5’-MeCMeUG AGT MeCTG TTT MeUMeCMeC AMeUMeU MeCMeU -3’, which is identical to the sequence recited at instant claims 3, 16, and 17. Accordingly, art is applied below (see section Claim Rejections - 35 USC § 103) wherein the ATL1102 sequence of Limmroth et al., 2014 is considered to read on the sequence recited at instant claims 3, 16, and 17. Under broadest reasonable interpretation and for purposes of searching the art, this recited sequence is considered to be instant SEQ ID NO: 2 not instant SEQ ID NO: 1 (bolded emphasis added). Claims 3, 16, and 17 are drawn to methods of administering an oligonucleotide comprising the structure set forth above and in the claims, wherein said structure comprises 5 uracil residues designated “MeU.” Per the instant specification, such residues are synthesized using 2’-methoxyethyl modified thymidines not 5-methyluracils (page 33, lines 26-28). Therefore, each “MeU” residue in the oligonucleotides recited in the claims may be interpreted as a thymine (T) residue. Additionally, in the absence of a clearly defined sequence identifier, the Examiner must rely on broadest reasonable interpretation to encompass all possible modifications defined in the sequence listing as well as the sequence(s) recited in the claims themselves. As set forth above, the sequence recited at instant claims 3, 16, and 17 is identical to the ATL1102 sequence (and modifications thereof) disclosed in Limmroth et al., 2014 and therefore ATL1102 is considered to read on the sequence recited at instant claims 3, 16, and 17. Claim Objections Claims 3, 8-11, and 15-17 are objected to because of the following informalities: Claims 3, 16, and 17 are objected to for failing to comply with the Sequence Rules (see above). It would be remedial to insert the appropriate sequence identifier immediately after the recited oligonucleotide structure in each claim. With further regard to claim 3, the recitation of “e.g,” (bolded and underlined emphasis added) in the penultimate line is improper. The proper acronymization is “e.g.”. It would be remedial to amend the instant claim language such that the acronymization is proper. Claim 8 is objected to for reciting the acronym “WFI” without properly defining said acronym prior to its recitation. It would be remedial to amend the instant claim set such that the acronym “WFI” is properly defined prior to its recitation. Claims 9-11 are objected to for reciting the acronym “MD” without properly defining said acronym prior to its recitation. It would be remedial to amend the instant claim set such that the acronym “MD” is properly defined prior to its recitation. With further regard to claim 9, the recitation of “Duchene [sic] muscular dystrophy” is improper, as “Duchene” should be spelled “Duchenne.” It appears that Applicant accidentally incorporated a simple typographical error. It would be remedial to amend the instant claim such that the typographical error is corrected to recite “Duchenne.” With further regard to claim 11, the recitation of “non ambulatory” does not comport with standard grammatical and/or linguistic conventions, which require a dash separating “non” and “ambulatory.” It would be remedial to amend the instant claim to recite “non-ambulatory,” thereby comporting with standard grammatical and/or linguistic conventions. Claim 15 is objected to for reciting “the method of claim 14 wherein corticosteroid is administered at a low dose,” which does not comport with standard grammatical and/or linguistic conventions, as it lacks an article such as “the” preceding “corticosteroid.” For purposes of comporting with standard grammatical and/or linguistic conventions, it would be remedial to amend instant claim 15 to recite, for example “the method of claim 14 wherein the corticosteroid is administered at a low dose” (bolded emphasis added). This is merely an example set forth by the Examiner and is not intended to be limiting. Appropriate correction is required. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 3-15 and 17 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claims 3 (from which claims 4-15 all directly or indirectly depend) and 17, the phrase "such as" renders the claim indefinite because it is unclear whether the limitations following the phrase are part of the claimed invention. None of claims 4-15 resolve the basis of this indefiniteness rejection and therefore they inherit the rejection of instant claim 3. See MPEP § 2173.05(d). It would be remedial to amend the instant claim language to remove the phrase “such as,” thereby rendering the metes and bounds of protection sought by the instant claim set definite, apprising those of ordinary skill in the art of the scope of protection sought. Regarding claim 3 (from which claims 4-15 all directly or indirectly depend), the phrase “e.g.” (taken to mean "for example") renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. None of claims 4-15 resolve the basis of this indefiniteness rejection and therefore they inherit the rejection of instant claim 3. See MPEP § 2173.05(d). It would be remedial to amend the instant claim language to remove the phrase “e.g.,” thereby rendering the metes and bounds of protection sought by the instant claim set definite, apprising those of ordinary skill in the art of the scope of protection sought. Claim 10 (which depends from instant claim 9) recites the limitation "the dystrophin gene" in lines 1-2. There is insufficient antecedent basis for this limitation in the claim. It would be remedial to amend the instant claim language such that there is proper antecedent basis for each and every claim term. The term “low” in claim 15 is a relative term which renders the claim indefinite. The term “low” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The specification indicates that a “low dose” of corticosteroid “includes” doses ranging from 1/5 to 4/5 of “the standard dose.” This definition is not limiting, as the term “standard dose” (from which “low dose is derived) is not given a limiting definition either such that the basis for comparison is unclear. Therefore, one of ordinary skill would not be reasonably apprised by the instant claim language as to the metes and bounds of protection sought. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 3-17 are rejected under 35 U.S.C. 103 as being unpatentable over US 2012/0258093 A1 (hereinafter Butler-Browne; as cited in Applicant IDS) in view of US 2013/0345293 A1 (hereinafter Klinger), as evidenced by Limmroth et al., 2014 (hereinafter Limmroth) and Ramamoorthy and Cidlowski, 2016 (hereinafter Ramamoorthy). With regard to claim 3, which recites “a method for improving muscle performance such as muscle or limb strength or delaying decline in muscle performance such as muscle or limb strength in a subject with muscular dystrophy, the method comprising periodically administering to the subject a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of an oligonucleotide comprising the structure: 5’ – MeCMeUG AGT MeCTG TTT MeUMeCMEC AMeUMeU MeCMeU – 3’ wherein, each of the 19 internucleotide linkages of the oligonucleotide is an O,O-linked phosphorothioate diester; the nucleotides at the positions 1 to 3 from the 5’ end are 2’-O-(2-methoxyethyl) modified ribonucleosides; the nucleotides at the positions 4 to 12 from the 5’ end are 2’-deoxyribonucleosides; the nucleotides at the positions 13 to 20 from the 5’ end are 2’-O-(2-methoxyethyl) modified ribonucleosides; and all cytosines are 5-methylcytosines (MeC), or a pharmaceutically acceptable salt or stereoisomer thereof, for a time and under conditions sufficient to improve muscle performance such as muscle (e.g[.] limb) strength or delay decline in muscle performance such as muscle (e.g. limb) strength),” Butler-Browne discloses a method of treating Duchenne Muscular Dystrophy (DMD) in a patient in need thereof, said method comprising administering to said patient in need thereof an antisense molecule to inhibit expression of a gene encoding an alpha4 integrin subunit (abstract; paragraphs [0043]-[0045]). An inhibitor suited for such applications and disclosed in Butler-Browne is ATL1102 (paragraph [0053]), which comprises the sequence 5’ – MeCMeUG AGT MeCTG TTT MeUMeCMEC AMeUMeU MeCMeU – 3’ (Limmroth: page 1781, column 1, paragraph 2). Thus, ATL1102 of Butler-Browne (and Limmroth) comprises the same sequence as that of the instantly claimed therapeutic oligonucleotide. Limmroth further teaches that ATL1102 comprises phosphorothioate internucleotide linkages and has a 3-9-8, 2’-O-(2-methoxyethyl) gapmer design (page 1781, column 1, paragraph 2), which is identical to the structure recited at b)-d) of instant claim 3. Additionally, Limmroth teaches that all cytosine and uracil bases are 5’ methylated in ATL1102 (page 1781, column 1, paragraph 2), as in e) of instant claim 3. Butler-Browne further discloses that ATL1102 may be administered on a daily basis, and that therapeutically effective amounts include 25, 50, 100, and 250 mg of the active ingredient or salt thereof within a pharmaceutical composition comprising a pharmaceutically acceptable carrier (paragraphs [0059], [0061], and [0063]), thereby treating DMD in a patient in need thereof (abstract). Thus, Butler-Browne discloses the therapeutic utility of ATL1102 in treating DMD, while Limmroth teaches that ATL1102 is identical to the instantly claimed oligonucleotide, with the exception of the O,O-linked phosphorothioate diesters of a) of instant claim 3. This deficiency is cured by Klinger. Klinger discloses an oligonucleotide for the inhibition of alpha4 integrin (as in Butler-Browne), wherein said oligonucleotide is identical to ATL1102 and to the instantly claimed oligonucleotide (paragraphs [0025] and [0274]). Klinger further discloses that the oligonucleotide taught therein comprises 19 internucleotide linkages, wherein said internucleotide linkages are O,O-linked phosphorothioate diesters (paragraph [0027]). Regarding the treatment outcomes recited in the instant claim, it is considered that Butler-Browne and Klinger (as evidenced by Limmroth) collectively disclose the treatment method of instant claim 3, as set forth above. The treatment outcomes from said method are considered to occur inherently upon execution of the method steps. See MPEP § 2112. Thus, it is considered that Butler-Browne, Klinger, and Limmroth collectively disclose each and every limitation of instant claim 3. With regard to claim 4, which recites “the periodic administration [of the method of claim 3] is once or twice or three times per week or fortnight or month,” it is noted that while Butler-Browne discloses that ATL1102 may be administered on a daily basis, and that therapeutically effective amounts include 25, 50, 100, and 250 mg of the active ingredient or salt thereof within a pharmaceutical composition comprising a pharmaceutically acceptable carrier (paragraphs [0059], [0061], and [0063]), thereby treating DMD in a patient in need thereof (abstract), Butler-Browne also discloses that the specific treatment regimen will depend on a number of factors and may be optimized by those of ordinary skill in the art (i.e. physicians) to be within the scope of sound medical judgment (paragraph [0059]). Therefore, it would have been obvious to someone of ordinary skill in the art prior to the effective filing date of the instant invention to have arrived at the claimed administration schedule via practicing routine optimization of adjusting drug administration to patient characteristics, patient needs, and disease progress and intensity, as disclosed in Butler-Browne. With regard to claim 5, which recites “the therapeutically effective mount [of the method of claim 3] is 10mg to 300mg,” as set forth above, Butler-Browne discloses that ATL1102 may be administered on a daily basis, and that therapeutically effective amounts include 25, 50, 100, and 250 mg of the active ingredient or salt thereof within a pharmaceutical composition comprising a pharmaceutically acceptable carrier (paragraphs [0059], [0061], and [0063]), thereby treating DMD in a patient in need thereof (abstract). Thus, Butler-Browne discloses each and every additional limitation of instant claim 4. With regard to claim 6, which recites “the therapeutically effective amount [of the method of claim 3] is selected from the group consisting of 25mg to 50mg, 50mg to 100mg, 100mg to 200 mg and 150mg to 300mg,” as set forth above, Butler-Browne discloses that ATL1102 may be administered on a daily basis, and that therapeutically effective amounts include 25, 50, 100, and 250 mg of the active ingredient or salt thereof within a pharmaceutical composition comprising a pharmaceutically acceptable carrier (paragraphs [0059], [0061], and [0063]), thereby treating DMD in a patient in need thereof (abstract). Thus, Butler-Browne discloses each and every additional limitation of instant claim 6. With regard to claim 7, which recites “the oligonucleotide [of the method of claim 3] is a sodium or potassium salt,” as set forth above Butler-Browne discloses that ATL1102 may be administered on a daily basis, and that therapeutically effective amounts include 25, 50, 100, and 250 mg of the active ingredient or salt thereof within a pharmaceutical composition comprising a pharmaceutically acceptable carrier (paragraphs [0059], [0061], and [0063]), thereby treating DMD in a patient in need thereof (abstract). Butler-Browne further discloses that the pharmaceutical salts comprising the therapeutic oligonucleotide taught therein may be sodium or potassium salts (paragraphs [0063] and [0066]). Thus, Butler-Browne discloses each and every additional limitation of instant claim 7. With regard to claim 8, which recites “the pharmaceutical carrier [of the method of claim 3] is WFI and the composition is adjusted to pH 7.2-7.6,” the Examiner notes that the acronym “WFI” refers to “water for injection.” Butler-Browne discloses that the pharmaceutically acceptable carrier of the therapeutic compositions taught therein may be sterilized water (paragraphs [0063] and [0067]), which reads on the instantly claimed “WFI.” However, Butler-Browne is silent as to the pH of the formulations taught therein. This deficiency is cured by Klinger, which discloses an oligonucleotide for the inhibition of alpha4 integrin (as in Butler-Browne), wherein said oligonucleotide is identical to ATL1102 and to the instantly claimed oligonucleotide (paragraphs [0025] and [0274]), as set forth above. Klinger further discloses that the oligonucleotide taught therein may be formulated in water for injection adjusted to a pH of 7.2-7.6 (paragraph [0144]). Thus, it is considered that Butler-Browne and Klinger collectively disclose each and every additional limitation of instant claim 8. With regard to claim 9, which recites “the MD [muscular dystrophy] is selected from the group consisting of Duchen[n]e muscular dystrophy (DMD)…”, as set forth above, Butler-Browne discloses a method of treating Duchenne Muscular Dystrophy (DMD) in a patient in need thereof, said method comprising administering to said patient in need thereof an antisense molecule to inhibit expression of a gene encoding an alpha4 integrin subunit such as ATL1102 (abstract; paragraphs [0043]-[0045] and [0053]). Thus, Butler-Browne discloses treatment of Duchenne muscular dystrophy, as instantly claimed. Accordingly, Butler-Browne discloses each and every additional limitation of instant claim 9. With regard to claim 10, which recites “the MD [of the method of claim 9] involves a mutation in the dystrophin gene,” as set forth above, Butler-Browne discloses a method of treating Duchenne Muscular Dystrophy (DMD) in a patient in need thereof, said method comprising administering to said patient in need thereof an antisense molecule to inhibit expression of a gene encoding an alpha4 integrin subunit such as ATL1102 (abstract; paragraphs [0043]-[0045] and [0053]). Butler-Browne further discloses that Duchenne muscular dystrophy is caused by mutations or deletions in the dystrophin gene, affecting 1 in 3,500 male births (paragraph [0003]). Thus, Butler-Browne discloses each and every additional limitation of instant claim 10. With regard to claim 11, which recites “the subject [of the method of claim 3] is diagnosed with MD and is ambulatory or non[-]ambulatory,” as set forth above, Butler-Browne discloses a method of treating Duchenne Muscular Dystrophy (DMD) in a patient in need thereof, said method comprising administering to said patient in need thereof an antisense molecule to inhibit expression of a gene encoding an alpha4 integrin subunit such as ATL1102 (abstract; paragraphs [0043]-[0045] and [0053]). Given that a patient diagnosed with DMD may only be ambulatory or non-ambulatory, it is considered that Butler-Browne discloses each and every additional limitation of instant claim 11. With regard to claim 12, which recites “the subject [of the method of claim 11] is a juvenile or pubescent boy of 10 years or older,” Butler-Browne examined patients ranging in age from 5 to 17 years (paragraph [0129]) and discloses that DMD affects 1 in 3,500 male births (paragraph [0003]). Therefore, it would have been obvious to have treated any of the patients in this age range since they were all in need of treatment. Furthermore, given that DMD primarily impacts male patients, it would have been obvious to have specifically treated a male patient in this range, including one of 10 years or older, as instantly claimed. Thus, it is considered that Butler-Browne discloses and/or motivates each and every additional limitation of instant claim 12. With regard to claim 13, which recites “the composition [of the method of claim 3] is administered subcutaneously,” as set forth above, Butler-Browne discloses a method of treating Duchenne Muscular Dystrophy (DMD) in a patient in need thereof, said method comprising administering to said patient in need thereof an antisense molecule to inhibit expression of a gene encoding an alpha4 integrin subunit such as ATL1102 (abstract; paragraphs [0043]-[0045] and [0053]). Butler-Browne further discloses that the therapeutic oligonucleotide taught therein may be administered subcutaneously (paragraphs [0062] and [0070]). Thus, Butler-Browne discloses each and every additional limitation of instant claim 13. With regard to claim 14, which recites “administration [of the method of claim 3] is in combination with corticosteroid treatment,” as set forth above, Butler-Browne discloses a method of treating Duchenne Muscular Dystrophy (DMD) in a patient in need thereof, said method comprising administering to said patient in need thereof an antisense molecule to inhibit expression of a gene encoding an alpha4 integrin subunit such as ATL1102 (abstract; paragraphs [0043]-[0045] and [0053]). Butler-Browne further discloses that treatment of DMD with glucocorticoids can improve overall motor function and is associated with a reduction in the number of inflammatory mononuclear cells (i.e. CD8 T cells) and dendritic cells, with a positive correlation between the reduction in the number of dendritic cells and clinical improvement (paragraph [0005]). Ramamoorthy teaches that glucocorticoids are corticosteroids (Introduction: paragraph 1). Therefore, based on the disclosure of Butler-Browne, one of ordinary skill in the art would have been motivated to further treat DMD patients with both ATL1102 and corticosteroids such as glucocorticoids, as instantly claimed. With regard to claim 15, which recites the “corticosteroid [of the method of claim 14] is administered at a low dose,” as set forth above, based on the disclosure of Butler-Browne, one of ordinary skill in the art would have been motivated to further treat DMD patients with both ATL1102 and corticosteroids such as glucocorticoids, as instantly claimed. Furthermore, as set forth above, one of ordinary skill in the art is capable of arriving at an appropriate dosage based on the characteristics of the patient and the severity of the disease, as disclosed in Butler-Browne (paragraph [0059]). With regard to claim 16, which recites “a method of treating muscular dystrophy in a subject in need thereof, the method comprising periodically administering to the subject a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of an inhibitory oligonucleotide comprising the structure: 5’ – MeCMeUG AGT MeCTG TTT MeUMeCMEC AMeUMeU MeCMeU – 3’ wherein, each of the 19 internucleotide linkages of the oligonucleotide is an O,O-linked phosphorothioate diester; the nucleotides at the positions 1 to 3 from the 5’ end are 2’-O-(2-methoxyethyl) modified ribonucleosides; the nucleotides at the positions 4 to 12 from the 5’ end are 2’-deoxyribonucleosides; the nucleotides at the positions 13 to 20 from the 5’ end are 2’-O-(2-methoxyethyl) modified ribonucleosides; and all cytosines are 5-methylcytosines (MeC), or a pharmaceutically acceptable salt thereof, or stereoisomer thereof, for a time and under conditions sufficient to improve one or more markers, signs or symptoms of muscular dystrophy, or to delay progression of muscular dystrophy in a subject,” Butler-Browne discloses a method of treating Duchenne Muscular Dystrophy (DMD) in a patient in need thereof, said method comprising administering to said patient in need thereof an antisense molecule to inhibit expression of a gene encoding an alpha4 integrin subunit (abstract; paragraphs [0043]-[0045]). An inhibitor suited for such applications and disclosed in Butler-Browne is ATL1102 (paragraph [0053]), which comprises the sequence 5’ – MeCMeUG AGT MeCTG TTT MeUMeCMEC AMeUMeU MeCMeU – 3’ (Limmroth: page 1781, column 1, paragraph 2). Thus, ATL1102 of Butler-Browne (and Limmroth) comprises the same sequence as that of the instantly claimed therapeutic oligonucleotide. Limmroth further teaches that ATL1102 comprises phosphorothioate internucleotide linkages and has a 3-9-8, 2’-O-(2-methoxyethyl) gapmer design (page 1781, column 1, paragraph 2), which is identical to the structure recited at b)-d) of instant claim 3. Additionally, Limmroth teaches that all cytosine and uracil bases are 5’ methylated in ATL1102 (page 1781, column 1, paragraph 2), as in e) of instant claim 16. Butler-Browne further discloses that ATL1102 may be administered on a daily basis, and that therapeutically effective amounts include 25, 50, 100, and 250 mg of the active ingredient or salt thereof within a pharmaceutical composition comprising a pharmaceutically acceptable carrier (paragraphs [0059], [0061], and [0063]), thereby treating DMD in a patient in need thereof (abstract). Thus, Butler-Browne discloses the therapeutic utility of ATL1102 in treating DMD, while Limmroth teaches that ATL1102 is identical to the instantly claimed oligonucleotide, with the exception of the O,O-linked phosphorothioate diesters of a) of instant claim 16. This deficiency is cured by Klinger. Klinger discloses an oligonucleotide for the inhibition of alpha4 integrin (as in Butler-Browne), wherein said oligonucleotide is identical to ATL1102 and to the instantly claimed oligonucleotide (paragraphs [0025] and [0274]). Klinger further discloses that the oligonucleotide taught therein comprises 19 internucleotide linkages, wherein said internucleotide linkages are O,O-linked phosphorothioate diesters (paragraph [0027]). Regarding the treatment outcomes recited in the instant claim, it is considered that Butler-Browne and Klinger (as evidenced by Limmroth) collectively disclose the treatment method of instant claim 16, as set forth above. The treatment outcomes from said method are considered to occur inherently upon execution of the method steps. See MPEP § 2112. Thus, it is considered that Butler-Browne, Klinger, and Limmroth collectively disclose each and every limitation of instant claim 16. With regard to claim 17, which recites “a method for improving muscle function such as limb function or delaying decline in muscle function such as limb function in a subject with muscular dystrophy, the method comprising periodically administering to the subject a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of an oligonucleotide comprising the structure: 5’ – MeCMeUG AGT MeCTG TTT MeUMeCMEC AMeUMeU MeCMeU – 3’ wherein, each of the 19 internucleotide linkages of the oligonucleotide is an O,O-linked phosphorothioate diester; the nucleotides at the positions 1 to 3 from the 5’ end are 2’-O-(2-methoxyethyl) modified ribonucleosides; the nucleotides at the positions 4 to 12 from the 5’ end are 2’-deoxyribonucleosides; the nucleotides at the positions 13 to 20 from the 5’ end are 2’-O-(2-methoxyethyl) modified ribonucleosides; and all cytosines are 5-methylcytosines (MeC), or a pharmaceutically acceptable salt thereof, or stereoisomer thereof, for a time and under conditions sufficient to improve muscle function such as limb function in a subject,” Butler-Browne discloses a method of treating Duchenne Muscular Dystrophy (DMD) in a patient in need thereof, said method comprising administering to said patient in need thereof an antisense molecule to inhibit expression of a gene encoding an alpha4 integrin subunit (abstract; paragraphs [0043]-[0045]). An inhibitor suited for such applications and disclosed in Butler-Browne is ATL1102 (paragraph [0053]), which comprises the sequence 5’ – MeCMeUG AGT MeCTG TTT MeUMeCMEC AMeUMeU MeCMeU – 3’ (Limmroth: page 1781, column 1, paragraph 2). Thus, ATL1102 of Butler-Browne (and Limmroth) comprises the same sequence as that of the instantly claimed therapeutic oligonucleotide. Limmroth further teaches that ATL1102 comprises phosphorothioate internucleotide linkages and has a 3-9-8, 2’-O-(2-methoxyethyl) gapmer design (page 1781, column 1, paragraph 2), which is identical to the structure recited at b)-d) of instant claim 3. Additionally, Limmroth teaches that all cytosine and uracil bases are 5’ methylated in ATL1102 (page 1781, column 1, paragraph 2), as in e) of instant claim 17. Butler-Browne further discloses that ATL1102 may be administered on a daily basis, and that therapeutically effective amounts include 25, 50, 100, and 250 mg of the active ingredient or salt thereof within a pharmaceutical composition comprising a pharmaceutically acceptable carrier (paragraphs [0059], [0061], and [0063]), thereby treating DMD in a patient in need thereof (abstract). Thus, Butler-Browne discloses the therapeutic utility of ATL1102 in treating DMD, while Limmroth teaches that ATL1102 is identical to the instantly claimed oligonucleotide, with the exception of the O,O-linked phosphorothioate diesters of a) of instant claim 17. This deficiency is cured by Klinger. Klinger discloses an oligonucleotide for the inhibition of alpha4 integrin (as in Butler-Browne), wherein said oligonucleotide is identical to ATL1102 and to the instantly claimed oligonucleotide (paragraphs [0025] and [0274]). Klinger further discloses that the oligonucleotide taught therein comprises 19 internucleotide linkages, wherein said internucleotide linkages are O,O-linked phosphorothioate diesters (paragraph [0027]). Regarding the treatment outcomes recited in the instant claim, it is considered that Butler-Browne and Klinger (as evidenced by Limmroth) collectively disclose the treatment method of instant claim 17, as set forth above. The treatment outcomes from said method are considered to occur inherently upon execution of the method steps. See MPEP § 2112. Thus, it is considered that Butler-Browne, Klinger, and Limmroth collectively disclose each and every limitation of instant claim 17. Given that Butler-Browne discloses therapeutic antisense oligonucleotides such as ATL1102 that treat patients with muscular dystrophy (i.e. Duchenne muscular dystrophy) in combination with corticosteroids such as glucocorticoids (as taught by Ramamoorthy) dosed based on the medical judgment of a physician having ordinary skill in the art, that Limmroth discloses that ATL1102 comprises the same sequence as that of the instantly claimed therapeutic oligonucleotide and is a 3-9-8 2’O-(2-methoxyethyl) gapmer, and that Klinger also discloses a therapeutic oligonucleotide that is identical to ATL1102, wherein said therapeutic oligonucleotide comprises 19 O,O-linked phosphorothioate diesters internucleotide linkages, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to modify the ATL1102 oligonucleotide taught in Butler-Browne such that it specifically comprises O,O-linked phosphorothioate diesters internucleotide linkages (as disclosed in Klinger) to predictably generate a therapeutic oligonucleotide suitable for the treatment of muscular dystrophies such as Duchenne Muscular Dystrophy. One would have been motivated to make such a modification in order to receive the expected benefit of generating a therapeutic oligonucleotide suitable for the treatment of muscular dystrophies such as Duchenne Muscular Dystrophy. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 3-17 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-13 of U.S. Patent No. 11,976,281 B2 in view of US 2012/0258093 A1 (hereinafter Butler-Browne; as cited in Applicant IDS) and US 2013/0345293 A1 (hereinafter Klinger). Patent ‘281 is drawn to a method of treating muscular disorders such as muscular dystrophy, said method comprising periodically administering an inhibitory oligonucleotide to the alpha 4 chain of VLA-4 (abstract). The method of patent ‘281 specifically comprises periodically administering to the subject a pharmaceutical composition comprising a pharmaceutically acceptable carrier and a therapeutically effective amount of an oligonucleotide comprising the structure: 5’ – MeCMeUG AGT MeCTG TTT MeUMeCMEC AMeUMeU MeCMeU – 3’ wherein, each of the 19 internucleotide linkages of the oligonucleotide is an O,O-linked phosphorothioate diester; the nucleotides at the positions 1 to 3 from the 5’ end are 2’-O-(2-methoxyethyl) modified ribonucleosides; the nucleotides at the positions 4 to 12 from the 5’ end are 2’-deoxyribonucleosides; the nucleotides at the positions 13 to 20 from the 5’ end are 2’-O-(2-methoxyethyl) modified ribonucleosides; and all cytosines are 5-methylcytosines (MeC), wherein the therapeutically effective amount is 25 mg to 100 mg, as recited at patented claims 1, 8, and 9 and as is also recited at instant claims 3, 5, 6, 16, and 17. The periodic administration is further recited to occur once or twice or three times per week or fortnight or month at patented claim 2 and also at instant claim 4. The treated muscular dystrophy is recited to be selected from the group consisting of Duchenne muscular dystrophy, limb girdle muscular dystrophy, Becker muscular dystrophy, congenital muscular dystrophy, and other muscular dystrophies at patented claim 3 and also at instant claim 9. The muscular dystrophy treated by the patented method is recited to involve a mutation in a dystrophin gene at patented claim 4 and also at instant claim 10. The subject to be treated by the patented method is recited to be diagnosed with Duchenne muscular dystrophy and may be ambulatory or non ambulatory at patented claim 5 and also at instant claim 11. The patented method is recited to comprise administering the oligonucleotide set forth above in combination with varying doses of corticosteroid treatment at patented claims 6 and 10-13 and also at instant claims 14 and 15. Regarding instant claims 7, 8, 12, and 13, the patented application is silent as to the salt form of the therapeutic oligonucleotide claimed therein, the WFI and pH of the therapeutic solution, as well as subject age and route of administration. These deficiencies are cured by Butler-Browne and Klinger. As set forth above, Butler-Browne discloses that ATL1102 is a therapeutic antisense oligonucleotide for the treatment of Duchenne muscular dystrophy (abstract) and further that said therapeutic antisense oligonucleotide may be administered on a daily basis, and that therapeutically effective amounts include 25, 50, 100, and 250 mg of the active ingredient or salt thereof within a pharmaceutical composition comprising a pharmaceutically acceptable carrier (paragraphs [0059], [0061], and [0063]). Butler-Browne further discloses that the pharmaceutical salts comprising the therapeutic oligonucleotide taught therein may be sodium or potassium salts (paragraphs [0063] and [0066]). Thus, Butler-Browne discloses each and every additional limitation of instant claim 7. Furthermore, Butler-Browne discloses that the pharmaceutically acceptable carrier of the therapeutic compositions taught therein may be sterilized water (paragraphs [0063] and [0067]), which reads on the instantly claimed “WFI” of instant claim 8. However, Butler-Browne is silent as to the pH of the formulations taught therein. This deficiency is cured by Klinger, which discloses an oligonucleotide for the inhibition of alpha4 integrin (as in Butler-Browne), wherein said oligonucleotide is identical to ATL1102 and to the instantly claimed oligonucleotide (paragraphs [0025] and [0274]), as set forth above. Klinger further discloses that the oligonucleotide taught therein may be formulated in water for injection adjusted to a pH of 7.2-7.6 (paragraph [0144]). Thus, it is considered that Butler-Browne and Klinger collectively disclose each and every additional limitation of instant claim 8. Butler-Browne discloses examining patients ranging in age from 5 to 17 years (paragraph [0129]) and discloses that DMD affects 1 in 3,500 male births (paragraph [0003]). Therefore, it would have been obvious to have treated any of the patients in this age range since they were all in need of treatment. Furthermore, given that DMD primarily impacts male patients, it would have been obvious to have specifically treated a male patient in this range, including one of 10 years or older, as instantly claimed. Thus, it is considered that Butler-Browne discloses and/or motivates each and every additional limitation of instant claim 12. Finally, Butler-Browne further discloses that the therapeutic oligonucleotide taught therein may be administered subcutaneously (paragraphs [0062] and [0070]). Thus, Butler-Browne discloses each and every additional limitation of instant claim 13. Given that patent ‘281 discloses a therapeutic oligonucleotide for the treatment of muscular dystrophies, wherein said therapeutic oligonucleotide is identical to that of the instant application and is further recited be administered in combination with a corticosteroid, and that Butler-Browne and Klinger disclose therapeutic antisense oligonucleotide ATL1102, which is identical to that of patent ‘281 and the instant application, wherein said antisense oligonucleotide may be formulated as a sodium or potassium salt and may be delivered subcutaneously with a WFI pharmaceutically acceptable carrier with a pH adjusted to 7.2-7.6 to juvenile male patients in need thereof, it would have been obvious to someone of ordinary skill in the art before the effective filing date of the claimed invention to formulate the therapeutic antisense oligonucleotide of both the patented and instant applications per the teachings of Butler-Browne and Klinger to predictably generate a therapeutic antisense oligonucleotide for purposes of treating muscular dystrophy in juvenile male subjects in need thereof. One would have been motivated to make such a modification in order to receive the expected benefit of generating a therapeutic antisense oligonucleotide for purposes of treating muscular dystrophy in juvenile male subjects in need thereof. Conclusion No claims are allowed. Claims 3, 8-11, and 15-17 are objected to. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Sarah E Allen whose telephone number is (571)272-0408. The examiner can normally be reached M-F 8-5. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached at 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /SARAH E ALLEN/ Examiner, Art Unit 1637 /J. E. ANGELL/ Primary Examiner, Art Unit 1637
Read full office action

Prosecution Timeline

Apr 01, 2024
Application Filed
Aug 24, 2026
Non-Final Rejection mailed — §103, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735703
OLIGONUCLEOTIDE COMPOSITIONS AND METHODS OF USE THEREOF
4y 5m to grant Granted Sep 15, 2026
Patent 12703874
METHODS OF TREATING HEARING LOSS USING A SECRETED TARGET PROTEIN
4y 6m to grant Granted Aug 11, 2026
Patent 12649922
Novel Retinitis Pigmentosa Treatment
1y 10m to grant Granted Jun 09, 2026
Patent 12599665
GENE FUSIONS FOR CONTROL OF GENETICALLY MODIFIED CELLS
3y 2m to grant Granted Apr 14, 2026
Patent 12590304
NUCLEIC ACID, PHARMACEUTICAL COMPOSITION, CONJUGATE, PREPARATION METHOD, AND USE
4y 4m to grant Granted Mar 31, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
58%
Grant Probability
99%
With Interview (+47.8%)
3y 6m (~1y 1m remaining)
Median Time to Grant
Low
PTA Risk
Based on 26 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month