DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant claims domestic benefit under 35 U.S.C. 119(e) to U.S. Provisional Patent Application No. 63/515,558, filed on 7/25/2023 and to U.S. Provisional Patent Application No. 63/499,243, filed 4/30/2023. Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on 5/24/2026 is acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Election/Restrictions
Applicant’s election without traverse of Group 1, 2, 4-9, 11, 13, and 15-18), in the reply filed on 5/24/2026 is acknowledged. Claims 24-26, 29-30, and 32 are herein withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim.
Applicant’s election of the cell-penetrating peptide species TAT p47-67, corresponding to SEQ ID NO: 55 as the cell-penetrating peptide is herein acknowledged. This appears to correlate to SEQ ID NO: 24 for the nucleotide sequence of the vector in claim 18.
Claims 1, 2, 4-9, 11, 13, and 15-18 are pending and have been examined on the merits.
Claim Interpretation
Recited first in claim 1, the term “α-GAL A (wt sp)” appears to mean an alternative wherein the signal peptide is a “wild type” signal peptide from α-GAL A. One can determine from the specification that the human α-GAL A signal peptide is encoded by SEQ ID NO: 51 of the instant invention and comprises the amino sequence of SEQ ID NO:28 (see e.g. [0124]). Thus, under the Broadest Reasonable Interpretation of the claim terms, in view of the specification, claim 1 is being interpreted as encompassing a peptide identical to the wild-type human α-GAL A amino acid sequence, having “a portion” of the enzyme, along with the wild-type α-GAL A signal peptide. The wild-type human protein fulfills these limitations. Claim 4 recites that the sequence comprises at least 80% of the amino acid sequence of SEQ ID NO: 27, which appears to be a substantial portion to the wild-type human enzyme.
The term “viral vector” recited in claims 9, 11, 13, and 15-18 is being interpreted herein under the B.R.I. in view of the specification as a nucleotide sequence which introduces an exogenous or engineered nucleotide sequence into a cell, requiring components from a viral genome necessary to deliver the genetic material (see e.g. [0102] and [0103]). Thus, although recited in the preamble, when considering the knowledge in the art and the descriptions in the specification, this termed is considered to further limit the claimed nucleotides, such that the components necessary for viral replication and infection must be present.
In claims 4-5, 6, and 15-18, the identity requirements for the sequence requirements has been interpreted as requiring, in each case, a sequence comprising a minimum of 80% sequence identity to the indicated sequence. Although presented as alternatives, any sequence having from 80% to 100% of the indicated sequences appears to fulfill the claim limitations.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1, 2, 4-9, 11, 13, and 15-18 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 1 recites “An engineered peptide comprising or consisting of a portion of human alpha-galactosidase A (a-GAL A) or a functional variant thereof, and a portion of signal peptide of tissue plasminogen activator (sp21, sp18, sp20 or sp22) or a-GAL A (wt sp), or a functional variant thereof.”
The claim is indefinite due to the phrases “a portion of human alpha-galactosidase A (a-GAL A) or a functional variant thereof” and “a portion of signal peptide of tissue plasminogen activator (sp21, sp18, sp20 or sp22) or α-GAL A (wt sp) or a functional variant thereof.”. There is no definition or meaning to “a portion of” nor for “a functional variant thereof”. There is no manner for one of ordinary skill to determine the structural limits imposed by these limitations. Under the B.R.I. of the claim, even in view of the specification, the claims recite any sequence that could possibly be considered a portion, which includes any combination of two amino acids found in the sequences. Because the metes and bounds of the claimed peptides are essentially indefinite, the claims are rejected under 112(b).
The dependent claims 2, 7, 8, 9, 11, and 13 do not further limit practically the portion or the functional variant thereof by reciting a specific amino acid or nucleotide sequence that comprises structurally the claimed invention.
Claim 1 also recites “signal peptide of tissue plasminogen activator (sp21, sp18, sp20 or sp22)” and “α-GAL A (wt sp)”. The use of parentheses renders the claim indefinite. Are the elements found in the parentheses meant to further limit the claimed structure? Or are these merely exemplary? Or is this some sort of abbreviation? There is no way to distinguish the meaning of these claim elements. Further, from examining the sequences in the disclosure, it is apparent that “sp21” refers to a signal peptide from tissue plasminogen activator (tPA), which corresponds to a nucleotide sequence comprising SEQ ID NO: 22 and an amino acid sequence having SEQ ID NO: 49. However, “sp18”, “sp20”, and “sp22” are refering to signal peptides derived from luciferases and correspond to the nucleotide sequences of SEQ ID NOs: 19, 21, and 23, respectively (and the amino acid sequences are SEQ ID NOs: 46, 48, and 50, respectively).
For all of these reasons, the meaning of the claimed alternative element “signal peptide of tissue plasminogen activator” cannot be determined. Only the sequences corresponding to sp21 are from tPA. The claim is considered indefinite because the metes and bounds of claim protection sought cannot be determined. Applicant is requested to amend the language to a specific structural definition of the signal peptide (as only an example: “a signal peptide, herein termed sp21, comprising a signal peptide from tissue plasminogen activator, comprising the amino acid sequence of SEQ ID NO: 49” or language similar to this).
Further, the term “α-GAL A (wt sp)” appears to mean an alternative wherein the signal peptide is a “wild type” signal peptide from α-GAL A. There is no clear definition for the α-GAL A signal peptide in claim 1, however one can determine from the specification that the human α-GAL A signal peptide is encoded by SEQ ID NO: 51 of the instant invention and comprises the amino sequence of SEQ ID NO:28 (see e.g. [0124]). It is suggested to amend this portion to “the signal peptide from human α-GAL A, comprising the amino sequence of SEQ ID NO:28” or language similar thereto.
Claim 2 recites “a portion of a cell-penetrating peptide” and there is no meaning nor definition provided for “a portion”. A portion includes any combination of two amino acids found in a sequence. Further, no meaning, definition nor sequence for a cell-penetrating peptide has been provided. Because the metes and bounds of the claimed portion of a cell-penetrating peptide cannot be determined, the claims are rejected under 112(b).
Claim 5 recites the limitation “the portion of sp21, sp18, sp20 or sp22 or the functional variant thereof”. There is insufficient antecedent basis for this limitation in the claim. Claim 1 recites “a portion of signal peptide of tissue plasminogen activator (sp21, sp18, sp20 or sp22)”. The elements of “(sp21, sp18, sp20 or sp22)” are only recited in parenthesis and further, only “sp21” actually refers to a sequence from tPA, as set forth above. It is also unclear if the claim is meant to limit the signal peptide to only these or not. In other words: does claim 5 exclude the alternatives with the wild-type a-Gal A signal peptide? Further, the sequences recited in claim 5 (SEQ ID NO:s 22, 19, 21, or 23) recite nucleotide sequences and not amino acid sequences (see the XML listing that accompanies this application). There is no way to determine what the claims are intended to limit. Thus the claim is indefinite because it is not sure what amino acid sequences are actually required of these limitations. There is no way to determine the actual metes and bounds of claim 5.
Claim 7 recites “the portion of sp21 or the functional variant thereof”. There is insufficient antecedent basis for this limitation in the claim because claim 1 recites “a portion of signal peptide of tissue plasminogen activator (sp21, sp18, sp20 or sp22)”. This is not considered proper antecedent basis because “sp21” is only recited in parenthesis and as an alternative. Further it is unclear if the claim is meant to limit the signal peptide to only sp21, and thus exclude the alternatives with the wild-type a-Gal A signal peptide.
Claim 11 recites “A viral vector comprising an expression cassette comprising or consisting of a first nucleotide sequence encoding the portion of a-GAL A or the functional variant thereof, a second nucleotide sequence encoding the portion of sp21 or wt sp, or the functional variant thereof, and optionally a third nucleotide sequence encoding the portion of the cell-penetrating peptide or the functional variant thereof, and a promoter.”
As an initial matter, it is unclear if “and a promoter” is required of the claim or not. The element follows “optionally”. However, due to the way “and” is used here the claim could be interpreted as either requiring the promoter and just the “third nucleotide sequence” is optional, or the claim could be interpreted as meaning that both the third nucleotide sequence and the promoter is optional. Correction of this ambiguity is required.
The claim is also indefinite because it refers to (1) “the portion of a-GAL A or the functional variant thereof”, (2) “the portion of sp21 or wt sp, or the functional variant thereof”, and (3) “the portion of the cell-penetrating peptide or the functional variant thereof,”. Claim 11 is an independent claim and does not recite or further require the limits of claim 1. There is insufficient antecedent basis for these elements in the claim. For each, there is no manner in which to determine what “the portion... or the functional variant thereof” is referring to.
Claim 16 recites “the portion of sp21, sp18, sp20, or sp22”. There is insufficient antecedent basis for the limitations of sp18, sp20, or sp22 in this claim. Claim 16 depends on claim 11, which only recites “sp21”. The other signal peptides are not presented as options in claim 11 and thus the claim is indefinite as presented.
In claims 4-5, 6, and 15-18, a list of alternative sequence identity limitations are presented, in the form of: “with at least 80%, 85%, 90%, 95%, 99%, or 100% identity to SEQ ID NO: XX”. In such cases, a broad range or limitation together with a narrow range or limitation that falls within the broad range or limitation (in the same claim) may be considered indefinite if the resulting claim does not clearly set forth the metes and bounds of the patent protection desired. See MPEP § 2173.05(c). In the present instance, each of claims 4-5, 6, and 15-18 recites the broadest recitation as being at least 80% identical to one of the indicated sequence, and the claim also recite “85%, 90%, 95%, 99%, or 100% identity” which is the narrower statement of the range/limitation. The claims are considered indefinite because there is a question or doubt as to whether the feature introduced by such narrower language is (a) merely exemplary of the remainder of the claim, and therefore not required, or (b) a required feature of the claims. It is implied that by reciting at least 80% sequence identity, all of the sequences having the narrow percent identity limitations (e.g. “85%, 90%, 95%, 99%, or 100%) are also encompassed. It is suggested that the claims be amended to recite only a single range or a single minimal sequence identity requirement. Further limitations of the sequence identity may be presented in additional dependent claims, if so desired.
All other claims depend directly or indirectly from the rejected claims and are, therefore, also rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, for the reasons set forth above.
Claim Rejections - 35 USC § 101
35 U.S.C. 101 reads as follows:
Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title.
Claims 1, 4, 5, and 7 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a product of nature without significantly more.
Claims 9, 11, 13, and 15-18 are drawn to “viral vectors” comprising nucleotide sequences encoding an engineered peptide. Due to the description in the specification ([0102]-[0103]), and in view of the accepted meaning of these terms in the art, one can determine that these claims refer to nucleotide-containing vectors which contain elements for replication and infection of target cells that clearly amount to significantly more than the naturally-occurring sequences. Thus, these claims are deemed eligible by the streamlined analysis described in MPEP § 2106, subsection III and 2106.06, because when viewed as a whole, the claims clearly do not seek to tie up any judicial exception (e.g. the product of nature). Further, these would have markedly distinct characteristics, both structurally and functionally, when compared to the naturally-occurring nucleotide sequences, and thus would be eligible based on Step 2A, Prong 1.
Under the B.R.I. in view of the specification, claims 1, 2, and 4-8 are drawn to peptides comprising at least a portion of human alpha-galactosidase A (α-Gal A). These are nature-based products, because the natural human protein is encompassed in the claims. For determining subject matter eligibility, the following analysis was considered, per MPEP § 2106.
Patent Eligibility Analysis Step 1: Step 1 of the eligibility analysis asks: is the claim to a process, machine, manufacture or composition of matter? Yes, the claims are directed to a composition, either an engineered peptide or a viral vector. (Claims 1, 2, 4-8, STEP 1: YES).
Patent Eligibility Analysis Step 2A Prong 1: Step 2A, prong 1 asks: does the claim recite an abstract idea, law of nature, or a natural phenomenon (product of nature)?
Claims 1, 2, and 4-8 each require an engineered peptide, wherein the peptide comprises a portion of human alpha-galactosidase A (α-Gal A). Claim 1 further recites that the peptide comprises a portion of a signal peptide, and the signal peptide is either from a tissue plasminogen activator or an α-Gal A signal peptide.
Claim 2 and claims 6 and 8 dependent thereof require an additional cell-penetrating peptide, which appears to be distinct from the alpha-galactosidase A. However these cell-penetrating peptides could also be naturally-derived.
Thus, the B.R.I. of claims 1, 2, and 5-8 include limitations encompassing natural products, specifically, the wild-type protein of human alpha-galactosidase A with an endogenous α-Gal A signal peptide.
When a claim recites a nature-based product limitation, the markedly different characteristics (MDC) analysis is used to determine whether the natural product has markedly different characteristics from its natural counterpart (see MPEP 2106.04(c)).
In this case, the appropriate natural counterpart for the engineered peptide of claims 1, 2, and 4-8 would be at the natural occurring human alpha-galactosidase A.
The second step in the MDC analysis is to identify appropriate characteristics to compare. Appropriate characteristics can be expressed as the nature-based product’s structure, function, and/or other properties, and are evaluated on a case-by-case basis. In this case, the appropriate characteristics include: the structure of the enzyme, typically determined by the sequence, and the enzyme’s functional properties, particularly the localization and activity. The final step in the markedly different characteristics analysis is to compare the characteristics of the claimed nature-based product to its naturally-occurring counterpart in its natural state, in order to determine whether the characteristics of the claimed product are markedly different. The courts have emphasized that to show a marked difference, a characteristic must be changed as compared to nature, and cannot be an inherent or innate characteristic of the naturally-occurring counterpart or an incidental change in a characteristic of the naturally occurring counterpart. Myriad, 569 U.S. at 580, 106 USPQ2d at 1974-75. Thus, in order to be markedly different, the inventor must have caused the claimed product to possess at least one characteristic that is different from that of the counterpart (MPEP § 2016.04(c).II.C.). If there is no change in any characteristic, the claimed product lacks markedly different characteristics, and is a product of nature exception.
For claim 1, no characteristics of a naturally-derived human alpha-galactosidase A with an endogenous α-Gal A signal peptide are markedly changed when compared to the naturally occurring counterpart. The naturally-occurring enzyme, having the full length sequence including the wild-type signal peptide for α-Gal A is encompassed by the claims. The claimed protein (or engineered peptide) having the exact same sequence as the naturally-occurring enzyme is clearly a product of nature exception, and has all of the same properties.
For claim 4, the amino acid sequence of SEQ ID NO: 27 is 100% identical to a portion of the wild-type sequence starting at the 32nd amino acid of the wild-type enzyme. SEQ ID NO: 28 is identical to the first 31 amino acids of the wild-type sequence (see the alignments at the end of this action). Thus, an engineered peptide having α-Gal A or “wt sp”, SEQ ID NO: 28, fused to SEQ ID NO: 27 would be identical and have all of the properties of the wild-type sequence. Claims 1 and 4 are thus found to clearly the recite naturally-occurring enzyme.
Claims 5 and 7 further limit the sequence for the alternative of “the portion of sp21”. However, claim 1 recites in the alternative that the signal peptide may comprise “α-Gal A (wt sp)”. In light of the 112(b) issues discussed above and in consideration of the B.R.I. of the claims, the dependent claims 5 and 7 limit the identity and structure of the alternative having sp21 (or maybe sp18, sp20, or sp22) but there is no language that further excludes the peptide from having the α -Gal A (wt sp) signal peptide. Thus claims 5 and 7 are also found to encompass the wild-type enzyme, as the further elements only pertains to one of the alternatives.
Therefore, the claimed product lacks markedly different characteristics, and is a product of nature exception (Claims 1, 4-5, and 7, Step 2A, Prong 1: YES).
Claims 2, 6, and 8 require that the peptide comprises a cell-penetrating peptide. When considering the claimed engineered peptide as a whole, it is evident that the inclusion of the cell-penetrating peptide, as described in the specification (at [0015], [0019], [0105]), will result in structural properties and functional activity (i.e. the cell-penetrating activity) that are not present in endogenous human α-Gal A (Claims 2, 6, and 8, Step 2A, Prong 1: NO). Thus these claims are not drawn to a judicial reception and are patent eligible.
Patent Eligibility Analysis Step 2A Prong 2: Step 2A, prong 2 asks: does the claim recite additional elements that integrate the judicial exception into a practical application?
Claims 1 and 4 do not recite any additional elements other than the product of nature exception, specific limitations regarding the natural compositions (i.e. the sequence of the a-Gal A, which includes the wild-type sequence), and functional limitations thereof.
Claim 5 recites sequences that could comprise “sp21”, “sp18”, “sp20, or “sp22”. However, as explained above, due to the lack of clarity in the claims and the ambiguity regarding the signal peptide, it is deemed that these elements only further limit the alternatives of the signal peptide, and that the claims still comprises the alternative wherein the signal peptide is the wild-type sequence. Claim 7 appears to recite that the signal peptide is fused to the N-terminus of the enzyme. None of the elements differentiate the claims from the natural product, nor does it recite a practical application thereof.
Therefore, the judicial exception is not integrated into a practical application because the claims do not recite any additional elements other than the naturally-occurring product(s) and innate functional characteristics thereof (Claims 1, 4-5, and 7, Step 2A, Prong 2: NO).
Patent Eligibility Analysis Step 2B: Does the claim recite additional elements that amount to significantly more than the judicial exception?
When considered individual or in combination, the claims do not amount to more than the judicial exception. Because claims 1, 4-5, and 7 encompass the wild-type enzyme (as one of the potential alternatives), the claims are all deemed to be patent ineligible. The claims do not recite any practical additional elements that amount to significantly more than the exception.
The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception (Claims 1, 4-5, and 7, Step 2B: NO).
As such, the claims do not qualify as eligible subject matter. For these reasons claims 1, 4-5, and 7 are rejected under section 101 as being directed to non-statutory subject matter.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
(a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention.
Claims 1, 4, 9, 11, 13, 15, and 17 are rejected under 35 U.S.C. 102(a)(1)/(a)(2) as being anticipated by Hordeaux (WO-2022076803-A1, published April 14, 2022 and filed October 8, 2021. This is a PCT application which corresponds to US PGPub No. 20230365955, published November 16, 2023. For convenience, paragraph numbers corresponding to US 20230365955 will be used herein).
Hordeaux discloses polynucleotide sequences encoding functional human alpha-galactosidase A (hGLA), expression cassettes containing these coding sequences and vectors, such as recombinant adeno-associated virus (rAAV) vectors having vector genomes that include an hGLA coding sequence operably linked to one or more regulatory sequence (Abstract). Hordeaux also discloses compositions containing these expression cassettes and rAAV, as well as methods for the use of these compositions for treatment of Fabry disease (Abstract).
Hordeaux discloses that in some embodiments: “the hGLA comprises at least amino acids 32 to 429 of SEQ ID NO: 2, or a sequence at least 95% identical thereto... the hGLA comprises amino acids 32 to 429 of SEQ ID NO: 7. In certain embodiments, wherein the hGLA comprises the native signal peptide. In other embodiments, hGLA comprises a heterologous signal peptide. In certain embodiments, the hGLA comprises the full length (amino acids 1 to 429) of SEQ ID NO: 17, or a sequence at least 95% identical thereto” ([0004]).
Elsewhere Hordeaux discloses: “The “human alpha galactosidase A” or “hGLA” may be, for example, a full-length protein (including a signal peptide and the mature protein), the mature protein, a variant protein as described herein, or a functional fragment. As used herein, the term “functional hGLA” refers to an enzyme having the amino acid sequence of the full-length native (wild-type) protein (as shown in SEQ ID NO: 2 and UniProtKB accession number: P06280-1), a variant thereof (including those described herein with specific amino acid substitution(s)” ([0071]). SEQ ID NO: 2 in Hordeaux comprises a sequence that is 100% identical to the instantly recited SEQ ID NO: 27.
Further, the first 31 amino acids of SEQ ID NO: 2 of Hordeaux are 100% identical to the wild-type signal peptide claimed in the instant application (see e.g. the alignment with SEQ ID NO: 28). Hordeaux also states that “there is a signal peptide at amino acid positions 1 to 31 and the mature protein includes amino acid 32 to 429. As used herein, a “signal peptide” refers to a short peptide (usually about 16 to 35 amino acids) present at the N-terminus of newly synthesized proteins” (see [0072]). Hordeaux also discloses that an hGLA may include a native signal peptide (i.e. amino acids 1 to 31 of SEQ ID NO: 2) or, alternatively, a heterologous signal peptide ([0072]-[0073]).
Thus, Hordeaux anticipates the engineered peptide recited in claims 1 and 4, by disclosing a polypeptide having a sequence that comprises at least a portion of human alpha-galactosidase A and a portion of the wild-type signal peptide from a-Gal A. The wild-type protein (e.g. SEQ ID NO: 2) of Hordeaux fulfills all of the requirements of the instant claims and comprises a sequence that is 100% identical to that of SEQ ID NO: 27 (e.g. from amino acid 32-429 of the reference sequence). The sequences of SEQ ID NO: 7 and 17 in Hordeaux are 99.4 and 99.3% identical, respectively, to the instant SEQ ID NO: 27, recited in claim 4.
Regarding claim 9, Hordeaux discloses polynucleotide sequences encoding functional human alpha-galactosidase A (hGLA), expression cassettes containing these coding sequences and vectors, and recombinant adeno-associated virus (rAAV) vectors having vector genomes that include an hGLA coding sequence operably linked to one or more regulatory sequence (Abstract, claim 1). Hordeaux thus discloses a viral vector (recombinant AAV) that comprises a nucleotide sequence for human alpha-galactosidase A (e.g. hGLA natural), as required of the instant claim 9. See also SEQ ID NO: 10 and FIG. 2.
Regarding claim 11 and 13, Hordeaux discloses a viral vector (e.g. rAAV) wherein there exists a nucleotide sequence comprising the human alpha-galactosidase A enzyme sequence and the natural or wild-type a-Gal A signal peptide. From the diagram in Fig. 2, representing a viral vector having this sequence, it is evident that the signal peptide will at the N-terminus (e.g. 5’ to in the nucleotide sequence) of the enzyme sequence (see also [0072]). Therefore claims 11 and 13 are considered anticipated by these disclosures in Hordeaux.
Regarding claim 15, Hordeaux discloses that the viral vector may comprise a sequence having SEQ ID NO: 10, which contains a portion that is 100% identical to that of the instantly recited SEQ ID NO: 27. SEQ ID NO: 1 in Hordeaux is also identical to that of the instant claim.
Regarding claim 17, Hordeaux discloses that the nucleotide sequence may be that of hGLAco having SEQ ID NO: 3, comprising alpha-galactosidase A. This sequence contains a region at the 5’ end that is 86.2% identical to that of the instantly recited SEQ ID NO: 51. Thus, the instantly claimed viral vector of claim 9, having a wt sp with a nucleotide sequence of at least 80% to that of SEQ ID NO: 51 is considered to be anticipated by this sequence of Hordeaux.
For all of the reasons discussed above, Hordeaux is considered to anticipate all of the required elements of claims 1, 4, 9, 11, 13, 15, and 17.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 2, 4, 7, 9, 11, 13, 15, and 17 are rejected under 35 U.S.C. 103 as being unpatentable over Hordeaux (WO-2022076803-A1, paragraph numbers from corresponding US 20230365955 are used herein) in view of Armour (WO-2022155665-A1, to Spark Therapeutics Inc., on IDS filed 5/24/2026).
Hordeaux discloses or renders obvious all of the limitations of claims 1, 4, 9, 11, 13, 15, and 17. The teachings of Hordeaux include all of those discussed above.
Particularly, Hordeaux teaches polynucleotide sequences encoding functional human alpha-galactosidase A (hGLA), expression cassettes containing these coding sequences and vectors, and recombinant adeno-associated virus (rAAV) vectors having vector genomes that include an hGLA coding sequence operably linked to one or more regulatory sequence (Abstract, claim 1). Hordeaux teaches that hGLA comprises at least amino acids 32 to 429 of SEQ ID NO: 2, or a sequence at least 95% identical thereto. Hordeaux also discloses that the vector comprising hGLA may include a native signal peptide (i.e. amino acids 1 to 31 of SEQ ID NO: 2) or, a heterologous signal peptide ([0072]-[0073]). Hordeaux teaches various signal peptides known to the art and states “a heterologous signal peptide is preferably of human origin” ([0073]). Hordeaux also teaches that the signal peptide is attached on the N-terminus ([0072]).
Regarding claim 2, Hordeaux teaches, in a list of multiple possible components, that the . vector includes but not is not limited to “a recombinant virus, a plasmid, lipoplexes, a polymersome, Polyplexes, a dendrimer, a cell penetrating peptide (CPP) conjugate” ([0114]).
However, Hordeaux does not teach in a single embodiment that the signal peptide is from tissue plasminogen activator (as in some of the alternatives of claim 1 and in claim 7), nor does Hordeaux explicitly teach that the peptide comprises a cell-penetrating peptide as in claim 2.
Armour (WO 202215565-A1) is drawn to polynucleotides including nucleic acids encoding α-galactosidase A (e.g. GLA) and methods of using the polynucleotides to treat lysosomal storage disorders such as Fabry disease (Abstract). Particularly, Armour teaches producing and using an expression cassette comprising a nucleic acid encoding α-galactosidase A (GLA), and that the GLA comprises the amino acid sequence of SEQ ID NO: 100 ([00124]-[00125]). The sequence of SEQ ID NO: 100 from Armour is 100% identical to that of SEQ ID NO: 27 herein, and is the same as the hGLA sequence taught in Hordeaux.
Armour teaches an expression cassette for α-galactosidase A should comprises an appropriate secretory signal sequence or signal peptide that will allow the secretion of the polypeptide encoded by the polynucleotide molecule of the instant invention ([0012];[00126])
Armour teaches that any suitable signal peptide known to those skilled in the art in view of the present disclosure can be used in the invention, including a signal peptide from tPA, inter alia ([00127]). Armour teaches that it is common to select from among any conventional signal sequence that directs proteins through the endoplasmic reticulum secretory pathway, including variants of the above mentioned signal peptides ([00127]).
Further, regarding a cell-penetrating peptide, Armour teaches that any suitable protein based delivery system or cell-penetrating peptide (CPP) known to those skilled in the art in view of the present disclosure can be used ([00221]). Armour teaches that CPPs are short peptides (6-30 amino acid residues) that are capable of intracellular penetration to deliver therapeutic molecules, and these include, inter alia, the TAT peptide from HIV-1 ([00222]).
Therefore, to one of ordinary skill in the art, prior to the effective filing date of the instant invention, it would have been prima facie obvious in view of the combined teachings of Hordeaux and Armour to select a signal peptide from tissue-plasminogen activator, tPA, for the signal peptide of a secreted α-galactosidase A, as taught in Armour. Further, it would have been obvious over the combined teachings of Hordeaux and Armour to include a sequence for a cell-penetrating peptide (CPP) to improve intracellular penetration to deliver therapeutic molecules.
One would have been motivated by the teachings of Armour to further modify the engineered α-galactosidase A peptide taught in Hordeaux. Both references teach adding a signal peptide, including selecting from signal peptides known in the art. It is evident that one having ordinary skill in the art would have knowledge of the tPA signal peptide, as indicated by the teachings of Armour. Further, one of ordinary skill would reasonably predict that the inclusion of the tPA signal peptide would result in a secreted protein. Secretion is desirable for both the production and collection of protein-based therapies in vitro, and for applications of the therapy if delivered in vivo (e.g. so the peptides can be produced intercellularly and secreted so they can reach a desired target tissues, if necessary for treatment). Such genetic manipulations are well-known in the art. The selection of the tPA signal peptide would have been a matter of routine optimization and judicious selection to one having ordinary skill in the art. The positioning of the tPA signal peptide at the N-terminus, as recited in claim 7, would have naturally followed from the teachings of both Armour and Hordeaux, because both references teach that conventionally, a signal peptide for protein secretion is found at the N-terminus.
See also MPEP § 2143.I.B (KSR, Rationale B) which discusses that it is obvious to substitute one known element for another to obtain predictable results. In this case, both the wild-type signal peptide from hGLA and heterologous signal peptides are taught in Hordeaux to be suitable for the engineered α-galactosidase A peptide used to treat Fabry disease. Because Armour pertains to a similar α-galactosidase A peptide and teaches that the heterologous signal peptide may include a signal peptide from tPA, it would have been obvious to select and substitute a sequence from tPA for the endogenous signal peptide. Such substitutions are known in the art would have been well within the ordinary skill level.
Regarding claim 2, both Hordeaux and Armour suggest that the cell delivery system for an α-galactosidase A peptide can include a cell-penetrating peptide. Armour further teaches that inclusion of a cell-penetrating peptide such as the HIV-1 TAT peptide sequence is well-known in the art, and will predictably result in increased target cell penetration. Thus, one would predict that the inclusion of a cell-penetrating peptide would result in an improved therapy.
It is apparent that there would have been a reasonable expectation of success in combining the teachings of the cited references Hordeaux and Armour to arrive at the inventions of claims 2 and 7 because both references pertain to proteins and therapies comprising α-galactosidase A peptide with N-terminus signal peptides, and Armour teaches that cell-penetrating peptides such as TAT from HIV-1 and that tPA signal peptides are commonly selected and known in the art.
Therefore, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date, as evidenced by the cited references, especially in the absence of evidence to the contrary.
Claims 5 and 16 are rejected under 35 U.S.C. 103 as being unpatentable over Hordeaux (WO-2022076803-A1) and Armour (WO-2022155665-A1), as applied to claims 1, 2, 4, 7, 9, 11, 13, 15, and 17 above, and further in view of Fuller et al. (US Pat. No. 6,881,723).
The combined teachings of Hordeaux and Armour make obvious the alternative of claim 1, requiring an engineered peptide comprising α-galactosidase A with a signal peptide from tissue-plasminogen activator, tPA, for all of the reasons described above.
Armour does teach that tPA is among many suitable signal peptides known in the art, and that one having ordinary skill would be well-knowledge in signal peptides ([00127]).
However, the combination of Hordeaux and Armour does not explicitly teach that the tPA signal peptide is encoded by a nucleotide sequence at least 80% similar to that of SEQ ID NOs: 22, 19, 21, or 23 of the instant application, nor that the amino acid sequence for tPA is at least 80% similar to SEQ ID NO: 49 (this is believed to be what claim 5 is meant to recite), as recited in claims 5 and 17.
Fuller et al. (US Pat. No. 6,881,723) pertains to hybrid antigen/carrier nucleic acid constructs, expression vectors containing such constructs, and to nucleic acid immunization strategies employing such reagents (Col 1, lines 15-24). Fuller teaches vectors and compositions and methods for eliciting an immune response using these molecules (Abstract). Fuller teaches that the therapeutic constructs may contain ancillary sequences for the secretion of a protein from a mammalian cell, and explicitly states that such “secretion leader sequences are known to those skilled in the art, and include, for example, the tissue plasminogen activator (tpa) leader signal sequence.” (Col 10, lines 31-36).
For the signal peptide of tPA, Fuller teaches that the coding Sequence for the tissue plasminogen activator (tpa) Signal peptide, and is SEQ ID NO. 5, which comprises a sequence that is 98.5% identical to that of the instantly claimed SEQ ID NO: 22 (Col 17, lines; see Appendix G below). Fuller also teaches that the protein Sequence for this tPA signal peptide is SEQ ID NO. 6, which is 100% identical to that of SEQ ID NO: 49 herein (Col 17, lines 40-45; see Appendix H below).
Therefore, to one of ordinary skill in the art, prior to the effective filing date of the instant invention, it would have been prima facie obvious in view of the combined teachings of Hordeaux, Armour, and Fuller to select a signal peptide from tissue-plasminogen activator, tPA, for the signal peptide of a secreted α-galactosidase A, as taught in Armour and to select the amino acid sequence and corresponding nucleotide sequence taught in Fuller for tPA.
One would have been motivated by the teachings of Armour to select and provide from among the signal peptides known to the art, including tPA. One having an ordinary level of skill would have known to consult related literature for known successful sequences of the tPA signal peptide, although it is not explicitly taught in Armour. The instantly claimed amino acid sequence of SEQ ID NO: 58 therein is about 98.5% identical to that of the instantly claimed SEQ ID NO:22. The amino acid sequence of SEQ ID NO: 49 corresponds to the amino acid produced by this sequence, and is 100% identical to SEQ ID NO: 6 of Fuller. Because this sequence appears to be a common and well-known sequence for this signal peptide, one having ordinary skill in the art would be motivated to select and use the tPA leader amino acid sequence, encoded by a sequence that is nearly identical to that which is instantly claimed.
It is apparent that there would have been a reasonable expectation of success in combining the teachings of the cited references Hordeaux, Armour, and Fuller to arrive at the inventions of claims 5 and 16 because Armour teaches that tPA signal peptides are commonly selected and known in the art and Fuller teaches nucleotide and amino acid sequence that are known to comprise a tPA signal peptide and is used successfully therein for secretion of a therapeutic protein in mammalian cells. It would be predictable that the same sequence used in Fuller, which is known in the art, would have been a suitable sequence for the tPA suggested in Armour, when producing an expression vector as made obvious by Hordeaux and Armour.
Therefore, the invention of claims 5 and 16 would have been obvious to one of ordinary skill in the art prior to the effective filing date, as evidenced by the cited references, especially in the absence of evidence to the contrary.
Claims 6, 8, and 18 are rejected under 35 U.S.C. 103 as being unpatentable over Hordeaux (WO-2022076803-A1) and Armour (WO-2022155665-A1), as applied to claims 1, 2, 4, 7, 9, 11, 13, 15, and 17 above, and further in view of “Higuchi et al.” (2010. “α-Galactosidase A-Tat Fusion Enhances Storage Reduction in Hearts and Kidneys of Fabry Mice”. Molecular Medicine, Vol. 16, Nos. 5-6, pp. 216-221, on IDS filed 5/24/2026)
The combined teachings of Hordeaux and Armour make obvious the alternative of claim 1, requiring an engineered peptide comprising α-galactosidase A with a signal peptide and containing a cell-penetrating peptide (as in claim 2) for all of the reasons described above.
However, the combination of Hordeaux and Armour does not explicitly teach that the cell-penetrating peptide comprises a sequence that is at least 80% identical to SEQ ID No: 55, as recited in claim 6, and is encoded by a nucleotide sequence at least 80% identical to that of SEQ ID NO: 24, as in claim 18. Nor does this combination teach that a cell-penetrating peptide is fused to the C-terminus of the enzyme as in claim 8.
Higuchi teaches that the protein transduction domain from human immunodeficiency virus (HIV), Tat, allows proteins to penetrate a cell membrane and results in enhanced cellular uptake (Abstract). Higuchi teaches a fusion protein with α-galactosidase A and a TAT sequence fused to the C-terminus (Title, Abstract and Figure 1). Higuchi teaches in Figure 1 that the TAT sequence is “YGRKKRRQRRR” which is identical to that of SEQ ID NO: 55 in the instant application. Higuchi teaches that the sequence encoding the TAT peptide is encoded by a nucleotide sequence comprising 5’-TATGGCAGGAAGAAGCGGAGACAGCGACGAAGA-‘3, which is identical to that of the instant SEQ ID NO: 24 (on pg. 217, left col, under “Lentiviral Vector (LV) Production and Transductions”). Higuchi teaches that the fusion protein comprising α-galactosidase A with a TAT cell-penetrating sequence was used in a model of Fabry disease in mice (Abstract) and that the TAT fusion protein provides additional benefit in these mice by reducing Gb3 accumulation more effective, compared to controls (see pg. 221, left col).
Therefore, to one of ordinary skill in the art, prior to the effective filing date of the instant invention, it would have been prima facie obvious in view of the combined teachings of Hordeaux, Armour, and Higuchi to incorporate a cell-penetrating peptide at the C-terminus of the fusion protein comprising a signal peptide and α-galactosidase A, and to select for the sequence of the cell-penetrating peptide the TAT peptide sequence (i.e. SEQ ID NO: 55) taught in Higuchi, for the benefit of increased cell penetration and improved therapeutic effects.
One would have been motivated to select the peptide sequence and corresponding nucleotide sequence for the TAT peptide that was used in Higuchi because this reference teaches that it can successfully be fused at the C-terminus of α-galactosidase A and used to treat Fabry disease. It would have thus been predictable, in view of the suggestions in Armour and the explicit teachings of Higuchi to produce such a sequence, wherein there exists a signal peptide (e.g. the wildtype signal peptide or a heterologous one such as tPA), α-galactosidase A, and the cell-penetrating TAT sequence. One would have logically used the same nucleotide sequence demonstrated in Higuchi to produce the desired TAT sequence. This appears to be substantially identical to the claimed nucleotide sequence (and indeed greater than 80%).
All of the claimed elements are known in the art and the references teach and suggest combining these elements. Further, Higuchi teaches that using the specific sequences for the TAT peptide results in a fusion peptide with improved cell penetration, which would predictably result in improved therapeutic benefit.
There would have been a reasonable expectation of success in combining the teachings of the cited references Hordeaux, Armour, and Higuchi because each pertain to fusion proteins involving α-galactosidase A and Higuchi demonstrates the therapeutic potential of a fusion protein having a cell-penetrating TAT sequence at the C-terminus.
Thus, the inventions recited in claims 6, 8, and 18 would have been prima facie obvious to one of ordinary skill in the art prior to the effective filing date, as evidenced by the cited references, especially in the absence of evidence to the contrary.
Citation of Pertinent Art
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure.
Seldin et al. (US Pat. No. 6,458,574) pertains to α-Gal A preparations that have an extended circulating half-life in a mammalian host, and methods for making same; and methods and dosages for administering an α-Gal A preparation to a subject (Abstract). Seldin teaches that such enzymes and preparations are used to treat for the treatment of α-galactosidase A deficiencies including Fabry disease (see Col 1, lines 10-42). Seldin teaches various sequences for both the nucleotide sequences of α-Gal A (e.g. SEQ ID NOs: 3 and 5) and the amino acid sequence (SEQ ID NO: 4, FIG. 6), and establishes that the first 31 amino acids are a signal peptide (Col 1, lines 43-47).
Zhu et al. (WO-2023028566-A2, on IDS filed 5/24/2026) teaches methods for making an isolated, e.g., recombinant, AAV particles, and methods for delivering an exogenous alpha-galactosidase (GAL) protein into a subject and/or methods for treating a subject having a GAL-associated disease or disorder, e.g., a lysosomal storage disorder, e.g., Fabry disease (Abstract). Zhu teaches using various native and codon-optimized signal peptides, including native human GAL signal peptide (see e.g. Figure 2).
Conclusion
No claims are allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANDREW TERRY MOEHLMAN whose telephone number is (571)270-0990. The examiner can normally be reached M-F 9am-5pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Anand Desai can be reached at 571-272-0947. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.T.M./Examiner, Art Unit 1655
/ANAND U DESAI/Supervisory Patent Examiner, Art Unit 1655
APPENDIX A: Alignment of SEQ ID NO: 28 and Alpha-galactosidase A (P06280; Q6LER7)
PNG
media_image1.png
200
400
media_image1.png
Greyscale
APPENDIX B: Alignment of SEQ ID NO: 27 and Alpha-galactosidase A (P06280; Q6LER7)
PNG
media_image2.png
200
400
media_image2.png
Greyscale
APPENDIX C: Alignment of SEQ ID NO: 27 and SEQ ID NO: 2 of Hordeaux (WO-2022076803-A1, US PGPub No. 20230365955)
PNG
media_image3.png
200
400
media_image3.png
Greyscale
APPENDIX D: Alignment of SEQ ID NO: 28 (wt sp) and SEQ ID NO 2 of Hordeaux
PNG
media_image4.png
200
400
media_image4.png
Greyscale
APPENDIX E: Alignment of SEQ ID NO: 25 and SEQ ID NO: 1 of Hordeaux (WO-2022076803-A1, US PGPub No. 20230365955)
RESULT 1
US-18-246-872-1
Query Match 99.7%; Score 1194; DB 1; Length 1287;
Best Local Similarity 100.0%;
Matches 1194; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 CTGGACAATGGATTGGCAAGGACGCCTACCATGGGCTGGCTGCACTGGGAGCGCTTCATG 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 94 CTGGACAATGGATTGGCAAGGACGCCTACCATGGGCTGGCTGCACTGGGAGCGCTTCATG 153
Qy 61 TGCAACCTTGACTGCCAGGAAGAGCCAGATTCCTGCATCAGTGAGAAGCTCTTCATGGAG 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 154 TGCAACCTTGACTGCCAGGAAGAGCCAGATTCCTGCATCAGTGAGAAGCTCTTCATGGAG 213
Qy 121 ATGGCAGAGCTCATGGTCTCAGAAGGCTGGAAGGATGCAGGTTATGAGTACCTCTGCATT 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 214 ATGGCAGAGCTCATGGTCTCAGAAGGCTGGAAGGATGCAGGTTATGAGTACCTCTGCATT 273
Qy 181 GATGACTGTTGGATGGCTCCCCAAAGAGATTCAGAAGGCAGACTTCAGGCAGACCCTCAG 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 274 GATGACTGTTGGATGGCTCCCCAAAGAGATTCAGAAGGCAGACTTCAGGCAGACCCTCAG 333
Qy 241 CGCTTTCCTCATGGGATTCGCCAGCTAGCTAATTATGTTCACAGCAAAGGACTGAAGCTA 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 334 CGCTTTCCTCATGGGATTCGCCAGCTAGCTAATTATGTTCACAGCAAAGGACTGAAGCTA 393
Qy 301 GGGATTTATGCAGATGTTGGAAATAAAACCTGCGCAGGCTTCCCTGGGAGTTTTGGATAC 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 394 GGGATTTATGCAGATGTTGGAAATAAAACCTGCGCAGGCTTCCCTGGGAGTTTTGGATAC 453
Qy 361 TACGACATTGATGCCCAGACCTTTGCTGACTGGGGAGTAGATCTGCTAAAATTTGATGGT 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 454 TACGACATTGATGCCCAGACCTTTGCTGACTGGGGAGTAGATCTGCTAAAATTTGATGGT 513
Qy 421 TGTTACTGTGACAGTTTGGAAAATTTGGCAGATGGTTATAAGCACATGTCCTTGGCCCTG 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 514 TGTTACTGTGACAGTTTGGAAAATTTGGCAGATGGTTATAAGCACATGTCCTTGGCCCTG 573
Qy 481 AATAGGACTGGCAGAAGCATTGTGTACTCCTGTGAGTGGCCTCTTTATATGTGGCCCTTT 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 574 AATAGGACTGGCAGAAGCATTGTGTACTCCTGTGAGTGGCCTCTTTATATGTGGCCCTTT 633
Qy 541 CAAAAGCCCAATTATACAGAAATCCGACAGTACTGCAATCACTGGCGAAATTTTGCTGAC 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 634 CAAAAGCCCAATTATACAGAAATCCGACAGTACTGCAATCACTGGCGAAATTTTGCTGAC 693
Qy 601 ATTGATGATTCCTGGAAAAGTATAAAGAGTATCTTGGACTGGACATCTTTTAACCAGGAG 660
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 694 ATTGATGATTCCTGGAAAAGTATAAAGAGTATCTTGGACTGGACATCTTTTAACCAGGAG 753
Qy 661 AGAATTGTTGATGTTGCTGGACCAGGGGGTTGGAATGACCCAGATATGTTAGTGATTGGC 720
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 754 AGAATTGTTGATGTTGCTGGACCAGGGGGTTGGAATGACCCAGATATGTTAGTGATTGGC 813
Qy 721 AACTTTGGCCTCAGCTGGAATCAGCAAGTAACTCAGATGGCCCTCTGGGCTATCATGGCT 780
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 814 AACTTTGGCCTCAGCTGGAATCAGCAAGTAACTCAGATGGCCCTCTGGGCTATCATGGCT 873
Qy 781 GCTCCTTTATTCATGTCTAATGACCTCCGACACATCAGCCCTCAAGCCAAAGCTCTCCTT 840
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 874 GCTCCTTTATTCATGTCTAATGACCTCCGACACATCAGCCCTCAAGCCAAAGCTCTCCTT 933
Qy 841 CAGGATAAGGACGTAATTGCCATCAATCAGGACCCCTTGGGCAAGCAAGGGTACCAGCTT 900
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 934 CAGGATAAGGACGTAATTGCCATCAATCAGGACCCCTTGGGCAAGCAAGGGTACCAGCTT 993
Qy 901 AGACAGGGAGACAACTTTGAAGTGTGGGAACGACCTCTCTCAGGCTTAGCCTGGGCTGTA 960
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 994 AGACAGGGAGACAACTTTGAAGTGTGGGAACGACCTCTCTCAGGCTTAGCCTGGGCTGTA 1053
Qy 961 GCTATGATAAACCGGCAGGAGATTGGTGGACCTCGCTCTTATACCATCGCAGTTGCTTCC 1020
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1054 GCTATGATAAACCGGCAGGAGATTGGTGGACCTCGCTCTTATACCATCGCAGTTGCTTCC 1113
Qy 1021 CTGGGTAAAGGAGTGGCCTGTAATCCTGCCTGCTTCATCACACAGCTCCTCCCTGTGAAA 1080
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1114 CTGGGTAAAGGAGTGGCCTGTAATCCTGCCTGCTTCATCACACAGCTCCTCCCTGTGAAA 1173
Qy 1081 AGGAAGCTAGGGTTCTATGAATGGACTTCAAGGTTAAGAAGTCACATAAATCCCACAGGC 1140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1174 AGGAAGCTAGGGTTCTATGAATGGACTTCAAGGTTAAGAAGTCACATAAATCCCACAGGC 1233
Qy 1141 ACTGTTTTGCTTCAGCTAGAAAATACAATGCAGATGTCATTAAAAGACTTACTT 1194
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1234 ACTGTTTTGCTTCAGCTAGAAAATACAATGCAGATGTCATTAAAAGACTTACTT 1287
APPENDIX F: Alignment of SEQ ID NO: 51 and SEQ ID NO: 3 of Hordeaux (WO-2022076803-A1, US PGPub No. 20230365955)
RESULT 1
US-18-246-872-3
Query Match 86.2%; Score 80.2; DB 1; Length 1287;
Best Local Similarity 91.4%;
Matches 85; Conservative 0; Mismatches 8; Indels 0; Gaps 0;
Qy 1 ATGCAGCTGAGAAACCCCGAGCTGCACCTGGGCTGTGCCCTGGCCCTGCGCTTTCTGGCC 60
|||||||||||||| ||||||||||||||||||||||||||||| ||| | |||||||||
Db 1 ATGCAGCTGAGAAATCCCGAGCTGCACCTGGGCTGTGCCCTGGCTCTGAGATTTCTGGCC 60
Qy 61 CTGGTGAGTTGGGATATCCCTGGCGCCAGAGCC 93
|||||| |||||| ||||||||||| ||||||
Db 61 CTGGTGTCTTGGGACATCCCTGGCGCTAGAGCC 93
APPENDIX G: Alignment of SEQ ID NO: 22 and SEQ ID NO: 5 of Fuller (US 6,881,723)
RESULT 1
US-09-434-830-5
Sequence 5, US/09434830
Patent No. 6881723
GENERAL INFORMATION
APPLICANT: FULLER, et al.
Query Match 98.5%; Score 65; Length 66;
Best Local Similarity 100.0%;
Matches 65; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTT 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 ATGGATGCAATGAAGAGAGGGCTCTGCTGTGTGCTGCTGCTGTGTGGAGCAGTCTTCGTT 60
Qy 61 TCGGC 65
|||||
Db 61 TCGGC 65
APPENDIX H: Alignment of SEQ ID NO: 49 and SEQ ID NO: 6 of Fuller (US 6,881,723)
Query Match 100.0%; Score 115; DB 1; Length 22;
Best Local Similarity 100.0%;
Matches 22; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
Qy 1 MDAMKRGLCCVLLLCGAVFVSA 22
||||||||||||||||||||||
Db 1 MDAMKRGLCCVLLLCGAVFVSA 22
Prosecution Insights