Prosecution Insights
Last updated: April 19, 2026
Application No. 18/623,981

BRASSICA EVENT MON94100 AND METHODS OF USE THEREOF

Non-Final OA §101§102
Filed
Apr 01, 2024
Examiner
KOVALENKO, MYKOLA V
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Monsanto Technology LLC
OA Round
1 (Non-Final)
70%
Grant Probability
Favorable
1-2
OA Rounds
2y 11m
To Grant
95%
With Interview

Examiner Intelligence

Grants 70% — above average
70%
Career Allow Rate
371 granted / 534 resolved
+9.5% vs TC avg
Strong +26% interview lift
Without
With
+25.6%
Interview Lift
resolved cases with interview
Typical timeline
2y 11m
Avg Prosecution
39 currently pending
Career history
573
Total Applications
across all art units

Statute-Specific Performance

§101
3.2%
-36.8% vs TC avg
§103
34.1%
-5.9% vs TC avg
§102
11.3%
-28.7% vs TC avg
§112
40.2%
+0.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 534 resolved cases

Office Action

§101 §102
DETAILED ACTION Notice of Pre-AIA or AIA Status 1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of the Claims 2. Claims 5, 6, 9, and 12 are pending and examined. Claim Rejections - 35 USC § 101 3. 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. 4. Claims 5, 6, and 12 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (product of nature) without significantly more. The claims are drawn to a DNA molecule having a sufficient length of contiguous nucleotides of SEQ ID NO: 10 to function as a DNA probe specific for SEQ ID NO: 10 in a sample; including, wherein the DNA probe comprises SEQ ID NO: 13. A polynucleotide comprising the full-length SEQ ID NO: 13 is present in a number of naturally occurring organisms. For example, GenBank Accession Number OZ038523 (submitted on May 13, 2024) discloses a sequence from Tenacibaculum sp., a bacterium, that has 100% sequence identity to SEQ ID NO: 13. The sequence alignment is set forth below. Tenacibaculum sp. 190524A05c isolate ena-SAMPLE-TAB-13-05-2024-13:56:06:370-140299 genome assembly, chromosome: T190524A05C Sequence ID: OZ038523.1 Length: 4130482Number of Matches: 1 Range 1: 3831061 to 3831076 Query 1 ATCCATGTAGATTTCC 16 |||||||||||||||| Sbjct 3831076 ATCCATGTAGATTTCC 3831061 The claims thus encompass a product of nature. Moreover, the claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception. For example, claim 12, although it is drawn to a “kit,” does not recite any structural elements other than the probe of claim 5, which includes the probe of SEQ ID NO: 13. This judicial exception is not integrated into a practical application because the claims are merely directed to a DNA molecule or a kit whose sole recited element is said DNA molecule, and do not encompass any method steps or any other limitations that could be reasonably interpreted as requiring the integration of said naturally occurring DNA molecule into a practical application. Claim Rejections - 35 USC § 102 5. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. 6. Claims 5, 6, 9 and 12 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Brinker et al (US Patent 8,501,407, issued on August 6, 2013). Brinker et al disclose, at SEQ ID NO: 6, the nucleic acid sequence of soybean transgenic event MON 87708 that has 83.6% sequence identity to nucleotides 1098-3895 of the instant SEQ ID NO: 10. The sequence of Brinker et al encompasses large portions of contiguous nucleotides with 100% identity to the instant SEQ ID NO: 10. This includes positions 3869 to 3881 of SEQ ID NO: 10, which represent the instant SEQ ID NO: 13 (see the Specification, Brief Description of the Sequences on page 6 and paragraph 33 on page 7). The sequence alignment is set forth below. Brinker et al disclose a DNA probe comprising a nucleotide sequence of sufficient length of contiguous nucleotides of SEQ ID NO: 6, wherein said probe is diagnostic for the presence of event MON 87708. Brinker et al disclose a method for detecting the presence of a DNA molecule from soybean event MON 87708 in a sample, comprising contacting said sample with said probe, subjecting said sample and said probe to stringent hybridization conditions, and detecting hybridization of said DNA probe to a DNA molecule in said sample, wherein the hybridization of said DNA probe to said DNA molecule indicates the presence of a DNA molecule form said soybean event MON 87708. Brinker et al disclose a DNA detecting kit comprising said probe (claims 15, 17, and 22). Because the sequence of Brinker et al comprises large portions of contiguous nucleotides having 100% identity to the instant SEQ ID NO: 10, which portions can be used as a probe, the DNA molecule and the kit of Brinker et al read on the DNA molecule and the kit of the instant claims 5, 6, and 12. The steps of the method of Brinker et al will read on those of the instant claim 9. It is noted that the limitation, in the instant claim 9, “wherein the hybridization of the DNA probe to the DNA molecule indicates the presence of Brassica Event MON94100” is reasonably interpreted as an intended result of the method. It is noted that a "‘whereby clause in a method claim is not given weight when it simply expresses the intended result of a process step positively recited.” Hoffer v. Microsoft Corp., 405 F.3d 1326, 1329, 74 USPQ2d 1481, 1483 (Fed. Cir. 2005). See MPEP 2111.04. Moreover, a sample of DNA “derived” from a Brassica plant may include other DNA sources and thus the sample of Brinker et al will read on the sample of the instant method. Similarly, in claim 5, the recitation “to function as a DNA probe specific for SEQ ID NO: 10 in a sample derived from a Brassica plant” is an intended use for the claimed DNA molecule, which does not preclude the functionally recited DNA probe from also recognizing the presence of DNA derived from other transgenic events. For these reasons, the disclosure of Brinker et al anticipates the invention of the instant claims. The alignment between the instant SEQ ID NO: 10 and SEQ ID NO: 6 of Brinker et al. Sequence 6, US/12868989 Patent No. 8501407 GENERAL INFORMATION APPLICANT: Monsanto Technology LLC APPLICANT: Brinker, Ronald J APPLICANT: Burns, Wen C. APPLICANT: Feng, Paul C.C. APPLICANT: Gupta, Anju APPLICANT: Hoi, Soi-Wai APPLICANT: Malven, Marianne APPLICANT: Wu, Kunsheng TITLE OF INVENTION: Soybean Transgenic Event MON 87708 and Methods of Use Thereof FILE REFERENCE: 38-21(55544)0000 CURRENT APPLICATION NUMBER: US/12/868,989 CURRENT FILING DATE: 2010-08-26 PRIOR APPLICATION NUMBER: 61/243,227 PRIOR FILING DATE: 2009-09-17 NUMBER OF SEQ ID NOS: 16 SEQ ID NO 6 LENGTH: 5946 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Chimeric DNA molecule of soybean genomic DNA and transgene DNA Query Match 41.9%; Score 2058.2; Length 5946; Best Local Similarity 83.6%; Matches 2450; Conservative 0; Mismatches 348; Indels 133; Gaps 5; Qy 1098 CGGCCGCAGATCTTGAGCCAATCAAAGAGGAGTGATGTAGACCTAAAGCAATAATGGAGC 1157 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1208 CGGCCGCAGATCTTGAGCCAATCAAAGAGGAGTGATGTAGACCTAAAGCAATAATGGAGC 1267 Qy 1158 CATGACGTAAGGGCTTACGCCCATACGAAATAATTAAAGGCTGATGTGACCTGTCGGTCT 1217 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1268 CATGACGTAAGGGCTTACGCCCATACGAAATAATTAAAGGCTGATGTGACCTGTCGGTCT 1327 Qy 1218 CTCAGAACCTTTACTTTTTATGTTTGGCGTGTATTTTTAAATTTCCACGGCAATGACGAT 1277 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1328 CTCAGAACCTTTACTTTTTATGTTTGGCGTGTATTTTTAAATTTCCACGGCAATGACGAT 1387 Qy 1278 GTGACCCAACGAGATCTTGAGCCAATCAAAGAGGAGTGATGTAGACCTAAAGCAATAATG 1337 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1388 GTGACCCAACGAGATCTTGAGCCAATCAAAGAGGAGTGATGTAGACCTAAAGCAATAATG 1447 Qy 1338 GAGCCATGACGTAAGGGCTTACGCCCATACGAAATAATTAAAGGCTGATGTGACCTGTCG 1397 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1448 GAGCCATGACGTAAGGGCTTACGCCCATACGAAATAATTAAAGGCTGATGTGACCTGTCG 1507 Qy 1398 GTCTCTCAGAACCTTTACTTTTTATATTTGGCGTGTATTTTTAAATTTCCACGGCAATGA 1457 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1508 GTCTCTCAGAACCTTTACTTTTTATATTTGGCGTGTATTTTTAAATTTCCACGGCAATGA 1567 Qy 1458 CGATGTGACCTGTGCATCCGCTTTGCCTATAAATAAGTTTTAGTTTGTATTGATCGACAC 1517 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1568 CGATGTGACCTGTGCATCCGCTTTGCCTATAAATAAGTTTTAGTTTGTATTGATCGACAC 1627 Qy 1518 GGTCGAGAAGACACGGCCATAAGCTTGGATCCTCGAGAATTCTCAACACAACATATACAA 1577 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1628 GGTCGAGAAGACACGGCCATAAGCTTGGATCCTCGAGAATTCTCAACACAACATATACAA 1687 Qy 1578 AACAAACGAATCTCAAGCAATCAAGCATTCTACTTCTATTGCAGCAATTTAAATCATTTC 1637 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1688 AACAAACGAATCTCAAGCAATCAAGCATTCTACTTCTATTGCAGCAATTTAAATCATTTC 1747 Qy 1638 TTTTAAAGCAAAAGCAATTTTCTGAAAATTTTCACCATTTACGAACGATAGCCATGGCTT 1697 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1748 TTTTAAAGCAAAAGCAATTTTCTGAAAATTTTCACCATTTACGAACGATAGCCATGGCTT 1807 Qy 1698 CTATGATATCCTCTTCCGCTGTGACAACAGTCAGCCGTGCCTCTAGGGGGCAATCCGCCG 1757 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1808 CTATGATATCCTCTTCCGCTGTGACAACAGTCAGCCGTGCCTCTAGGGGGCAATCCGCCG 1867 Qy 1758 CAATGGCTCCATTCGGCGGCCTCAAATCCATGACTGGATTCCCAGTGAGGAAGGTCAACA 1817 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1868 CAATGGCTCCATTCGGCGGCCTCAAATCCATGACTGGATTCCCAGTGAGGAAGGTCAACA 1927 Qy 1818 CTGACATTACTTCCATTACAAGCAATGGTGGAAGAGTAAAGTGCATGCAGGTGTGGCCTC 1877 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1928 CTGACATTACTTCCATTACAAGCAATGGTGGAAGAGTAAAGTGCATGCAGGTGTGGCCTC 1987 Qy 1878 CAATTGGAAAGAAGAAGTTTGAGACTCTTTCCTATTTGCCACCATTGACGAGAGATTCCC 1937 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1988 CAATTGGAAAGAAGAAGTTTGAGACTCTTTCCTATTTGCCACCATTGACGAGAGATTCCC 2047 Qy 1938 GGGCCATGGCCACCTTCGTCCGCAATGCCTGGTATGTGGCGGCGCTGCCCGAGGAACTGT 1997 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2048 GGGCCATGGCCACCTTCGTCCGCAATGCCTGGTATGTGGCGGCGCTGCCCGAGGAACTGT 2107 Qy 1998 CCGAAAAGCCGCTCGGCCGGACGATTCTCGACACACCGCTCGCGCTCTACCGCCAGCCCG 2057 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2108 CCGAAAAGCCGCTCGGCCGGACGATTCTCGACACACCGCTCGCGCTCTACCGCCAGCCCG 2167 Qy 2058 ACGGTGTGGTCGCGGCGCTGCTCGACATCTGTCCGCACCGCTTCGCGCCGCTGAGCGACG 2117 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2168 ACGGTGTGGTCGCGGCGCTGCTCGACATCTGTCCGCACCGCTTCGCGCCGCTGAGCGACG 2227 Qy 2118 GCATCCTCGTCAACGGCCATCTCCAATGCCCCTATCACGGGCTGGAATTCGATGGCGGCG 2177 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2228 GCATCCTCGTCAACGGCCATCTCCAATGCCCCTATCACGGGCTGGAATTCGATGGCGGCG 2287 Qy 2178 GGCAGTGCGTCCATAACCCGCACGGCAATGGCGCCCGCCCGGCTTCGCTCAACGTCCGCT 2237 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2288 GGCAGTGCGTCCATAACCCGCACGGCAATGGCGCCCGCCCGGCTTCGCTCAACGTCCGCT 2347 Qy 2238 CCTTCCCGGTGGTGGAGCGCGACGCGCTGATCTGGATCTGTCCCGGCGATCCGGCGCTGG 2297 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2348 CCTTCCCGGTGGTGGAGCGCGACGCGCTGATCTGGATCTGTCCCGGCGATCCGGCGCTGG 2407 Qy 2298 CCGATCCTGGGGCGATCCCCGACTTCGGCTGCCGCGTCGATCCCGCCTATCGGACCGTCG 2357 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2408 CCGATCCTGGGGCGATCCCCGACTTCGGCTGCCGCGTCGATCCCGCCTATCGGACCGTCG 2467 Qy 2358 GCGGCTATGGGCATGTCGACTGCAACTACAAGCTGCTGGTCGACAACCTGATGGACCTCG 2417 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2468 GCGGCTATGGGCATGTCGACTGCAACTACAAGCTGCTGGTCGACAACCTGATGGACCTCG 2527 Qy 2418 GCCACGCCCAATATGTCCATCGCGCCAACGCCCAGACCGACGCCTTCGACCGGCTGGAGC 2477 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2528 GCCACGCCCAATATGTCCATCGCGCCAACGCCCAGACCGACGCCTTCGACCGGCTGGAGC 2587 Qy 2478 GCGAGGTGATCGTCGGCGACGGTGAGATACAGGCGCTGATGAAGATTCCCGGCGGCACGC 2537 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2588 GCGAGGTGATCGTCGGCGACGGTGAGATACAGGCGCTGATGAAGATTCCCGGCGGCACGC 2647 Qy 2538 CGAGCGTGCTGATGGCCAAGTTCCTGCGCGGCGCCAATACCCCCGTCGACGCTTGGAACG 2597 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2648 CGAGCGTGCTGATGGCCAAGTTCCTGCGCGGCGCCAATACCCCCGTCGACGCTTGGAACG 2707 Qy 2598 ACATCCGCTGGAACAAGGTGAGCGCGATGCTCAACTTCATCGCGGTGGCGCCGGAAGGCA 2657 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2708 ACATCCGCTGGAACAAGGTGAGCGCGATGCTCAACTTCATCGCGGTGGCGCCGGAAGGCA 2767 Qy 2658 CCCCGAAGGAGCAGAGCATCCACTCGCGCGGTACCCATATCCTGACCCCCGAGACGGAGG 2717 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2768 CCCCGAAGGAGCAGAGCATCCACTCGCGCGGTACCCATATCCTGACCCCCGAGACGGAGG 2827 Qy 2718 CGAGCTGCCATTATTTCTTCGGCTCCTCGCGCAATTTCGGCATCGACGATCCGGAGATGG 2777 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2828 CGAGCTGCCATTATTTCTTCGGCTCCTCGCGCAATTTCGGCATCGACGATCCGGAGATGG 2887 Qy 2778 ACGGCGTGCTGCGCAGCTGGCAGGCTCAGGCGCTGGTCAAGGAGGACAAGGTCGTCGTCG 2837 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2888 ACGGCGTGCTGCGCAGCTGGCAGGCTCAGGCGCTGGTCAAGGAGGACAAGGTCGTCGTCG 2947 Qy 2838 AGGCGATCGAGCGCCGCCGCGCCTATGTCGAGGCGAATGGCATCCGCCCGGCGATGCTGT 2897 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2948 AGGCGATCGAGCGCCGCCGCGCCTATGTCGAGGCGAATGGCATCCGCCCGGCGATGCTGT 3007 Qy 2898 CGTGCGACGAAGCCGCAGTCCGTGTCAGCCGCGAGATCGAGAAGCTTGAGCAGCTCGAAG 2957 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3008 CGTGCGACGAAGCCGCAGTCCGTGTCAGCCGCGAGATCGAGAAGCTTGAGCAGCTCGAAG 3067 Qy 2958 CCGCCTGAACCGGCTTATGCTGCACGGGCGGGGCGGGGCGGTTTCGATCGGCTCGCCTGT 3017 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3068 CCGCCTGAACCGGCTTATGCTGCACGGGCGGGGCGGGGCGGTTTCGATCGGCTCGCCTGT 3127 Qy 3018 CCCGGCGATATTCTAGCTTAATCATCTGAAAC-----------------TGTTCACCATG 3060 |||||||||||||||| || | | | | | ||| | Db 3128 CCCGGCGATATTCTAGAGCTTTCGTTCGTATCATCGGTTTCGACAACGTTCGTCAAGTTC 3187 Qy 3061 CATGCAATCTTGTGA------------AATATATGGTTTTAATTAGACTTCAATCTTATG 3108 ||||| | | | | | | | || || | || || Db 3188 AATGCATCAGTTTCATTGCGCACACACCAGAATCCTACTGAGTTTGAGTATTATGGCATT 3247 Qy 3109 TTGGCTATTGTACTAATAAAAGCATGTCATGTTATTTTCATTTGATTTTATCTGTACTTT 3168 | | ||| | | | ||| | ||| || | |||| | | | | || | Db 3248 GGGAAAACTGTTTTTCTTGTACCATTTGTTGTGCTTGTAATTTACTGTGTTTTTTATTCG 3307 Qy 3169 GGTTTGTTT------------------GAAGAATAAAGATGAGCTTGCTATGCATGCATG 3210 | ||| | | | || ||| ||| | | || Db 3308 GTTTTCGCTATCGAACTGTGAAATGGAAATGGATGGAGAAGAGTTAATGAATGATATGGT 3367 Qy 3211 CATGCCATCGATTATCAGGGTTTCCTTTTTTCTTTTCTGGCTTCCCATCAATTTGGTGTG 3270 | | | ||| ||| | || ||| |||| | ||| | || || Db 3368 CCTTTTGTTCATTCTCAAATTAATATTATTTGTTTTTTCTCTTATTTGTTGTGTGTTGAA 3427 Qy 3271 AATTAGTGTGTGTGATATATTATATTATGCTATTTATGAAATAAAT-------------- 3316 | | | | || |||| | || | ||| | |||| Db 3428 TTTGAAATTATAAGAGATATGCAAACATTTTGTTTTGAGTAAAAATGTGTCAAATCGTGG 3487 Qy 3317 ----TGTTGGTTATATTTGATCTACAATCTACATACATGTGATTTTTATCAACAAAATAT 3372 | || | || || | || | | | || || || | | Db 3488 CCTCTAATGACCGAAGTTAATATGAGGAGTAAAACACTTGTAGTTGTACCATTATGCTTA 3547 Qy 3373 CTCGGGAAACAATACCTTTTTGGTAGCAAAATTCAAATAATACTATTTTAAATAAATCA- 3431 || | ||| | | | | | | ||| || ||| || || Db 3548 TTCACTAGGCAACAAATATATTTTCAGACCTAGAAAAGCTGCAAATGTTACTGAATACAA 3607 Qy 3432 ------------------------------------------------------------ 3431 Db 3608 GTATGTCCTCTTGTGTTTTAGACATTTATGAACTTTCCTTTATGTAATTTTCCAGAATCC 3667 Qy 3432 -------AAGTTAACCAATACCTTATTCAAGTTGGAGGGGTCTCAAACAAGCAAAAGAAT 3484 | ||| || | | |||| | | || | | | || | Db 3668 TTGTCAGATTCTAATCATTGCTTTATAATTATAGTTATACTCATGGATTTGTAGTTGAGT 3727 Qy 3485 TCAAGTTGTTAATGAACTTCGGTTAATGATAAAAGAATTCGCATTTAAAAGCGGCCGCAC 3544 | | | | | | || |||| |||| || | | | Db 3728 ATGAAAATATTTTTTAATGCATTTTATGACTTGCCAATTGATTGACAACATGCATCAATC 3787 Qy 3545 GTCCTGCTTGGCCTACTAGGCCAACGCAGGCGCTGGCCGTGACGGCCACGAGCGAACTAG 3604 | | ||||| | | | | | | | | ||| | Db 3788 GCGGCCGCTCTAGAACTAGTGGATCCCCCCCTTTAAGGGGGCTGCAGGAATTCGATATCA 3847 Qy 3605 GCCTTGGGCCGCATCGATCGTGAAGTTTCTCATCTAAGCCCCCATTTGGACGTGAATGTA 3664 ||| ||| |||||||||||||||||||||||||||||||||||||||||||| Db 3848 AGCTTTGGCGCGCCAAATCGTGAAGTTTCTCATCTAAGCCCCCATTTGGACGTGAATGTA 3907 Qy 3665 GACACGTCGAAATAAAGATTTCCGAATTAGAATAATTTGTTTATTGCTTTCGCCTATAAA 3724 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3908 GACACGTCGAAATAAAGATTTCCGAATTAGAATAATTTGTTTATTGCTTTCGCCTATAAA 3967 Qy 3725 TACGACGGATCGTAATTTGTCGTTTTATCAAAATGTACTTTCATTTTATAATAACGCTGC 3784 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 3968 TACGACGGATCGTAATTTGTCGTTTTATCAAAATGTACTTTCATTTTATAATAACGCTGC 4027 Qy 3785 GGACATCTACATTTTTGAATTGAAAAAAAATTGGTAATTACTCTTTCTTTTTCTCCATAT 3844 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 4028 GGACATCTACATTTTTGAATTGAAAAAAAATTGGTAATTACTCTTTCTTTTTCTCCATAT 4087 Qy 3845 TGACCATCATACTCATTGCTGATCCATGTAGATTTCCCGGACATGAAGCCA 3895 |||||||||||||||||||||||||||||||||||||||||| | | || Db 4088 TGACCATCATACTCATTGCTGATCCATGTAGATTTCCCGGACTTTAGCTCA 4138 Conclusion 7. No claims are allowed. 8. Any inquiry concerning this communication or earlier communications from the examiner should be directed to MYKOLA V KOVALENKO whose telephone number is (571)272-6921. The examiner can normally be reached Mon.-Fri. 9:00-5:30 PST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, BRATISLAV STANKOVIC can be reached at (571)270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /MYKOLA V. KOVALENKO/Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Apr 01, 2024
Application Filed
Mar 04, 2026
Non-Final Rejection — §101, §102 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12600983
TRANSGENIC MAIZE EVENT MON 87427 AND THE RELATIVE DEVELOPMENT SCALE
2y 5m to grant Granted Apr 14, 2026
Patent 12600981
INSECT INHIBITORY PROTEINS
2y 5m to grant Granted Apr 14, 2026
Patent 12570965
HERBICIDE-RESISTANT RICE PLANTS, POLYNUCLEOTIDES ENCODING HERBICIDE-RESISTANT ACETOHYDROXYACID SYNTHASE LARGE SUBUNIT PROTEINS, AND METHODS OF USE
2y 5m to grant Granted Mar 10, 2026
Patent 12570994
PLANTS HAVING INCREASED TOLERANCE TO HERBICIDES
2y 5m to grant Granted Mar 10, 2026
Patent 12568901
WHEAT VARIETY KS TERRITORY
2y 5m to grant Granted Mar 10, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
70%
Grant Probability
95%
With Interview (+25.6%)
2y 11m
Median Time to Grant
Low
PTA Risk
Based on 534 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month