Prosecution Insights
Last updated: October 04, 2026
Application No. 18/650,088

TRANSGENIC ANIMAL MODEL, METHOD FOR CONSTRUCTING SAME, AND USE THEREOF

Non-Final OA §102§103§112
Filed
Apr 30, 2024
Priority
Jun 07, 2022 — continuation of PCTCN2022097333
Examiner
SINGH, ANOOP KUMAR
Art Unit
Tech Center
Assignee
Shenzhen Institutes Of Advanced Technology Chinese Academy Of Sciences
OA Round
1 (Non-Final)
43%
Grant Probability
Moderate
1-2
OA Rounds
1y 9m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 43% of resolved cases
43%
Career Allowance Rate
310 granted / 721 resolved
-17.0% vs TC avg
Strong +68% interview lift
Without
With
+67.6%
Interview Lift
resolved cases with interview
Typical timeline
4y 2m
Avg Prosecution
58 currently pending
Career history
782
Total Applications
across all art units

Statute-Specific Performance

§101
3.8%
-36.2% vs TC avg
§103
34.9%
-5.1% vs TC avg
§102
12.7%
-27.3% vs TC avg
§112
32.7%
-7.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 721 resolved cases

Office Action

§102 §103 §112
DETAILED ACTION The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Applicant’s response to restriction requirement filed on July 13, 2026 have been received and entered. Claims 1-9 are pending in the instant application. Election/Restrictions Applicant’s election without traverse of claims 1-7 (group I) in the reply filed on July 13, 2026 is acknowledged. Claims 8-9 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention there being no allowable generic or linking claim. Election was made without traverse in the reply filed on July 13, 2026. Priority This application is a Continuation application of PCT/CN2022/097333 filed on 06/07/2022. Information Disclosure Statement The information disclosure statements (IDS) submitted on 04/30/2024 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement has been considered by the examiner. Claims 1-7 are under consideration. Claim Objections The claims are objected to because the words within the claims are crowded too closely together without spacing, making reading difficult. For example: matingadult (claim 2, line 2) , adultfemale (claim 2, line 4), and solutioncomprises (claim 3, line2). Appropriate correction is required. Claim 1 is objected to recite the phrase “condition knockout mice”. The standard scientific term is conditional knockout mice rather than "condition knock out mouse”. Claim 6 is objected for typographical error in reciting Ainx 1. It should be replaced with Axin1. Claim 1 is objected for recitation of phrase “constructing”. It should be noted that transgenic mouse model is usually produced or generated by a process not constructed. It is suggested that applicant should replace the phrase with --producing-- or --providing--. Appropriate correction is required. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 1-2 and 5 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Zhou et al (Journal of Cell Physiology, 2019, 234, 1720-1729). Claims are directed to a method for constructing a transgenic animal model, comprising the following steps: S1, constructing Axin1flox/flox transgenic mice and Agcl-CreER transgenic mice; S2, selecting adult Axin1flox/flox mice and Agcl-CreER mice to mate, and producing condition knockout mice by mating; S3, injecting tamoxifen into abdominal cavities of adult condition knockout mice, with the injection continuing for 5 days; S4, regularly detecting biochemical indicators of the Axin1 AgclER condition knockout mice during modeling, and performing histological and histo morphometric analyses; S5, when Axin1 AgclER condition knockout body simultaneously experiences growth plate chondrocyte hypertrophy, ectopic ossification, and knee joint cartilage degeneration syndrome, obtaining the transgenic animal model. Claim interpretation: recitation of “when anAxin1 AgclER condition exhibit a phenotype” (claim 1) and phrase following “when newborn mice grow at 2-3 week.”” (claims 2, lines 4,) are conditional clause and therefore limitation following phrase “when” is interpreted as not required by the method and the limitation is expected to happen in future is not given any patentable weight. To the extent prior art teaches that method of regularly detecting biochemical indicators to obtain the recited phenotype (claim 1) and mating Axin1flox/flox mice with Agcl-CreER mice (claim 2), it is applicable to the rejection. Claim 5 is interpreted as injecting 1 mg/10-gram bodyweight of tamoxifen into abdominal cavities. With respect to claims 1-2 and 5, Zhou teaches (i) providing Axin1flox/flox transgenic mice and Agcl-CreER transgenic mice (see page 1781, col, 2, last para.), (ii) mating Axin1flox/flox mice and Agcl-CreERT2 mice to produce Axin1 Agc1ER mouse; (iii) injecting 1 mg/10-gram bodyweight, tamoxifen into abdominal cavities of 2-month-old adult condition knockout mice for 5 days (see page 1721, col. 2, last para. and 1722, col. 1, para. 1 and col. 2, last para to page 1723, col. 1, para. 1), (iv) detecting biochemical indicators of the Axin1 AgclER condition knockout mice and performing histological analysis (see fig. 2) at different time of development for expression of Axin1 (fig. 1(, Col-X, MMP13 (see fig. 3) and PCNA (fig. 4) to obtain a mouse model of osteoarthritis-like phenotype in temporomandibular joint. Regarding claim 2-4, Zhou teaches mating Axin1flox/flox mice and Agcl-CreERT2 mice to produce Axin1 Agc1ER mouse. Recitation of phrase following “nen newborn mice grow at 2-3 week.”” (claims 2, lines 4, claims 3-4 dependent therefrom) are conditional clause and therefore limitation following phrase “when” is interpreted as not required by the method and is not given any patentable weight. Accordingly, Zhou anticipates claims 1-4 and 5. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1, 6 and 7 are rejected under 35 U.S.C. 103 as being unpatentable over Zhou et al (Journal of Cell Physiology, 2019, 234, 1720-1729), Hui et al (International J of Oral Science, 2018, 10, 1-8) and Shu et al (Bone Research, 2020, 8(31), 1-8). Claims are directed to a method for constructing a transgenic animal model, comprising the following steps: S1, constructing Axin1flox/flox transgenic mice and Agcl-CreER transgenic mice; S2, selecting adult Axin1flox/flox mice and Agcl-CreER mice to mate, and producing condition knockout mice by mating; S3, injecting tamoxifen into abdominal cavities of adult condition knockout mice, with the injection continuing for 5 days; S4, regularly detecting biochemical indicators of the Axin1 AgclER condition knockout mice during modeling, and performing histological and histo morphometric analyses; S5, when Axin1 AgclER condition knockout body simultaneously experiences growth plate chondrocyte hypertrophy, ectopic ossification, and knee joint cartilage degeneration syndrome, obtaining the transgenic animal model. Claim interpretation: recitation of when Axin1 AgclER condition exhibit a phenotype is condition clause and does not require any specific method step and therefore to the extent prior art teaches that method of regularly detecting biochemical indicators to obtain the recited phenotype, it is applicable to the rejection. The amount of tamoxifen injected in claim 5 is interpreted as 1 mg/10gram of body weight of mouse. With respect to claims 1 and 5, Zhou teaches (i) providing Axin1flox/flox transgenic mice and Agcl-CreER transgenic mice (see page 1781, col, 2, last para.), (ii) mating Axin1flox/flox mice and Agcl-CreERT2 mice to produce Axin1 Agc1ER mouse; (iii) injecting 1 mg/10 gram bodyweight, tamoxifen into abdominal cavities of 2 month old adult condition knockout mice for 5 days (see page 1721, col. 2, last para. and 1722, col. 1, para. 1 and col. 2, last para to page 1723, col. 1, para. 1), (iv) detecting biochemical indicators of the Axin1 AgclER condition knockout mice and performing histological analysis (see fig. 2) at different time point for expression of Axin1 (fig. 1, Col-X and MMP13 (see fig. 3) to obtain a mouse model of osteoarthritis-like phenotype in temporomandibular joint. Regarding claims 6 and 7, Zhou teaches that the biochemical indicators comprise expression levels of Axin1 (fig. 1), Axin-2 (see page 1723, col. 1, para. 1). ß-catenin (fig. 5), COI-X, MMP13 (see 3) , and PCNA (a marker for proliferation, fig. 4) in condition knockout mouse. Zhou further discloses analyses comprise expression of micro-CT (see page 1722, col. 1, para. 3). Zhou differs from claimed invention by not disclosing detecting proliferation marker Ki-67 and TRAP staining of the Axin1 AgclER condition knockout mice. However, before the effective filing date of instant application, Hui reported proliferating cell nuclear antigen (PCNA), Ki67, and terminal deoxinucleotidyl transferase-mediated dUTP-fluorescein nick end labeling (TUNEL) staining are performed to assess changes in chondrocyte proliferation and apoptosis (see page 2, col. 2, para. 3). It is disclosed that PCNA and Ki67 both assess cell proliferation (see page 2, col. 2, para. 3). The combination of references differs from claimed invention by not disclosing TRAP staining of the condition knockout mice. Shu teaches identifying osteoclasts by TRAP staining (see fig. 3) in Axin1 Osx knockout mouse. It is disclosed that osteoclast formation in the subchondral bone of 2- and 4-week-old knock out mouse is decreased as compared with that of Cre-negative tibiae (see fig. 3b). Therefore, it would have been prima facie obvious for a person of ordinary skill in the art to combine the teachings of prior art to modify the method of Zhou to further characterize the conditional mouse by including other biochemical and histomorphometric analysis as suggested in Hui and Shu, in order to characterize the mouse model, as instantly claimed, with a reasonable expectation of success, before the effective filing date of the instant invention. Said modification amounting to combining prior art elements according to known methods to yield predictable results. One of ordinary skill in the art would be motivated to further characterize the mouse of Zhou for cartilage degeneration phenotype . One of skill in the art would have been expected to have a reasonable expectation of success because (i) all the recited markers and staining were known in the art, and hence "the combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results as evident from the teaching of Shu and Hui (ii) prior art had successfully reported TRAP staining. It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith , --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR , 82 USPQ2d at 1396) (available at http: www.uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf). Claims 1, 2 and 3 are rejected under 35 U.S.C. 103 as being unpatentable over Zhou et al (Journal of Cell Physiology, 2019, 234, 1720-1729), Xie et al (Genesis, 2011, 49, 98-102) and Wang et al (Journal of Experimental Medicine, 2017, 214, 49-58). Claim interpretation: phrase following “when newborn mice grow at 2-3 week.”” (claims 2, lines 4,) are conditional clause and therefore limitation following phrase “when” is interpreted as not required by the method and the limitation is expected to happen in future is not given any patentable weight. Zhou teaches (i) providing Axin1flox/flox transgenic mice and Agcl-CreER transgenic mice (see page 1781, col, 2, last para.), (ii) mating Axin1flox/flox mice and Agcl-CreERT2 mice to produce Axin1 Agc1ER mouse; (iii) injecting 1 mg/10 gram bodyweight, tamoxifen into abdominal cavities of 2 month old adult condition knockout mice for 5 days (see page 1721, col. 2, last para. and 1722, col. 1, para. 1 and col. 2, last para to page 1723, col. 1, para. 1), (iv) detecting biochemical indicators of the Axin1 AgclER condition knockout mice and performing histological analysis (see fig. 2) at different time point for expression of Axin1 (fig. 1, Col-X and MMP13 (see fig. 3) to obtain a mouse model of osteoarthritis-like phenotype in temporomandibular joint. While Zhou teaches mating Axin1flox/flox mice and Agcl-CreERT2 mice to obtain a produce conditional Axin1 Agc1ER mouse, but differs from claimed invention by not explicitly disclosing genotyping to characterize and select Axin1 Agc1ER mouse and lysing the mousetail tip in a lysis buffer. However, before the effective filing date of instant application, Xie teaches a method of genotyping a condition mouse by isolating genomic DNA from mouse tail and analyzed by southern blotting according to s a standard protocol. It is disclosed that mice carrying wild-type and Axin1flox alleles were genotyped in a single PCR reaction using a forward primer 3F (TGAACTCTTGATCAGGTCTTG) and reverse primer 2R (TATGATCTTTGGTCCTTTCTG), which amplify the wild-type (372-bp) and Axin1flox (463-bp) alleles. PCR reactions for genotyping were carried out under standard conditions (see page 101, col. 2, para. 2). Xie differs from claimed invention by not explicitly disclosing usw of lysis solution comprises 2l Tris-Hcl with a pH of 7.5, 20p1O.5M EDTA with a pH of 8.0, 6plSM NaCl, 20p1 SDS with a mass to volume ratio of 10%, and 1pl proteinase K with a concentration of 10mg/ml. Wang teaches a buffer containing 100 mM Tris-HCl 8.5, 0.2% SDS, 200 mM NaCl, and 5 mM EDTA in the presence of 0.25 mg/ml proteinase K for extracting genomic DNA from cells (see page 54, col. 2, para. 2). Therefore, it would have been prima facie obvious for a person of ordinary skill in the art to combine the teachings of prior art to modify the method bygenotyping the Axin1 Agc1ER mouse as disclosed in Zhou by lysing the tissue by adding lysis solution as suggested in Wang to perform PCR amplification for Axin1, in order to characterize the mouse model, as instantly claimed, with a reasonable expectation of success, before the effective filing date of the instant invention. Said modification amounting to combining prior art elements according to known methods to yield predictable results. One of ordinary skill in the art would be motivated to do so because this would allow one ordinary skill in the art to characterize and select conditional KO mouse line. It would be further obvious to optimize each component of the lysis solution to efficiently obtain nucleic acid from the KO mouse tail tip. It as it is well settled that routine optimization is not patentable, even if it results in significant improvements over the prior art. In support of this position, attention is directed to the decision in In re Aller, Lacey, and Haft, 105 USPQ 233 (CCPA 1955): With regards to determining experimental parameters, such as time in culture, the court has held that "[d]iscovery of optimum value of result effective variable in known process is ordinarily within skill of art (In re Boesch and Slaney, 205 USPQ 215 (CCPA 1980)). One of skill in the art would have been expected to have a reasonable expectation of success because (i) method of genotyping transgenic KO mouse and performing PCR was known in the art, and hence "the combination of familiar elements according to known methods is likely to be obvious when it does no more than yield predictable results as evident from the teaching of Xiao and Wang. It should be noted that the KSR case forecloses the argument that a specific teaching, suggestion, or motivation is required to support a finding of obviousness See the recent Board decision Ex parte Smith , --USPQ2d--, slip op. at 20, (Bd. Pat. App. & Interf. June 25, 2007) (citing KSR , 82 USPQ2d at 1396) (available at http: www.uspto.gov/web/offices/dcom/bpai/prec/fd071925.pdf). Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-7 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The term “regularly” in claim 1, S4 is a relative term which renders the claim indefinite. The term “regularly” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The term regularly does not specific an exact frequency and is context dependent and therefore the metes and bounds of the phrase could not be ascertained. Claims 2-7 are included in the rejection because they directly or indirectly depend form the rejected base claim. Appropriate correction is required. Claim 2 is vague and indefinite to the extent claims fails to establish any nexus between taking 1-3mm tail tip of the mice genotype identification and phrase “tissue needing lysis”. It is unclear if tissue needing lysis is same as mice tail tip of some other tissue. The metes and bounds of the claims could not be ascertained. Claim 2 is further vague to the extent it recited a descriptive phrase “incubating in a water bath after vortex oscillation, after thoroughly mixing evenly by vortex oscillation”. Appropriate correction is required. Claim 3 recites lysis solution that is incomplete as it omits the starting concentration of the Tris-HCl stock solution and the final volume of lysis solution. Absent starting concentration of Tris-Hcl stock solution the metes and bounds of the resulting composition could not be ascertained. Appropriate correction is required. Claim 4 is vague and indefinite to the extent nexus between recitation of “Axin 1 forward primer, Axin 1 reverse primer, CreER forward primer, and CreER reverse primer” and “a sequence of the Axin1 forward primer is set forth in SEQ ID No.1; a sequence of Axin1 reverse primer is set forth in SEQ ID No.2; a sequence of CreER forward primer is set forth in SEQ ID No.3; a sequence of CreER reverse primer is set forth in SEQ ID No.4” could not be ascertained. Appropriate correction is required. Claim 5 is vague and indefinite because there is no nexus between recitation phrase “injection amount of tamoxifen is calculated based on the body weight of the Axin1 AgclER condition knockout mice” and phrase “injecting 1mg per 10g”. A directed recitation of mount tamoxifen injection would obviate the basis of the rejection. Appropriate correction is required. Conclusion No claims allowed. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Molina et al (Med Oral Patol Oral Cir Bucal. 2013 Mar 1;18 (2):e174-9.) teaches Ki67 is more specific marker of proliferation as compared to PCNA (abstrat). Any inquiry concerning this communication or earlier communications from the examiner should be directed to ANOOP K. SINGH whose telephone number is (571)272-3306. The examiner can normally be reached Monday-Friday, 8AM-5PM. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Peter Paras can be reached at (571)272-4517. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ANOOP K SINGH/Primary Examiner, Art Unit 1632
Read full office action

Prosecution Timeline

Apr 30, 2024
Application Filed
Aug 11, 2026
Non-Final Rejection mailed — §102, §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12703852
HEMATOPOIETIC PROGENITOR CELL MARKER
6y 9m to grant Granted Aug 11, 2026
Patent 12696885
CELLS, VERTEBRATES, POPULATIONS & METHODS
6y 7m to grant Granted Aug 04, 2026
Patent 12680078
DIFFERENTIATION OF PLURIPOTENT STEM CELLS AND CARDIAC PROGENITOR CELLS INTO STRIATED CARDIOMYOCYTE FIBERS USING LAMININS LN-511, LN-521 AND LN-221
8y 0m to grant Granted Jul 14, 2026
Patent 12680083
MEDIA FOR CULTURING NAIVE HUMAN PLURIPOTENT STEM CELLS
2y 5m to grant Granted Jul 14, 2026
Patent 12624352
DNA-RESPONSIVE HYDROGELS, METHODS OF ALTERING A PROPERTY OF A HYDROGEL, AND APPLICATIONS THEREOF
6y 3m to grant Granted May 12, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
43%
Grant Probability
99%
With Interview (+67.6%)
4y 2m (~1y 9m remaining)
Median Time to Grant
Low
PTA Risk
Based on 721 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month