Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Claims 1, 3-17, 21-27, 33-36 and 47 are pending in this application and are examined.
Copending Applications
Applicants must bring to the attention of the Examiner, or other Office official involved with the examination of a particular application, information within their knowledge as to other copending United States applications, which are "material to patentability" of the application in question. MPEP 2001.06(b). See Dayco Products Inc. v. Total Containment Inc., 66 USPQ2d 1801 (CA FC 2003).
Deposit Perfection
The Office acknowledges the deposit of biological material and the deposit statement as outlined on paragraphs [0021-0022] of the specification. The deposit statement meets the requirements of 37 CFR 1.801-1.809. Therefore, no 112(a) rejection is applicable.
Claim Objections
Claims 25-26 and 36 is objected to for lacking an article. It is suggested that “Harvested” in claims 25-26 be replaced with ---A harvested----. In claim 36, it is suggested that “Method” be replaced with ---A method---.
Claim 35 is objected to under 37 CFR 1.75(c ) as being in improper form because a multiple dependent claim can depend on another claim in the alternative only. See MPEP 608.01(n). the claim depends on both claim 1 and claim 33. It is suggested that “as claimed in claim 1” be deleted.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 16-17, 21-23, 25, and 33-36 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claims 16, 21-23, 33-34 and 36 recite preferred and/or exemplary embodiments, recited as “and optionally a QTL on chromosome 4 and/or the QTL on chromosome 1. However, description of examples and preferences is properly set forth in the specification rather than in a single claim. Claim 25 is drawn to harvested part of the Brassica plant, “optionally in processed form”. A broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). The claim(s) are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. Dependent claims 17 and 35 do not obviate the rejection, therefore are included in the rejection. The multiple “optionally” and “and/or” recited in the same claim also renders the claim confusing. Appropriate corrections are required to more clearly define the metes and bounds of the claims.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1, 3-4, 6-8, 10-12, 14-17, 21-22, 25-27 and 47 are rejected under 35 U.S.C. 101 because the claimed invention is directed to product of nature without significantly more. The claim(s) recite(s) a Brassica plant comprising a QTL on chromosome 8, 4 and 1 which can be identified by use of at least one of SEQ ID NO: 1-22. The claims do not recite the claimed Brassica contains an exogenous genetic elements or chromosome 8. This judicial exception is not integrated into a practical application because the claimed plants/seed/cell are not produced by breeding or by genetic transformation methods and as evidenced by Coelho et al (Acta Hortic. 1202 (2018); PP. 93-100) a downy mildew resistant Brassica plant exists in nature. The claim(s) does/do not include additional elements that are sufficient to amount to significantly more than the judicial exception because the claimed plant is not markedly different from its naturally occurring counterpart, wild-type Brassica shown on Table 2 of Coelho et al. The QTL and markers of SEQ ID NO: 1-22 on chromosomes 8, 4 and 1 recited in the claims 3-4, 7-8, and 11-12 are naturally present in brassica plant and confer the downy mildew resistance. The alignment of sequences below show SEQ ID NO: 2 and 6 are present on chromosome 8 ; SEQ ID NO: 13-14 on chromosome 4; and SEQ ID NO: 18 and 20 on chromosome 1, in wild cabbage. Any association between resistance to downy mildew and the QTL markers of SEQ ID NO: 1-22 is a law of nature or natural phenomenon because SEQ ID NO: 1-22 are genomic nucleic acid sequences naturally present in downy mildew resistance Brassica plants. The claimed plant/seed, any part of the plant or cell thereof is not produced by crossing between two plants, therefore, fails to add any patentable weight to the product.The limitations “”detectable”, “can be identified”, “capable of”, “is suitable for”, and the homozygosity of the plant do not add to patent eligibility. The limitation “resistance detectable at cotyledon stage” does not add to patentability because Coelho et al brassica with cotyledon resistance. The harvested plant parts in optionally processed form of claims 25-27 having no exogenous genetic material read on product of nature. The claimed harvested parts of plant including processed form read on any extracted oil or other processed plant product (e.g., food product) which does not appear to be markedly different from that of the naturally occurring. The specification at paragraph [0078] reads as follows” food product may comprise harvested parts of Brassica plants of the invention or parts thereof, either in natural or optionally in the processed form”.
The Supreme Court does acknowledge that it is possible to transform an unpatentable law of nature, but one must do more than simply state the law of nature while adding the words “apply it”. See Gottschalk v. Benson, 409 U. S. 63, 67 (1972). The cell, seed and propagation material are part of the brassica plant, and not markedly different from its naturally occurring counterpart, and do not constitute patentable products.
The US Supreme Court in Mayo Collaborative Svcs. V. Prometheus Laboratories, Inc.,No. 10-1150 (2012) had confirmed that laws of nature are unpatentable. The US Supreme court in Biliski v. Kappos, No. 08-964, 2010 WL 2555192 (June 28, 2010) confirmed that abstract ideas are not patentable . “[L]aws of nature, natural phenomena, and abstract ideas” are not patentable. Diamond v. Diehr, 450 U. S. 185 (1981). The US Supreme court in Association for Molecular Pathology v. Myriad Genetics, Inc., -- U.S. – 133 S. Ct. 2107, 106 USPQ2d 1972 (June 13, 2013) confirmed that natural products are not patentable.
According to the MPEP 2106, a claim that is directed to a judicial exception when a law of nature is recited in the claim; such a claim requires a closer scrutiny for eligibility because of the risk it will “tie up” the excepted subject matter and pre-empt others from using the law of nature. Mayo, 132 S. Ct. at 1301 states "([E]ven though rewarding with patents those who discover new laws of nature and the like might well encourage their discovery, those laws and principles, considered generally, are ‘the basic tools of scientific and technological work.’ And so there is a danger that the grant of patents that tie up their use will inhibit future innovation premised upon them, a danger that becomes acute when a patented process amounts to no more than an instruction to ‘apply the natural law,’ or otherwise forecloses more future invention than the underlying discovery could reasonably justify’’ (quoting Gottschalk v. Benson, 409 U.S. 63, 67 (1972)).
Therefore, claims 1, 3-4, 6-8, 10-12, 14-17, 21-22, 25-27 and 47 do not recite something that is markedly different in structure/function than the judicial exception itself, and therefore, are deemed to be patent ineligible .
Instant SEQ ID NO: 2 Search Results
LR031879s5
LOCUS LR031879s5 2921300 bp DNA linear PLN 16-NOV-2018
DEFINITION Brassica oleracea HDEM genome, scaffold: C8.
ACCESSION LR031879
SOURCE Brassica oleracea (wild cabbage)
ORGANISM Brassica oleracea
JOURNAL Submitted (13-NOV-2018) Genoscope CEA, 2 rue Gaston Cremieux CP5706
91057 Evry cedex, France, France
FEATURES Location/Qualifiers
source 1..50921300
/organism="Brassica oleracea"
/mol_type="genomic DNA"
/db_xref="taxon:3712"
Query Match 99.2%; Score 199.4; DB 540; Length 2921300;
Best Local Similarity 99.5%;
Matches 200; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 1 AAGAATCATTGAGCCAATGTCGCTTGGAAATCCTGTCAAGAGAAATAAAGATCTGTTACT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 772142 AAGAATCATTGAGCCAATGTCGCTTGGAAATCCTGTCAAGAGAAATAAAGATCTGTTACT 772201
Qy 61 CACAAATGAAGACAAATACATTATCGTTACATGTGAAACATAATTTGTCTTACCTCCTTT 120
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||
Db 772202 CACAAATGAAGACAAATACATTATCGTTACATGTGAAACAGAATTTGTCTTACCTCCTTT 772261
Qy 121 ATTAAATACGCTACCGACATAGAACATAACCCCTGAGCTTCCAGAGAGCTGTTGCAGAAG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 772262 ATTAAATACGCTACCGACATAGAACATAACCCCTGAGCTTCCAGAGAGCTGTTGCAGAAG 772321
Qy 181 CATTAGCCCCACACCAATCTG 201
|||||||||||||||||||||
Db 772322 CATTAGCCCCACACCAATCTG 772342
Search Results of instant SEQ ID NO: 6
LR031879s5
DEFINITION Brassica oleracea HDEM genome, scaffold: C8.
ACCESSION LR031879
VERSION LR031879.1
SOURCE Brassica oleracea (wild cabbage)
ORGANISM Brassica oleracea
REFERENCE 1
AUTHORS William,W.
CONSRTM Genoscope - CEA
TITLE Direct Submission
JOURNAL Submitted (13-NOV-2018) Genoscope CEA, 2 rue Gaston Cremieux CP5706
/organism="Brassica oleracea"
/mol_type="genomic DNA"
/db_xref="taxon:3712"
gene <14333..14601
Query Match 100.0%; Score 201; DB 540; Length 2921300;
Best Local Similarity 100.0%;
Matches 201; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GGCCTATGTTGGGCCTCTTAAGCCCGTAGTTTGATAAGCTTCCAAGAACCAGCCATGATA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2099493 GGCCTATGTTGGGCCTCTTAAGCCCGTAGTTTGATAAGCTTCCAAGAACCAGCCATGATA 2099552
Qy 61 AGAGCAGTATAAGCTTGTCTACTAGCCATAGAGGTAGCCACTTCATTAACATCACTGAGA 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2099553 AGAGCAGTATAAGCTTGTCTACTAGCCATAGAGGTAGCCACTTCATTAACATCACTGAGA 2099612
Qy 121 TTCCGAATGTTGACTTTCCCATAACTTCTCTAGGTAACACATGAACCTGGTCGAATTAAG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 2099613 TTCCGAATGTTGACTTTCCCATAACTTCTCTAGGTAACACATGAACCTGGTCGAATTAAG 2099672
Qy 181 AAACACAAGAACATGGTTAGC 201
|||||||||||||||||||||
Db 2099673 AAACACAAGAACATGGTTAGC 2099693
SEQ ID NO: 13
LR031873s2/c
LOCUS LR031873s2 12010020 bp DNA linear PLN 16-NOV-2018
DEFINITION Brassica oleracea HDEM genome, scaffold: C4.
SOURCE Brassica oleracea (wild cabbage)
ORGANISM Brassica oleracea
REFERENCE 1
AUTHORS William,W.
CONSRTM Genoscope - CEA
Query Match 100.0%; Score 201; DB 540; Length 12010020;
Best Local Similarity 100.0%;
Matches 201; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAAGAGCTAGGATGATGCGGGTGATGAACAGAGGGGATTCTCAGAAACAGTGCAAATAAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1073193 GAAGAGCTAGGATGATGCGGGTGATGAACAGAGGGGATTCTCAGAAACAGTGCAAATAAA 1073134
Qy 61 GGGCAATACGCCCGGGAAAGGGAAGGAGTAAAACAAGCTGTTCCCAGCATAACTCTGAAT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1073133 GGGCAATACGCCCGGGAAAGGGAAGGAGTAAAACAAGCTGTTCCCAGCATAACTCTGAAT 1073074
Qy 121 CTGTTGTACATTCAATTTTCAATACAATTCATCTGCAAGAGACAGGGGAAACACATTCAT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1073073 CTGTTGTACATTCAATTTTCAATACAATTCATCTGCAAGAGACAGGGGAAACACATTCAT 1073014
Qy 181 GAAGGTATATCAAGAATTACA 201
|||||||||||||||||||||
Db 1073013 GAAGGTATATCAAGAATTACA 1072993
Instant SEQ ID NO: 14 search results
LR031873s2/c
DEFINITION Brassica oleracea HDEM genome, scaffold: C4.
SOURCE Brassica oleracea (wild cabbage)
ORGANISM Brassica oleracea
REFERENCE 1
AUTHORS William,W.
JOURNAL Submitted (13-NOV-2018) Genoscope CEA, 2 rue Gaston Cremieux CP5706
Query Match 100.0%; Score 201; DB 540; Length 12010020;
Best Local Similarity 100.0%;
Matches 201; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 GAAGAGCTAGGATGATGCGGGTGATGAACAGAGGGGATTCTCAGAAACAGTGCAAATAAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1073193 GAAGAGCTAGGATGATGCGGGTGATGAACAGAGGGGATTCTCAGAAACAGTGCAAATAAA 1073134
Qy 61 GGGCAATACGCCCGGGAAAGGGAAGGAGTAAAACAAGCTGTTCCCAGCATAACTCTGAAT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1073133 GGGCAATACGCCCGGGAAAGGGAAGGAGTAAAACAAGCTGTTCCCAGCATAACTCTGAAT 1073074
Qy 121 CTGTTGTACATTCAATTTTCAATACAATTCATCTGCAAGAGACAGGGGAAACACATTCAT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1073073 CTGTTGTACATTCAATTTTCAATACAATTCATCTGCAAGAGACAGGGGAAACACATTCAT 1073014
Qy 181 GAAGGTATATCAAGAATTACA 201
|||||||||||||||||||||
Db 1073013 GAAGGTATATCAAGAATTACA 1072993
SEQ ID NO: 18 on Chromosome 1
LR031878s1
LOCUS LR031878s1 12010020 bp DNA linear PLN 16-NOV-2018
DEFINITION Brassica oleracea HDEM genome, scaffold: C1.
ACCESSION LR031878
SOURCE Brassica oleracea (wild cabbage)
REFERENCE 1
AUTHORS William,W.
Query Match 100.0%; Score 201; DB 540; Length 12010020;
Best Local Similarity 100.0%;
Matches 201; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CAGAGAACTGGGCAACCTTGGCCTCCTTTGTGAAATTCCTTTTAAACGAACAAAAAAGTA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5792061 CAGAGAACTGGGCAACCTTGGCCTCCTTTGTGAAATTCCTTTTAAACGAACAAAAAAGTA 5792120
Qy 61 TCTTTCTCTGGCCTGGTTTGAGCCCATCCACCATGGAAGGGATTGACCTTTGAAGATCCG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5792121 TCTTTCTCTGGCCTGGTTTGAGCCCATCCACCATGGAAGGGATTGACCTTTGAAGATCCG 5792180
Qy 121 CCATGGAGAATAAGATAAGTTCTTTGTTTACGAAATCACTGAAGGAAATTTTCTGTTGCT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 5792181 CCATGGAGAATAAGATAAGTTCTTTGTTTACGAAATCACTGAAGGAAATTTTCTGTTGCT 5792240
Qy 181 TCTGATCAAGATGAGTGCCAG 201
|||||||||||||||||||||
Db 5792241 TCTGATCAAGATGAGTGCCAG 5792261
Search results of SEQ ID NO: 20
LR031878s1
LOCUS LR031878s1 12010020 bp DNA linear PLN 16-NOV-2018
DEFINITION Brassica oleracea HDEM genome, scaffold: C1.
ACCESSION LR031878
SOURCE Brassica oleracea (wild cabbage)
REFERENCE 1
AUTHORS William,W.
JOURNAL Submitted (13-NOV-2018) Genoscope CEA, 2 rue Gaston Cremieux CP5706
/mol_type="genomic DNA"
Query Match 100.0%; Score 201; DB 540; Length 12010020;
Best Local Similarity 100.0%;
Matches 201; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CTGGACTAATGCTGACTTCTCCTCTTAGTCAACTTAATAGCGTCAGTGTTTCTAATTTTC 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 7774227 CTGGACTAATGCTGACTTCTCCTCTTAGTCAACTTAATAGCGTCAGTGTTTCTAATTTTC 7774286
Qy 61 CACTGTTGCGGCCTCAAGATCTTAGGTACTAAATAACTTCATACAGGTTATCCTTTGATT 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 7774287 CACTGTTGCGGCCTCAAGATCTTAGGTACTAAATAACTTCATACAGGTTATCCTTTGATT 7774346
Qy 121 TGTTTATCTAACATTCGGTTTTATGATGATTGAAGGTTGGCTATTGCGGCTGCTGAAAGG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 7774347 TGTTTATCTAACATTCGGTTTTATGATGATTGAAGGTTGGCTATTGCGGCTGCTGAAAGG 7774406
Qy 181 CTGTTGATTTTGGAACCTCTT 201
|||||||||||||||||||||
Db 7774407 CTGTTGATTTTGGAACCTCTT 7774427
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 3-4, 6-8, 10-12, 14-17, 21-22, 25-27, 33, 36 and 47 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Carlier et al (Plant Breeding (2012)131:170-175) in light of each of Farinho et al (Theor Appl Genet (2004) 109:1392-1398); Carlsson et al (Hereditas (2004)141:293-300); and Coelho et al (Proc. Int. Symp. On Brassicas. Acta Hort. 459 (1998)).
The claims are drawn to a brassica plant that is resistant to Hyaloperonaspora brassicae, comprising a QTL on chromosome 8, 4 and 1 linked to markers SEQ ID NO: 1-22 which confers resistance to Hyaloperonospora brassicae to the Brassica plant, wherein the resistance is detectable in the cotyledon stage, wherein the presence of the OTL on chromosome 8 can be identified by use of at least one of the markers of SEQ TD NOS: 1 to 7, the presence of chromosome 4 can be identified by the use of markers SEQ ID NO: 8-16, the presence of chromosome 1 can be identified by the use of markers SEQ ID NO: 17-22, wherein when the QTLs are homozygously present the plant has an increased resistance to Hyaloperanospora brassicae as compared to the resistance Hyaloperonospora brassicae of a Brassica plant comprising only the OTL on chromosome 8; seed, cell, a propagation material or a harvested part of the Brassica plant having resistance to Hyalaperonospora brassicae and methods of producing said plant are also claimed.
The claims are interpreted to read on a downy mildew resistant Brassica plant and parts thereof that comprise unidentified QTLs on chromosomes 8, 4 and/or 1 that confers resistance against Hyaloperonospora brassica which include the QTLs taught by the QTLs taught by Carlier et al in light of each of Farinho et al, Carlsson et al, and Coelho et al; absent evidence to the contrary.
Carlier et al teach a Brassica oleraceae plant having resistance to downy mildew caused by Hyaloperonospora, and the presence of downy mildew resistance gene Pp523 located on chromosome 8 and show the genetic map of the Brassica oleracea with several markers (Figs.1-2; Table 1). Carlier et al state that 68% of the markers identified were mapped to three chromosomes (C3, C4, and C5), and one on chromosome 1 (C1). Carlier et al also teach brassica seed and progeny plants including F2 seed/plants having downy mildew resistance produced from crossing of downy mildew resistant B. oleracea plants with susceptible plants (see the whole document).
Each of Farinho et al, Carlsson et al, and Coelho et al is cited in Carlier et al.
Farinho et al (2004) teach Brassica oleraceae plant having resistance to downy mildew caused by Hyaloperonospora parasitica, and the presence of downy mildew resistance gene on chromosome 8 and markers closely linked to said resistance . Farinho et al also teach that multiple sources of genetic resistance to downy mildew are known at both the seedling and adult stage in brassica.
Carlsson et al teach a method of producing F1 progeny and further generation cabbage plants by crossing downy mildew resistant Brassica plants with susceptible plants, and backcrossing selected plants to produce backcrossed progeny plants. Carlsson et al also teach that the genetic resistance that control Hyaloperonospora parasitica in Brassica can be recessively (homozygously) inherited. Tables 1 and 4 list downy mildew resistant Brassica accessions including wild types.
Coelho et al teach that downy resistant Brassica oleracea screened for resistance at cotyledon stage and that cotyledon resistance is easy to assay on a large number of plants and stable since it is conducted under controlled environment.
Carlier et al in light of each of Farinho et al, Carlsson et al, and Coelho et al do not explicitly teach SEQ ID NO: 1-22. However, the markers are inherently located in chromosomes 8, 4 and 1 and that genetic element that confers known disease resistance property in known resistant plant species, does not render the plant novel. Claims 25-27 are included in the rejection because a harvest part that is a food product reads on parts of the cabbage plant taught by the Carlsson et al, and because the limitation “processed form” in claim parent claim 25, is optional.
Therefore, Carlier et al in light of each of Farinho et al, Carlsson et al, and Coelho et al anticipate the claimed invention, absent evidence to the contrary.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3-17, 21-27, 33-36 and 47 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are broadly drawn to a genus of brassica plants that is resistant to Hyaloperonaspora brassicae, comprising unspecified QTLs on chromosome 8, 4 and/or 1 linked to markers SEQ ID NO: 1-22 which confers resistance to Hyaloperonospora brassicae to the Brassica plant, wherein the resistance is detectable in the cotyledon stage, wherein the presence of the OTL on chromosome 8 can be identified by use of at least one of the markers of SEQ TD NOS: 1 to 7, the presence of chromosome 4 can be identified by the use of markers SEQ ID NO: 8-16, the presence of chromosome 1 can be identified by the use of markers SEQ ID NO: 17-22, wherein when the QTLs are homozygously present the plant has an increased resistance to Hyaloperanospora brassicae as compared to the resistance Hyaloperonospora brassicae of a Brassica plant comprising only the QTL on chromosome 8; seed, cell, a progeny or a propagation material, tissue culture, harvested part of the Brassica plant and having resistance to Hyalaperonospora brassicae, The claims are also drawn to a method of producing a Brassica plant showing resistance to Hyalopercnospora brassicae, comprising crossing a brassica plant comprising a QTL on chromosome 8 with another plant to produce an F1 population, selfing or crossing the F1 to obtain further generation population, and selecting from the further generation a plant comprising the QTL 8, and optionally a QTL on chromosome 4 and/or the QTL on chromosome 1, wherein the selection is done using SEQ ID NO: 1-22 for respective QTL; said method wherein the plant is a plant grown from seed deposited with NCIMB Accession No.43346.
In contrast, the specification describes the Brassica oleracea plant that is resistant to Hyaloperonaspora brassicae, comprising a QTL on chromosome 8, 4 and 1 linked to markers SEQ ID NO: 1-22, wherein the QTL is as comprised in the genome of Brassica plant representative seed of which was deposited under NCIMB Accession number NCIMB 43346, and wherein the QTLs are homozygously present in the plant. The specification also describes methods of using said brassica plant with the seed deposited in breeding to produce progeny having resistance to Hyaloperonaspora brassicae.
“The test for sufficiency is whether the disclosure of the application relied upon reasonably conveys to skilled in the art that the inventor had possession of the claimed subject matter as of the filing date.” Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1351 (Fed. Cir. 2010). To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Lockwood v. Amer. Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997). “An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations. Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966”. While the written description requirement does not demand either examples or an actual reduction, actual “possession” or reduction to practice outside of the specification is not enough. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1352 (Fed. Cir. 2010). Rather, it is the specification itself that must demonstrate possession. Id.
In this application, the specification does not describe a representative species of: the genus of Brassica plants , the genus of unidentified QTLs and markers other than SEQ ID NO:1-22 on chromosomes 8, 4 and 1, linked to downy mildew resistance. Singh et al (Journal of Horticultural Science and Biotechnology (2012), 87(2):137-143) provided the IDS indicate that markers linked to genes that provide downy mildew resistance caused by H. parasitica in broccoli cannot be used for downy mildew resistance breeding or detect the resistance in cauliflower due to the genetic variations in broccoli and cauliflower (paragraph bridging pages 137 and 138; pages 140-141). Therefore, substantial variations in structures and function are expected even among Brassica oleracea plants, let alone any Brassica plant, having resistance to downy mildew and comprising QTLs on chromosomes 8, 4 and/or 1.
Further, for claims 1, 6, 10, 14-17, 21-27, 33, 35-36 and 47, Applicant has not demonstrated possession of the QTLs by reciting sufficient structure in combination with a recitation of function. While the deposit of the seed recited in claim 5, 9 and 13 inherently contains the QTLs, the deposit is Not a substitute for a written description of the claimed invention. See MPEP 2163 (I) and Amgen, Inc. v. Chugai Pharm., 927 F.2d 1200, 1206, 18 USPQ2d 1016, 1021 (Fed. Cir. 1991) where it states “one must define a compound by "whatever characteristics sufficiently distinguish it". The specification does not describe a single QTL on chromosome 8, 4 or 1 that confers resistance to downy mildew in Brassica. Applicant provides a deposit of the seed of Brassica oleracea comprising QTLs on chromosomes 8, 4 and 1 and linked markers of SEQ ID NO: 1-22. However, this deposit is insufficient to show possession of these QTLs because not all the claims recite the deposit. In addition, no specific QTL is described in the specification (except the QTL that is inherently present in the deposited seed) and its location is somewhere between marker sequence of SEQ ID NO: 1 and 7 on chromosome 8, or somewhere between marker sequence of SEQ ID NO: 8 and 16 on chromosome 4, or somewhere between marker sequence of SEQ ID NO: 17 and 22; and can be identified by SEQ ID NO: 1-22. Not all the claims recite the markers. Claims 33 and 35 require selection of brassica plants comprising QTL on chromosomes 8 and 4 and/or 1. However, no markers for selection are recited in the claims. Claim 36 require introducing a QTL on chromosome 8 and optionally a QTL on chromosome 4 and/or QTL on chromosome 1 in any Brassica plant. However, no QTL is described in the specification by specific location or by sequence structure that is required for the resistance to H. parasitica. The only information provided in the specification is the identification of molecular markers linked to the QTLs and the large chromosomes (chromosomes 8, 4 and 1) carrying these QTLs.
The Federal Circuit has recently clarified the application of the written description requirement to inventions in the field of biotechnology. See University of California v. Eli Lilly and Co., 119 F.3d 1559, 1568, 43 USPQ2d 1398; 1406 (Fed. Cir. 1997). In summary, the court stated that a written description of an invention requires a precise definition, one that defines the structural features of the chemical genus that distinguishes it from other chemical structures. A definition by function does not suffice to define the genus because it is only an indication of what the gene does, rather than what it is. The court goes on to say, “A description of a genus of cDNAs may be achieved by means of a recitation of a representative number of cDNAs, defined by nucleotide sequence, falling within the scope of the genus or of a recitation of structural features common to members of the genus, which features constitute a substantial portion of the genus.” See University of California v. Eli Lilly and Co., 119 F.3d 1559; 43 USPQ2d 1398, 1406 (Fed. Cir. 1997).
It is true that functionally defined claims can meet the written description requirement if a reasonable structure-function correlation is established, whether by the inventor as described in the specification or known in the art at the time of the filing date” (AbbVie, 759 F.3d at 1298, reiterating Enzo Biochem, Inc., 323 F.3d at 964)(emphasis added). However, in the instant application, there is insufficient evidence of such an established structure-function correlation. Therefore, the specification has not met either of the two elements of the written description requirement as set forth in the court's decision in Eli Lilly, and has not shown her/his possession of the claimed genus at the time of the application.
The specification describes no method of using the exemplified or non-exemplified markers for introducing Hyaloperonospora brassica resistance in exemplified or non-exemplified Brassica plants. Further, since the specification fails to sufficiently describe the genus of Brassica plant/seed comprising a genus of QTLs on chromosomes 8 and 4 and/or 1 which confer resistance to Hyaloperonospora brassica, a method that employs said Brassica plant, a progeny, a propagation material or a tissue culture prepared from said Brassica plant are similarly not described.
Therefore, the specification fails to sufficiently describe the claimed invention in such full, clear, concise, and exact terms that a skilled artisan would recognize that Applicant was in possession of the invention as broadly claimed at the time of filing.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3-17, 21-27, 33-36 and 47 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-23 and 25-32 and 37-41 of U.S. Patent No. 12,054, 728 B2. Although the claims at issue are not identical, they are not patentably distinct from each other because the claims of both the instant application and the issued patent are drawn to a Brassica plant that is resistant to Hyaloperonaspora brassicae, comprising a QTL on chromosome 8, 4 and 1, wherein the resistance is detectable in the cotyledon stage, wherein the presence of the OTL on chromosome 8 can be identified by use of at least one of the markers of SEQ TD NOS: 1 to 7, the presence of chromosome 4 can be identified by the use of markers SEQ ID NO: 8-16, the presence of chromosome 1 can be identified by the use of markers SEQ ID NO: 17-22, wherein when the QTLs that are homozygously present in the plant has an increased resistance to Hyaloperanospora brassicae as compared to the resistance Hyaloperonospora brassicae of a Brassica plant comprising only the OTL on chromosome 8; wherein said QTLs is as present in Brassica oleracea plant, sample of seed deposited under NCIMB Accession no. 43346; tissue culture, seed, cell, a progeny or a propagation material or a harvested part/processed product of said brassica plant and methods of introducing said QTLs into other brassica and selecting plants containing the QTLs.
Claims 1, 6, 10, 14-15-17, 21-27, 33, 36 and 47 of the instant application, drawn to any Brassica plant comprising a QTL on chromosomes 8, 4 and/or 1 that confers resistant to Hyaloperanospora brassicae and methods of producing said plant, are broader in scope and encompass the claims of the issued patent, drawn to an agronomically elite Brassica oleracea plant comprising a QTL located on chromosome 8 between SEQ ID NOs: 1 and 7, a QTL on chromosome 4 located between SEQ ID NOs: 8 and 16, and/or a QTL on chromosome 1 located between SEQ ID NOs: 17 and 22; wherein the QTLs on chromosomes 8, 4 and 1 each is as present in the genome of Brassica oleracea plant , sample of seed deposited under NCIMB Accession no. 43346; said agronomically elite Brassica oleracea plant is broccoli, cauliflower, cabbage or kohlrabi. Therefore, the claims of the instant application define a genus encompassing the species claimed in the issued patents. All other claim limitations are substantially similar. Therefore, the claimed invention is obvious over the claims of the issued patent.
Remarks
No claim is allowed.
Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to MEDINA AHMED IBRAHIM whose telephone number is (571)272-0797. The examiner can normally be reached Monday-Friday, 9:00 - 6:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, BRATISLAV STANKOVIC can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
MEDINA AHMED. IBRAHIM
Primary Examiner
Art Unit 1662
/MEDINA A IBRAHIM/Primary Examiner, Art Unit 1662
ATTACHMENT TO OFFICE ACTION
REQUEST FOR INFORMATION UNDER 37 CFR § 1.105
1. Applicant and the assignee of this application are required under 37 CFR § 1.105 to provide the following information that the examiner has determined is reasonably necessary to the examination of this application.
2. This request is being made for the following reasons:
Applicant is claiming a Brassica plant/seeds with deposit number NCIMB 43346, but the instant specification is silent about what starting materials and methods were used to produce the Brassica plant/seed, or the breeding history and parental lines. The requested information is required to make a meaningful and complete search of the prior art.
3. In response to this requirement, if known, please provide answers to each of the following interrogatories eliciting factual information:
(i) Please supply the breeding methodology and history regarding the development of the instant brassica plant with the deposited seed.
a) Such information should include all of the public or commercial designations/denominations used for the original parental lines.
b) Information pertaining to the public availability of the original parental lines should be set forth.
c) The breeding method used should be set forth, such as whether single seed descent, bulk method, backcross method, or some other method was used.
d) The filial generation in which the instant plant was chosen should be set forth.
e) Information pertaining to the homozygosity or heterozygosity of the parents as well as the instant plant should be set forth.
f) Are there any patent applications or patents in which sibs or parents of the instant plant are claimed? If so, please set forth serial numbers and names of the sibs or parents.
4. If Applicant views any or all of the above requested information as a Trade Secret, then Applicant should follow the guidance of MPEP § 724.02 when submitting the requested information.
5. In responding to those requirements that require copies of documents, where the document is a bound text or a single article over 50 pages, the requirement may be met by providing copies of those pages that provide the particular subject matter indicated in the requirement, or where such subject matter is not indicated, the subject matter found in applicant’s disclosure. Please indicate where the relevant information can be found.
6. The fee and certification requirements of 37 CFR § 1.97 are waived for those documents submitted in reply to this requirement. This waiver extends only to those documents within the scope of this requirement under 37 CFR § 1.105 that are included in the applicant’s first complete communication responding to this requirement. Any supplemental replies subsequent to the first communication responding to this requirement and any information disclosures beyond the scope of this requirement under 37 CFR § 1.105 are subject to the fee and certification requirements of 37 CFR § 1.97 if submitted subsequent to a first Office action on the merits.
7. The applicant is reminded that the reply to this requirement must be made with candor and good faith under 37 CFR § 1.56. Where the applicant does not have or cannot readily obtain an item of required information, a statement that the item is unknown or cannot be readily obtained may be accepted as a complete reply to the requirement for that item.
8. This requirement is an attachment of the enclosed Office action. A complete reply to the enclosed Office action must include a complete reply to this requirement. The time period for reply to this requirement coincides with the time period for reply to the enclosed Office action.
/BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662