Prosecution Insights
Last updated: October 04, 2026
Application No. 18/632,901

Methods For Determining Antimicrobial Drug Resistance

Non-Final OA §102§112
Filed
Apr 11, 2024
Priority
Jul 05, 2019 — EU 19184836.5 +1 more
Examiner
JOHANNSEN, DIANA B
Art Unit
1682
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
BIOMERIEUX
OA Round
1 (Non-Final)
53%
Grant Probability
Moderate
1-2
OA Rounds
1y 7m
Est. Remaining
96%
With Interview

Examiner Intelligence

Grants 53% of resolved cases
53%
Career Allowance Rate
269 granted / 506 resolved
-6.8% vs TC avg
Strong +43% interview lift
Without
With
+42.8%
Interview Lift
resolved cases with interview
Typical timeline
4y 0m
Avg Prosecution
33 currently pending
Career history
549
Total Applications
across all art units

Statute-Specific Performance

§101
18.0%
-22.0% vs TC avg
§103
25.3%
-14.7% vs TC avg
§102
12.2%
-27.8% vs TC avg
§112
37.6%
-2.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 506 resolved cases

Office Action

§102 §112
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . This application is a continuation of US 16/920,109, filed 02 July 2020 (now abandoned), and claims foreign priority benefit of EP19184836.5, filed 05 July 2019. Election/Restrictions Applicant’s election without traverse of the species of Klebsiella and “the ‘mutations’ described in row 1697 of Table I, AR0000869-D79G (DNA sequence of SEQ ID NO: 6349, prt sequence of SEQ ID NO: 6350), which when present indicates resistance to Cefotaxime, Ceftazidime, Ceftriaxone, and Aztreonam, as disclosed in Table II in entry numbers 24656, 24657, 24658, and 24766”, in the reply filed on 06 April 2026, is acknowledged. All of pending claims 35-46 are under consideration as directed to the elected species. Rejection – Improper Markush Grouping Claims 35-46 are rejected on the basis that the claims contain an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). A Markush grouping is proper if the alternatives defined by the Markush group (i.e., alternatives from which a selection is to be made in the context of a combination or process, or alternative chemical compounds as a whole) share a “single structural similarity” and a common use. A Markush grouping meets these requirements in two situations. First, a Markush grouping is proper if the alternatives are all members of the same recognized physical or chemical class or the same art-recognized class, and are disclosed in the specification or known in the art to be functionally equivalent and have a common use. Second, where a Markush grouping describes alternative chemical compounds, whether by words or chemical formulas, and the alternatives do not belong to a recognized class as set forth above, the members of the Markush grouping may be considered to share a “single structural similarity” and common use where the alternatives share both a substantial structural feature and a common use that flows from the substantial structural feature. See MPEP § 2117. The Markush grouping of claims 35-46 - which is reflected in both the numerous alternative entries of Table 1 (which is referenced in the independent claims), and in the references to different alternative bacteria - is improper because the alternatives defined by the Markush grouping do not share both a single structural similarity and a common use for the following reasons: the claims recite in the alternative different variations having both different structural characteristics and different associated functional features (specifically, associations with different types of antimicrobial resistance, different genes, etc.), rather than any common structure and a common use that flows therefrom. The claims at present read on numerous different methods, as they recite both several alternative groups of microorganisms, and - with regard to each such microorganism - numerous different alternative variations, each of which has a different structure, and different associated resulting functional characteristics. Thus, the claims embrace multiple improper Markush groupings: a) the grouping of different bacteria, which are not functionally equivalent, and which lack a single structural similarity and common use; and b) within each group of bacteria, the grouping of distinct/different variations and corresponding sequences (which also lack functional equivalence, as well as a single structural similarity and common use). To overcome this rejection, Applicant may set forth each alternative (or grouping of patentably indistinct alternatives) within an improper Markush grouping in a series of independent or dependent claims and/or present convincing arguments that the group members recited in the alternative within a single claim in fact share a single structural similarity as well as a common use. Claim Objections Claims 39-41 are objected to because of the following informalities: in independent claim 39, the abbreviation “AMR” is employed without first providing the full terminology for which “AMR” stands. While it is noted that “AMR” is interpreted as being used in the same manner as it is employed in independent claim 35 (which recites “antimicrobial resistance marker (AMR)”), appropriate correction is required. Claims 42-46 are objected to because of the following informalities: in independent claim 42, there are two different steps identified as “(c)”. While it is clear that the last step c) of “exposing the population….” follows the step c) of “identifying”, appropriate correction is required (which simply requires amending the final step (c) to substitute “(d)”). Claim Rejections - 35 USC § 112(b)/second paragraph The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 35-46 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claims 35-38 are indefinite over the recitation in independent claim 35 (at (d)) of the limitation “administering…an antimicrobial drug that is different from the one or more antimicrobial drugs…”. Claim 35 previously recites “at least one antimicrobial drug”, but not “one or more antimicrobial drugs”, such that clear antecedent basis is lacking for the recitation of “the one or more” drugs. Further, as the type of drug employed in the “administering” is defined by reference to “the one or more….” drugs, further clarification is needed to ensure that the properties of the drug being administered are clear. Claims 35-38 are also indefinite over the recitation in independent claim 35 of the limitation “(b’3) performing or having performed the genotyping assay to determine the presence or absence in the Klebsiella species of at least one Klebsiella AMR, wherein the Klebsiella AMR has the nucleotide sequence of the SEQ ID NO: set forth in column I of rows 1587 to 2448 of Table I” (which language sets forth the nature of what is required with respect to the genotyping assay directed to the elected species). While this language is clearly a further limitation of the previously recited “(b) performing or having performed a genotyping assay on the sample” – such that the claim encompasses performing or “having performed” such testing, with the potential outcome embracing either “presence or absence” of a recited target sequence – the language “the nucleotide sequence of the SEQ ID NO: set forth in column I of rows 1587 to 2448 of Table I” does not make sufficiently clear what “the nucleotide sequence” is, which renders the boundaries of the claims under. First, the reliance on Table I renders the claims indefinite because it is unclear what elements of the Table are/are not actually part of the claimed invention (and to the extent that they are, what those elements actually require). As is discussed in MPEP 2173.05(s), Tables are only permissible in claims in circumstances when there is no practical way to define the invention in words, and where it more concise to incorporate a Table by reference. In the instant case, given the disclosure of nucleotide sequence information (via SEQ ID NO), there are clearly alternative ways in which the claimed invention could be more concisely and clearly defined within the claims. Second, the language “the SEQ ID NO: set forth in column I of rows 1587 to 2448” is additionally confusing as there is no such particular SEQ ID NO, but rather various different listed SEQ ID NOS. It is therefore not clear what is required by this language (and while it is noted that Applicant’s election of species has identified the particular sequences SEQ ID NO: 6349 and SEQ ID NO: 6350, these are not limitations that presently appear in the claims). As such, the boundaries of what is being claimed is not made clear by the present claim language. Claims 37 and 38 each recite the limitation "the at least one antimicrobial drugs" (see lines 1-2 of each claim). There is insufficient antecedent basis for this limitation in the claims. More particularly, claim 35 (from which claims 37-38 depend) recites “at least one antimicrobial drug” (as well as the language “the one or more antimicrobial drugs”, which is indefinite as discussed above); however, there is no prior reference to ‘at least one antimicrobial drugs”. Claims 39-41 are indefinite over the recitation in independent claim 39 of the limitation “where the microorganism is a Klebsiella species, the presence or absence of at least one Klebsiella AMR, wherein the Klebsiella AMR has the nucleotide sequence of the SEQ ID NO: set forth in column I of rows 1587 to 2448 of Table I” (which language sets forth the nature of what the sample from the patient “has been tested” for, as directed to the elected species). The language “the nucleotide sequence of the SEQ ID NO: set forth in column I of rows 1587 to 2448 of Table I” does not make sufficiently clear what “the nucleotide sequence” is, which renders the boundaries of the claims under. First, the reliance on Table I renders the claims indefinite because it is unclear what elements of the Table are/are not actually part of the claimed invention (and to the extent that they are, what those elements actually require). As is discussed in MPEP 2173.05(s), Tables are only permissible in claims in circumstances when there is no practical way to define the invention in words, and where it more concise to incorporate a Table by reference. In the instant case, given the disclosure of nucleotide sequence information (via SEQ ID NO), there are clearly alternative ways in which the claimed invention could be more concisely and clearly defined within the claims. Second, the language “the SEQ ID NO: set forth in column I of rows 1587 to 2448” is additionally confusing as there is no such particular SEQ ID NO, but rather various different listed SEQ ID NOS. It is therefore not clear what is required by this language (and while it is noted that Applicant’s election of species has identified the particular sequences SEQ ID NO: 6349 and SEQ ID NO: 6350, these are not limitations that presently appear in the claims). As such, the boundaries of what is being claimed is not made clear by the present claim language. Claims 42-46 are indefinite over the recitation in independent claim 42 of the limitation “exposing the population….to an antimicrobial drug that is different from the one or more antimicrobial drugs…”. Claim 42 previously recites “at least one antimicrobial drug”, but not “one or more antimicrobial drugs”, such that clear antecedent basis is lacking for the recitation of “the one or more” drugs. Further, as the type of drug employed in the “exposing” is defined by reference to “the one or more….” drugs, further clarification is needed to ensure that the properties of the drug being administered are clear. Claims 42-46 are also indefinite over the recitation in independent claim 42 of the limitation “(b’3) performing or having performed the genotyping assay to determine the presence or absence in the Klebsiella species of at least one Klebsiella AMR, wherein the Klebsiella AMR has the nucleotide sequence of the SEQ ID NO: set forth in column I of rows 1587 to 2448 of Table I” (which language sets forth the nature of what is required with respect to the genotyping assay directed to the elected species). While this language is clearly a further limitation of the previously recited “(b) performing or having performed a genotyping assay on the sample” – such that the claim encompasses performing or “having performed” such testing, with the potential outcome embracing either “presence or absence” of a recited target sequence – the language “the nucleotide sequence of the SEQ ID NO: set forth in column I of rows 1587 to 2448 of Table I” does not make sufficiently clear what “the nucleotide sequence” is, which renders the boundaries of the claims under. First, the reliance on Table I renders the claims indefinite because it is unclear what elements of the Table are/are not actually part of the claimed invention (and to the extent that they are, what those elements actually require). As is discussed in MPEP 2173.05(s), Tables are only permissible in claims in circumstances when there is no practical way to define the invention in words, and where it more concise to incorporate a Table by reference. In the instant case, given the disclosure of nucleotide sequence information (via SEQ ID NO), there are clearly alternative ways in which the claimed invention could be more concisely and clearly defined within the claims. Second, the language “the SEQ ID NO: set forth in column I of rows 1587 to 2448” is additionally confusing as there is no such particular SEQ ID NO, but rather various different listed SEQ ID NOS. It is therefore not clear what is required by this language (and while it is noted that Applicant’s election of species has identified the particular sequences SEQ ID NO: 6349 and SEQ ID NO: 6350, these are not limitations that presently appear in the claims). As such, the boundaries of what is being claimed is not made clear by the present claim language. Claims 45-46 are also each indefinite over the recitation of the language “the one or more antimicrobial drugs….”, because it is unclear how independent claim 42 is being further limited. While claim 42 does employ the language “one or more antimicrobial drugs”, that language is indefinite as used in that claim (as discussed above), and thus the manner in which claims 45-46 are further limiting is also unclear. It is suggested that the claims be amended to employ consistent terminology throughout, i.e., either “at least one antimicrobial drug” or “one or more antimicrobial drugs”. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claim(s) 35-46 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Phillippe et al (PLOS ONE 10(9):e0138828, pages 1-19 [Sept 2015]; cited in IDS), as evidenced by Wu et al (Biotechnology of Biofuels 10:248 [2017]; cited in IDS). Initially, it is reiterated that the claims are under consideration as directed to the elected species of Klebsiella, and “the ‘mutations’ described in row 1697 of Table I, AR0000869-D79G (DNA sequence of SEQ ID NO: 6349, prt sequence of SEQ ID NO: 6350), which when present indicates resistance to Cefotaxime, Ceftazidime, Ceftriaxone, and Aztreonam, as disclosed in Table II in entry numbers 24656, 24657, 24658, and 24766”. However, the present claims rely on unclear/indefinite references to information regarding the elected species that is presented in Table I (see the indefiniteness rejections above), while also clearly encompassing identification of “presence or absence” of a resistance marker or markers (such that the claims embrace methods in which the genotyping [independent claims 35 and 42] or testing [independent 39] of the claims with regard to a target bacterium/target sequence therein may have had either a positive or negative outcome, i.e., any assay/test sufficient to establish presence/absence meets the requirements of the claims with respect to genotyping/testing). Particularly in view of this breadth and lack of clarity, the Phillipe et al reference anticipates the claims, for the reasons given below (as all limitations of the claims are met, to the extent that they are presently understood). Furthermore, it is noted that based on applicant’s election of “Klebsiella” and reference to row 1697 of Table I (and SEQ ID NOS 6349/6350) in the response to species election, the bacterial species of Klebsiella aerogenes is addressed herein (although it is reiterated that it is not clear what the claims require, as discussed above). As evidenced by Wu et al, the species Klebsiella aerogenes is also known in the art as Enterobacter aerogenes (see page 2/15, left column, second full paragraph). Phillipe et al disclose collecting a series of clinical isolates from patients infected with multidrug resistant (MDR) E. aerogenes (aka K. aerogenes), and performing genome-wide analysis on the isolates to track changes in MDR profiles (see entire reference, particularly the Abstract and page 6/9, first two full paragraphs under “Results”). The collection of isolates taught by Phillipe et al constitutes an “obtaining” meeting the requirements of (a) of claims 35 and 42, and the whole genome analysis performed by Phillipe et al meets the requirements of (b) of claims 35 and 42, as well as the prior testing of a sample from a patient of independent claim 39, given that Phillipe et al disclose performing whole genome analysis and sequencing of isolates to identify resistance profiles (see again the entire reference, particularly page 6/9, as well as the sequencing described at page 5/19 bridging to 6/19, Table 1, and the discussion of ‘Comparative genomics” on page 12/19). Further, the detection of variations in sequencing data and identification of mutations associated constitute an “identifying” as set forth in independent claims 35 and 42 (including with regard to the elected antibiotics cefotaxime and ceftazidime) (see page 5/19 bridging to 6/19, Table 1, and the Results of “Comparative genomics between the clinical isolates and identification of mutations associated to MDR” on page 12/19). Phillipe et al further disclose - following sequence analysis and characterization with respect to MDR - administering different antimicrobial drugs to patients (so as to employ drugs different from those to which the patient samples exhibit resistance); see again page 6/19. It is noted that the claims as written do not require administration of any particular drugs (and again, as the claims recite that genotyping/testing regarding “presence or absence” of a target sequence is embraced thereby, any “administering” of a drug to which the tested/genotyped microorganism is not resistant is embraced by the present claim language). With further regard to the genotyping/testing required by the claims, as Phillipe et al disclose whole genome analysis, they inherently disclose a genotyping/testing that is sufficient to meet the claims; it is further noted that dependent claims 36 and 44 make clear that the type of sequencing taught by Phillipe et al is considered a type of genotyping (and Phillipe et al thus also anticipate these claims). With further regard to claim 42 and claims dependent therefrom, and particularly in view of dependent claim 43, which states that “the sample is obtained from a patient” - the administering of drugs to patients as taught by Phillippe et al meets the requirements of the “exposing” of (second step) c) of independent claim 42. With further regard to dependent claims 37-38, 40-41, and 45-46, it is reiterated that Phillippe et al teach resistance to antimicrobial drugs encompassed by the claims; see again Table 1 and page 6/19. Phillippe et al thus anticipate claims 35-46. Conclusion The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. While it is reiterated that all of claims 35-46 are anticipated for the reasons set forth above, it is also noted that the prior art as exemplified by Fröse et al (US 2019/0348154 [14 Nov 2019; filed 12 May 2017]; cited herein) discloses an Enterobacter aerogenes sequence that shares 100% identity with instant SEQ ID NO: 6349 (with the only difference resulting from the use of “N” [for any nucleotide] at nucleotide 236 in Applicant’s SEQ ID NO: 6349); see the alignment depicted in Appendix A below. Any inquiry concerning this communication or earlier communications from the examiner should be directed to DIANA B JOHANNSEN whose telephone number is (571)272-0744. The examiner can normally be reached Monday-Friday, 7:30 am-3:30 pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Wu-Cheng Winston Shen can be reached at (571) 272-3157. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /DIANA B JOHANNSEN/Primary Examiner, Art Unit 1682 APPENDIX A US-16-300-447-86870 Sequence 86870, US/16300447 Publication No. US20190348154A1 GENERAL INFORMATION APPLICANT: Curetis GmbH TITLE OF INVENTION: Stable pan-genomes and their use FILE REFERENCE: 602-39 PCT CURRENT APPLICATION NUMBER: US/16/300,447 CURRENT FILING DATE: 2018-11-09 PRIOR APPLICATION NUMBER: EP 16 169 695.0 PRIOR FILING DATE: 2016-05-13 NUMBER OF SEQ ID NOS: 537429 SEQ ID NO 86870 LENGTH: 1410 TYPE: DNA ORGANISM: Enterobacter aerogenes Query Match 100.0%; Score 1409; Length 1410; Best Local Similarity 99.9%; Matches 1409; Conservative 0; Mismatches 1; Indels 0; Gaps 0; Qy 1 ATGGCCACCCATTTGGTCTGGTTTCGCATGGATTTACGCCTTAACGATAATCTGGCGCTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 ATGGCCACCCATTTGGTCTGGTTTCGCATGGATTTACGCCTTAACGATAATCTGGCGCTG 60 Qy 61 GCCGCCGCCTGCCGCGACCCGCAGGCGCAGGTGCTGGCGCTGTATATCGCTACGCCAGAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GCCGCCGCCTGCCGCGACCCGCAGGCGCAGGTGCTGGCGCTGTATATCGCTACGCCAGAA 120 Qy 121 CAGTGGCGCCAACATCACATGGCGCCGCGCCAGGCGGCCTTTATCGCCAGCCATTTACGC 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CAGTGGCGCCAACATCACATGGCGCCGCGCCAGGCGGCCTTTATCGCCAGCCATTTACGC 180 Qy 181 AGCCTCCACGCGGCGTTGGCGGAACGCGGTATTCCGCTGCTGGTAGAAGAAGCGGNCGAT 240 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| Db 181 AGCCTCCACGCGGCGTTGGCGGAACGCGGTATTCCGCTGCTGGTAGAAGAAGCGGACGAT 240 Qy 241 TTCGCCGCCAGCATCGAGTTGCTAAAGCGCTTTTGTAAACAGCACCAGGTGAGCCATCTA 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 TTCGCCGCCAGCATCGAGTTGCTAAAGCGCTTTTGTAAACAGCACCAGGTGAGCCATCTA 300 Qy 301 TTTTATAACTATCAGTATGAGTTTAATGAGCGCCGGCGCGACGCCGGTGTTGAGAAAAGC 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 TTTTATAACTATCAGTATGAGTTTAATGAGCGCCGGCGCGACGCCGGTGTTGAGAAAAGC 360 Qy 361 CTGACAGAAGTCACCTGCCAGGGGTTTGACGACAGCGTGCTGTTGCCGCCGGGCAGCGTG 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CTGACAGAAGTCACCTGCCAGGGGTTTGACGACAGCGTGCTGTTGCCGCCGGGCAGCGTG 420 Qy 421 ATGACCGGCAACCGCGAGATGTATAAAGTCTTTACGCCGTTTAAAAATGCCTTTATCCGC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 ATGACCGGCAACCGCGAGATGTATAAAGTCTTTACGCCGTTTAAAAATGCCTTTATCCGC 480 Qy 481 CGCCTGCGTGAAGGGCTGCCGGAGTGCGTGGCGGCGCCGAAACCGCGCCAGTCAGCCACC 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 CGCCTGCGTGAAGGGCTGCCGGAGTGCGTGGCGGCGCCGAAACCGCGCCAGTCAGCCACC 540 Qy 541 CGACAGGCCTCGCCGCTGCCTGAGATCAACTATCCGCAAACGGCATTTGACACCGATCTG 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 CGACAGGCCTCGCCGCTGCCTGAGATCAACTATCCGCAAACGGCATTTGACACCGATCTG 600 Qy 601 TTCGCGGCGGATGAAAAAACGGCGCTGGCTCGATTGCGCGCGTTTTGTCAGCAGCCGGCG 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TTCGCGGCGGATGAAAAAACGGCGCTGGCTCGATTGCGCGCGTTTTGTCAGCAGCCGGCG 660 Qy 661 GCGGATTACGACCAGCAGCGCGATTTTCCGGCGATAGAGGGAACCAGCCGGCTATCGCCG 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 GCGGATTACGACCAGCAGCGCGATTTTCCGGCGATAGAGGGAACCAGCCGGCTATCGCCG 720 Qy 721 TGTCTCGCGGTAGGCGTACTGTCGCCGCGCCAGTGCCTGCATCGCTTGTTACGGGAGCAG 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 TGTCTCGCGGTAGGCGTACTGTCGCCGCGCCAGTGCCTGCATCGCTTGTTACGGGAGCAG 780 Qy 781 CCCGGCGCGCTGGATGGCGAAGCGGGCGCAAGCTGGCTGAACGAGATTATCTGGCGCGAG 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 CCCGGCGCGCTGGATGGCGAAGCGGGCGCAAGCTGGCTGAACGAGATTATCTGGCGCGAG 840 Qy 841 TTCTATCGTCATCTGATGGTTTACTACCCGAAACTGTGTAAAGGCCGGCCGTTTGTCGCC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 TTCTATCGTCATCTGATGGTTTACTACCCGAAACTGTGTAAAGGCCGGCCGTTTGTCGCC 900 Qy 901 TGGACCGACAAGGTCGCCTGGCGCAGCAATGAGGATGAACTGCGGGCCTGGCAACAGGGG 960 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 TGGACCGACAAGGTCGCCTGGCGCAGCAATGAGGATGAACTGCGGGCCTGGCAACAGGGG 960 Qy 961 CAAACCGGTTTCCCCATCGTCGATGCCGCCATGCGGCAGCTTAACGCCACCGGCTGGATG 1020 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 961 CAAACCGGTTTCCCCATCGTCGATGCCGCCATGCGGCAGCTTAACGCCACCGGCTGGATG 1020 Qy 1021 CACAATCGCCTGCGGATGATTGTCGCCAGCTTCCTGGCGAAAGACCTGCGCCTCGACTGG 1080 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1021 CACAATCGCCTGCGGATGATTGTCGCCAGCTTCCTGGCGAAAGACCTGCGCCTCGACTGG 1080 Qy 1081 CGGCACGGAGAGCGCTATTTCATGAGCCAACTGATCGACGGCGATTTGGCGGCCAACAAC 1140 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1081 CGGCACGGAGAGCGCTATTTCATGAGCCAACTGATCGACGGCGATTTGGCGGCCAACAAC 1140 Qy 1141 GGCGGCTGGCAGTGGGCGGCCTCGACCGGTACCGATGCAGCCCCTTATTTTCGTATTTTC 1200 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1141 GGCGGCTGGCAGTGGGCGGCCTCGACCGGTACCGATGCAGCCCCTTATTTTCGTATTTTC 1200 Qy 1201 AATCCGACGACCCAGGGCGAGAAATTTGATAAGCAGGGCGAGTTTATTCGCCGCTGGCTG 1260 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1201 AATCCGACGACCCAGGGCGAGAAATTTGATAAGCAGGGCGAGTTTATTCGCCGCTGGCTG 1260 Qy 1261 CCGGAACTGGCTGAAGTGCCAGAGAAAGCGCTGCATCAGCCGTGGCTGTGGGCGGATAAA 1320 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1261 CCGGAACTGGCTGAAGTGCCAGAGAAAGCGCTGCATCAGCCGTGGCTGTGGGCGGATAAA 1320 Qy 1321 CAGGGGGTAACGCTGAGGTATCCGCGCCCGCTGGTTGACCATAAGCAGGCGCGGCTGGAG 1380 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1321 CAGGGGGTAACGCTGAGGTATCCGCGCCCGCTGGTTGACCATAAGCAGGCGCGGCTGGAG 1380 Qy 1381 ACGCTGGCGGCCTGGGAAGCCGCCAGATAG 1410 |||||||||||||||||||||||||||||| Db 1381 ACGCTGGCGGCCTGGGAAGCCGCCAGATAG 1410
Read full office action

Prosecution Timeline

Apr 11, 2024
Application Filed
Jul 28, 2026
Non-Final Rejection mailed — §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12723282
MULTIPLEX DETECTION OF VULVOVAGINAL CANDIDIASIS, TRICHOMONIASIS AND BACTERIAL VAGINOSIS
2y 3m to grant Granted Sep 01, 2026
Patent 12691112
FGFR TYROSINE KINASE INHIBITORS FOR THE TREATMENT OF UROTHELIAL CARCINOMA
4y 10m to grant Granted Jul 28, 2026
Patent 12674206
Systems And Methods For Treating Patients Having A Genetic Predisposition To Develop Prostate Cancer
6y 0m to grant Granted Jul 07, 2026
Patent 12674207
METHODS AND MATERIALS FOR ASSESSING LOSS OF HETEROZYGOSITY
3y 6m to grant Granted Jul 07, 2026
Patent 12668846
NON-INVASIVE METHOD FOR THE DIAGNOSIS OR SCREENING OF COLORECTAL CANCER AND/OR PRE-CANCEROUS STAGE THEREOF
4y 5m to grant Granted Jun 30, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
53%
Grant Probability
96%
With Interview (+42.8%)
4y 0m (~1y 7m remaining)
Median Time to Grant
Low
PTA Risk
Based on 506 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month