DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 02/04/2026 has been entered.
Claim Status
Claims 15, 22-23 and new claims 32-37 are pending and examined here.
Priority
The claim to benefit of 63/416070, filed on 10/14/2022, and is a CON of 18/487663, filed on 10/16/2023 is recognized.
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosure of the prior-filed application, Application No. 63/416070, fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application.
‘070 does not disclose the GalNAc G1b moiety nor the modification patterns of examined claims, thus the examined claims enjoy the benefit of the parent application ‘663, on page 130, which discloses modified SEQ ID NOs, with EFD of 10/16/2023.
Response to Arguments
The Remarks of 02/04/2026 notes that “Applicant’s silence” regarding priority is not acquiescence to the Office’s statement.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 33-34 rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 33 recites the limitation "claim 33" in line 1. There is insufficient antecedent basis for this limitation in the claim. The claim depends on itself. Claim 34 does not overcome the indefiniteness, thus is rejected.
In the interest of compact prosecution, the claim will be interpreted to depend on claim 32.
Claim Rejections - 35 USC § 103
Rejection of claims 15, 22-23 is maintained, while the new claims 32-37 are rejected as noted below.
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 15, 22 and 23, 32-37 are rejected under 35 U.S.C. 103 as being unpatentable over Keating et al. (US20220364088, pub. 11/17/2022, with EFD: 10/22/2019, referred as Keating) and Kamola et al. (2017, PLoS Computational Biology, 11: e1004656, pg. 1-17, referred as Kamola) and Fakhr et al. (2016, Cancer Gene Ther., 23, 73-82, referred as Fakhr) and Foster et al. (2018, Molecular Ther., 26, pg. 708-717, referred as Foster) and Gengshen et al. (CN116854754, pub. 10/10/2023, a WIPO machine translation of CN116854754 and the untranslated version are provided, referred as Gengshen; all references are of record.
Regarding instant claims 15, 32, 35 instant base sequence of SEQ ID NO: 451 comprises 5' uUAGUAGAAUUUCUCUGUAGGC, a 22 nucleotide (nt.) sequence, while base sequence of SEQ ID NO: 444 comprises 5' CUACAGAGAAAUUCUACUAa 3', a 20 nt. sequence. All sequences noted in the action are from 5’ end orientation unless indicated otherwise. Instant SEQ ID NO: 444, 451 are modified forms.
Keating discloses iRNA agents, a double stranded RNA (dsRNA) agent for targeting complement component C3 gene (C3) (abstract); discloses antisense SEQ ID NO: 1529 (5’ aUAGUAGAAUUUCUCUGUAGGCu) and antisense SEQ ID NO: 1530 (5’ agUAGUAGAAUUUCUCUGUAGGC) that comprise 21 of the 22 nt. of instant SEQ ID NO: 3 (see instant SEQ ID NO: 3 above, underlined, bolded nt. indicates identical nt., while a lower case nt. designates a non-identical nt. compared to Keating strands). Keating discloses sense SEQ ID NOs, including SEQ ID NO: 1264 (cCUACAGAGAAAUUCUACUAu) and SEQ ID NO: 1265 (CUACAGAGAAAUUCUACUAcu). These comprise 19 nt. of the 20 nt. sequence of instant SEQ ID NO: 33 (see instant SEQ ID NO: 33 above, underlined, bolded indicates an identical sequence, while a lower case nt. designates a non-identical nt. compared to Keating strands).
Further Keating discloses that the aforementioned SEQ ID NOs are quite efficient (with Transfection Reagent (TX), the inhibition at 10 nM is almost 100%, and for free uptake (FU, i.e. without TX) the inhibition is at least 75%) in inhibiting the targeted transcript, see excerpt of Table 25 below, highlighting just the two duplexes comprising either (‘2.1-SEQ ID NOs: 1264/1529 or ‘3.1-SEQ ID NOs: 1265/1530, Table 20).
PNG
media_image1.png
194
799
media_image1.png
Greyscale
As indicated above, there is a nt. difference between Keating antisense and sense SEQ ID NOs and instant antisense and sense SEQ ID NOs.
Kamola discloses guidance for designing an improved siRNA to reduce off-target binding while still maintaining target inhibition: A/U at the 5’ end of the guide strand (also called the antisense strand), G/C at the 5’ end of the passenger strand (also called the sense strand), AU richness in the 5’ one-third region of the guide strand, and the absence of long GC stretches (pg. 2). Both Keating and instant SEQ ID NOs follow the suggested four rules. Then, figure 1 points out that nt. at position 1 of guide strand is not critical for silencing of the target mRNA transcript (see Fig. 1A, B) and that the essential sequence is the “seed” region of the guide/antisense strand (positions 2-8, see Fig. 1A). Thus, here, the mismatched nt. of instant guide SEQ ID NO: 3 at position 1 is in a non-seed region (it does not, at least, need to bind to the target transcript) and based on guidance of Kamola, can be either A or U, here it’s a U. Second, Fig. 1A also indicates a 2 nt. overhang for the guide strand at the 3’ end, similarly, here the duplex has a 2 nt. overhang. Further, the instant SEQ ID NO: 3 is complementary to a mRNA sequence that is nested within Keating SEQ ID NO: 1529 and 1530 (see underlined/bolded portion within pos. 761-800 of C3 transcript: 761-gtcatagtgg agcctacagagaaattctactacatctata).
Fakhr et al. discloses that siRNAs from 19 to 25 nt. have shown the same efficiency in silencing (pg. 75); thus here the difference of one nt. in length of antisense/guide strands would result in similar silencing outcomes (instant antisense is 22 nt., while of Keating is 23 nt.).
Further, despite a nt. differences between Keating’s iRNA agents (i.e. between ‘2.1-SEQ ID NOs: 1264/1529 and ‘3.1-SEQ ID NOs: 1265/1530, Table 20), there is a de minimis difference in their inhibition levels, especially with a transfection agent (see Table above with Tx). And both the iRNA agents provide a core sequence UAGUAGAAUUUCUCUGUAGGC in the guide/antisense strands that still provide result of greater than 75% inhibition.
Regarding the sense strands, the art indicates that it is degraded (Kamola, pg.2) and is 100% complementary to antisense strand.
Keating, Kamola, Fakhr do not disclose the modification pattern of elected SEQ ID NO: 451/463 or the pattern of cl. 29 (same modification pattern as cl. 14).
Regarding the modification pattern of instant isolated oligonucleotide, although Keating does not disclose the exact 2F and 2OMe modification pattern with interspersed phosphorothioate linkage within the siRNA, it would have been obvious for one ordinarily skilled in the art to have obviously tried workable modification patterns based on prior art to achieve improved results (see MPEP 2143(I)(E)).
Foster demonstrates that substantial efficacy improvements can be achieved by optimizing the position of 2F and 2OMe modifications across both the strands of the siRNA duplex to enhance stability without comprising intrinsic RNAi activity (abstract). Foster highlights that modifying the 2’ position of RNA can significantly enhance the stability of oligonucleotides and that the bulky 2OMe has a greater stabilizing effect than the less bulky 2F modification, however, steric bulk, “if not applied judiciously” results in reduction of RNAi activity (pg. 708). Before conducting bench studies, they conducted an in silico analysis based on a dataset of 1,890 duplexes with varying 2F and 2OMe composition across five targets and 15 target sites. The in silico results describe the impact of 2F relative to 2OMe at each position in the antisense strand (AS) and sense strand (SS) (Foster’s fig. 1A, B is provided below, and indicates “Negative numbers indicate activity improvement with inclusion of 2’-F relative to 2’-OMe at that position, positive numbers reflect decreased activity. Asterisks (*) indicate significant differences between 2’-F and 2’-OMe at the noted positions” (pg. 709, 710, Fig. 1). Foster also reduced the overall numbers of 2F with the rationale that 2OMe significantly enhances nuclease stability thus having a greater stabilizing effect while still maintaining inhibitory activity (pg. 708).
Foster: Fig. 1A, B, pg. 710.
PNG
media_image2.png
200
400
media_image2.png
Greyscale
Foster’s sense strand data of Fig. 1B shows significant inhibition differences between 2OMe and 2F at various positions, except for position 11 of sense strand (Fig. 1B), which has a strong (and a significant) preference for 2F, there is not a strong preference for 2OMe or 2F along the sense strand. Here, instant sense strand also has a 2F at position 11. Similarly reviewing the antisense strand data of Fig. 1A, there is a strong (and significant) preference for 2F at pos. 2 and 14, and a strong preference for 2OMe at position 21. Here instant antisense strand has 2F at pos. 2 and 14 and a 2OMe at pos. 21.
Using the in silico data as a starting point, Foster tested various sense and antisense strands pattern modifications in vitro and in vivo with the aim to identify an optimal 2OMe and 2F modification pattern, while maintaining a low 2F content, across a siRNA targeting a murine transthyretin gene (abstract, Fig. 1C, D, and other figures). Thus, it is known in the art to modify the nt. positions of 2OMe and 2F on a siRNA to identify a modification pattern(s) that improve stability and maintain or increase activity
In the instant claims (considering the duplex), there are 42 nt. in the duplex and 12 nt. contain 2’F (29%), while 30 nt. are 2’OMe (71%).
Similarly, regarding PS linkages, Foster introduced PS linkages in the antisense strand between position 1 and 2, 2 and 3, 21 and 22 and 22 and 23 and for sense strands, between position 1 and 2 and 2 and 3 from 5’ end (all nt. positions are from 5’ end unless indicated otherwise). Foster discloses that PS linkages provide additional protection against 3’ and 5’ exonucleases and thus are placed at terminal ends (pg. 708). Thus modifying the PS linkage content is known in the art.
Thus, substitution of equivalents in terms of identifying workable or optimal positions for both potency and reduced toxic effects by 2’F and 2’OMe modifications in a double-stranded NA strand is known in the prior art.
Thus, a skilled artisan could have pursued the known solutions of 2’F, 2’OMe modifications, and phosphorothioate linkages at various positions of the siRNA (relevant to instant cl. 14, 29).
Keating, Kamola, Fakhr, and Foster do not disclose the three GalNac G1b moieties at 3’ end of the sense strand (cl. 15, 32, 35).
Gengshen discloses siRNAs that targets proprotein convertase subtilisin 9 (PCSK9) with N-acetylgalactosamine (GalNAc) conjugate moieties bound to the 1’ position of a ribose moiety (see formula of pg. 1 of machine translation and many embodiments throughout the publication). GalNAc conjugate is a high-affinity ligand that binds to asialoglycoprotein receptor (ASGPR) on hepatocytes and the conjugate is used as a delivery vehicle to target nucleic acids to the liver and has shown a long-term in vivo silencing activity (pg. 1). Gengshen studied various forms of GalNac conjugated to the sugar moiety of a nucleotide with various types of linkers and at various positions on the ribose (see untranslated pub. pg. 63-68, 0222-0223), most GalNAc are conjugated at the 1’ position via a linker comprising carbon chain of various lengths or substituted carbon chains of varying lengths, comprising polyethylene glycol or amide moiety. One GalNAc conjugate studied is “inc-GalNac 1b” (see figure below). The “inc-GalNAc 1b” appears similar to instant GalNAc G1b moiety (relevant to instant cl. 15).
PNG
media_image3.png
258
402
media_image3.png
Greyscale
Pg. 32 of translated Gengshen indicates “[p]reparation of GalNAc-conjugated [of] siRNA sense strand” and as indicated in figure above, the GalNAc 1b is conjugated at the 3’ end (see also Table on pg. 63 of untranslated version, as 2nd column appears to indicate whether the 5’ or 3’ is modified) . Although inc-GalNAc 1b does not result in the highest level of inhibition of target transcript in serum at day 7 (D7) following treatment when compared with other siRNA conjugates, at 14 days (D14) it has comparable level of inhibition (85% of G1b v. low 90s of G#s, see Fig. 1 below). Here, there are 3 GalNAc G1b moieties, apparently, at the 3’ end of the sense strand (relevant to instant cl. 15, 26-27, 30, 31).
PNG
media_image4.png
674
790
media_image4.png
Greyscale
One of the KSR rationale that may be used to support a conclusion of obviousness is that there is some teaching, suggestion, or motivation in the prior art that would have led one of ordinary skill to modify the prior art reference or to combine prior art reference teachings to arrive at the claimed invention. Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified the noted iRNA agents of Keating as noted by Kamola and Fakhr and arrive at the claimed invention with a reasonable expectation of success. Here, recognizing that a) even with a couple nt. differences between Keating’s iRNA agent duplexes, as long as the iRNA agents comprise a core sequence in the guide strand (see SEQ ID NOs: 1529/1264 and 1530/1265) there is similar inhibitory outcomes; and b) Fakhr teaches that siRNAs of 19-25 nt. in length have similar inhibition outcomes; and c) using the siRNA design guidance provided by Kamola, a skilled artisan would expect similar successful results by following Kamola’s guidance and incorporating the core antisense strand sequence that targets the same site of the C3 transcript to inhibit expression of C3 transcript.
Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have modified either sense strand SEQ ID NO: 1264/1265 of iRNA agent of Keating in view of Gengshen and arrive at the claimed invention with a reasonable expectation of success. Here, a skilled artisan can select, based on preference, any one of the GalNAc conjugates modified at 1’ position of the ribose disclosed by Gengshen, including GalNAc 1b, for comparable results in inhibition of target transcript and delivery to the liver.
One of the KSR’s rationale for supporting conclusion of obviousness is “obvious to try,” requiring the following three findings: (1) a finding that at the relevant time, there had been a recognized problem or need in the art, which may include a design need or market pressure to solve a problem; (2) a finding that there had been a finite number of identified, predictable potential solutions to the recognized need or problem; (3) a finding that one of ordinary skill in the art could have pursued the known potential solutions with a reasonable expectation of success.
Therefore, it would have been prima facie obvious for one of ordinary skill in the art before the filing date of the claimed invention to have tried modifying the dsRNA agent comprising SEQ ID NOs: 1529/1264 or 1530/1265 of Keating in view of Foster to have arrived at the claimed invention with a reasonable expectation of success. Because Foster discloses optimizing the positions of 2OMe and 2F modifications on a siRNA, a skilled artisan with these known, finite modification options would expect that these modifications would successfully result in a stable siRNA that can target hepatocytes in vivo and result in inhibition of target gene.
In as much claims 32 and 35 recite the antisense and sense strands “consisting” of the nucleic acid sequences of SEQ ID NO: 451 and 444, the noted SEQ ID NOs 1264/1529 and 1265/1530 of Keating are not patentably distinct from the claimed sequences.
Thus, claims 15, 32, 35 are obvious.
Regarding instant cl. 22, 33, 36 Keating discloses iRNA can be delivered using drug delivery system, such as nanoparticle (par. 579).
Regarding instant cl. 23, 34, 37 Keating discloses a pharmaceutical composition containing dsRNA agent and a pharmaceutically acceptable carrier (par. 583).
Response to Arguments
Applicant's arguments filed 02/02/2026 (“the Remarks”) have been fully considered but they are not persuasive.
Before the Remarks are addressed, the Examiner suggests that the Applicant consider whether 102(b)(1)(B) exception applies to instant rejection of record, specifically to the Gengshen reference, since Gengshen specifically cites Wang and Cai reference WO2023014938 for its comparator product G1b moiety:
PNG
media_image5.png
323
503
media_image5.png
Greyscale
.
The Remarks of 08/08/2025, pg. 17, note that the subject matter disclosed in the US Pub., which also has Wang and Cai as authors, was owned by the same person or subject to an obligation of assignment to the same person. The WO pub. cited by Gengshen also has Wang and Cai as authors.
The Remarks insist on the following:
There is no rationale to pick cited sequences SEQ ID NO: 1264/1529 and 1265/1560 of Keating since there are oligonucleotides with “comparable or better potency” and the selection of the cited SEQ ID NOs is an impermissible hindsight rationale (pg. 6).
The cited SEQ ID NOs require further modification, i.e. removal/addition of nucleotides and a skilled artisan would have no motivation to modify any of the sequences of Keating through the removal and/or addition of one or more nucleotides (pg. 6-7). The Remarks further argue that if the Keating is reviewed in its entirety, then it would be understood that “removal and/or addition of one, two, or three nucleotides can yield sequences with drastically different biological activities” (pg. 7). Then Remarks proceed to compare numerous, non-claimed duplexes that have one to four nucleotide differences, but each sequence yields drastically different biological activities from sequence with one up to four nt. difference (pg. 7-8). Using this data, the Remarks proffer that “Office’s assertion that ‘differences in one nt. in length of antisense/guide strands would result in similar silencing outcomes’ clearly lacks evidentiary support” (pg. 8).
The Remarks insist that there is no rationale of selecting GalNAc G1b moiety and that G1b moiety is just a “comparator compound” and points to other Gengshen GalNAc moieties (inc-G12, inc-G5, inc-G6, etc. . . ) that would be preferred (pg. 9-10). Thus, based on Keating’s evidence that “even slight modifications to the nucleotide sequence can lead to unpredictable changes in biological activities of an siRNA” and “incorporation of different targeting ligands, particularly those with distinctly different chemical attributes, can lead to significantly different biological activities that cannot be predicted without undue experimentation,” a skilled artisan would not expect reasonable success in combination of Keating siRNA and Gengshen GalNAc G1b targeting ligand (pg. 11).
Then noting that Examiner stated “that number of potential modifications that are possible in an siRNA is ‘daunting” because “there exists an exceedingly vast number of possible modification patterns” (i.e., “more than billions of combinations”), that this daunting number of potential modification of siRNA “cannot be reconciled with the requirement of a finite number of solutions” as required under obvious to try rationale (pg. 11-12). The Remarks indicate that reading of Foster is “over-simplif[ied].” The Remarks indicate that “courts have explained that it is improper to assert that something is ‘obvious to try’ when would have ‘to vary all parameters or try each of numerous possible choices until one possibly arrived at a successful result” (pg. 14). The Remarks indicate that Office has “provided no siRNA of Keating which has a 2F content higher and a 2OMe content lower than the instantly claimed oligonucleotide” nor how these changes should be applied to the individual 22 and 20 nt. of claimed sequence and remain functional and highly efficient (pg. 14-15).
The Remarks further add the unexpected results were noted in prior Action (8/8/2025) (pg. 15).
The argument is not persuasive.
In response to applicant's argument 1) that the examiner's conclusion of obviousness is based upon improper hindsight reasoning, it must be recognized that any judgment on obviousness is in a sense necessarily a reconstruction based upon hindsight reasoning. But so long as it takes into account only knowledge which was within the level of ordinary skill at the time the claimed invention was made, and does not include knowledge gleaned only from the applicant's disclosure, such a reconstruction is proper. See In re McLaughlin, 443 F.2d 1392, 170 USPQ 209 (CCPA 1971). Here, the prior art discloses all the elements of the instant claimed subject matter. Further, it is also difficult to argue that there is improper hindsight reasoning since it is noted both in the prior actions that the exact modification pattern nor the sequences are disclosed in the prior art. But nevertheless, the claimed subject matter does not overcome the obviousness rejection on the basis that the cited references make the invention obvious.
Second, regarding argument 1, Keating’s SEQ ID NO: 1529/1264 and 1530/1264 show greater than 75% inhibition, thus a skilled artisan could select either of the duplex or identify a consensus sequence from the antisense strands to generate a siRNA based on Kamola/Fakhr design suggestion and have reasonable success for target inhibition. Kamola teaches that the 1st nt. and last nt. position of a guide strand is not critical for its degradation processing, and Fakhr teaches that a siRNA with length ranging from 19-25 have shown similar efficiency in silencing (see pg. 5-6, Action of 08/02/25). Keating provides the accessible region of the mRNA transcript that is capable of binding to the guide/antisense strand for target inhibition.
The Remarks argument 2) noting other Keating sequences with nt. difference(s) having negative effect on their silencing activity is not relevant since those sequences are not claimed. Further, even with nucleotide differences between Keating’s cited siRNAs comprising 1264/1529 and 1265/1530 the results demonstrate comparable potent, silencing activity, and thus would provide a further reason to select duplexes of SEQ ID NOs: 1264/1529 and 1265/1530 or targeting the same region of the target transcript. Regarding Keating’s SEQ ID NOs 1264/1529 or 1265/1530 would require further modifications, it should be noted that the argument is that Keating’s SEQ ID NOs are not patentably distinct from instant claimed SEQ ID NOs and thus there is no requirement of additional/removal of nucleotides.
Regarding argument (2, 3), MPEP 2123 notes that there is no requirement to select the most efficient or a best product: a known or obvious composition does not become patentable simply because it has been described as somewhat inferior to some other product for the same use. Here, identifying other GalNAc moieties of Gengshen does not take away from its disclosure of a functional G1b GalNAc moiety. Thus, a skilled artisan would reasonably expect success by combining the GalNAc G1b moiety of Gengshen conjugated to Keating siRNA, since neither notes that their respective composition resulted in a loss of inhibition activity.
Regarding argument 4) with the disclosure of Foster, a skilled artisan understands altering the modification pattern of 2OMe and 2F positions as taught by Foster while maintaining a low 2F and higher 2OMe content of a siRNA from a functional modification parent pattern, which had a higher 2F content, can still result in a comparable or even more potent siRNA molecule. Thus, a skilled artisan would expect reasonable success in achieving comparable or improved silencing activity even if modification pattern is altered.
Further, addressing the argument (4) that the “obvious to try” rationale is misapplied with the application of Foster’s teachings, since there is not a finite but rather a possibility of billions of permutations. Foster as a secondary reference would not be a mischaracterization, nor a “legal error”, of “obvious to try” rationale, since Foster indicates to decrease the overall 2F content for the bulkier/stable 2OMe modification and provides finite options to try to test out, even if it does not disclose the instant modification pattern..
First, Foster only demonstrates modification of two finite, known modifications at the 2’ ribose positions, 2F and 2OMe, of the siRNA.
Second, predictive analysis graph of Fig. 1A and 1B from in silico model provides a starting point for many modifications, since even Foster recognizes the daunting number of modifications that are possible (“221 or 223 possible permutations for sense and antisense, respectively”, pg. 709). Although, concerning inhibition of Fig. 1A and 1B, there appears to be a significant difference for preference of 2F at numerous positions (8 positions for AS and 7 positions for sense strands, 15/44 of total siRNA), for the remaining positions (i.e. 29 positions), either 2OMe and 2F modification could be used without significantly impacting the activity the siRNA. Foster, further tests the most critical preferences of both antisense (AS) and sense strands in Fig. 1C, pos. 2, 6, 14 of AS strand, and pos. 11 of pos. sense strand, confirming that, except pos. 6, the preference at pos. 2, 14 of AS strand and pos. 11 of sense strand is 2F.
Considering the instant modified antisense strand (SEQ ID NO: 451), the positions 2, 3, 5, 7, 10, 14 and 16 are 2F. Based on the results of Foster fig. 1A and 2A, positions 2, 3, 5, 14 and 16 have preference for 2F, and pos. 7, 10 can be either 2OMe or 2F, or alternatively, a skilled artisan can test those two questionable positions. Fig. 2A demonstrates that pos. 9, which Fig. 1A shows that pos. 9 has 2F preference, but, surprisingly, changing it to 2OMe makes it more active (see DV6); also similarly Fig. 1A indicates a 2OMe preference for pos. 8, but is tested to confirm that preference in Fig. 2A.
Similarly a skilled artisan can also use the data of Fig. 1B to identify the positions where 2F is preferred (pos. 8-11, 16) for the sense strand. Instant SEQ ID NO: 444 has 2F at positions 6, 8-11. Thus, instant 2F at positions 8-11 follows guidance of Fig. 1B and position 6 can be either 2F and 2OMe without significantly impact of the siRNA. Alternatively, a skilled artisan can also confirm whether the preference of 2F sites indicated in the Fig. 1B for the sense strand, as Foster has done in Fig. 2B and provides further data whether the preferred 2F sites are actually preferred.
Third, although instant 2F percentage content is ~29% range outside (i.e. “contrary” as noted in pg. 12-13). Foster tests 2F content from ranges of 18% 2F content (DV22 siRNA) to 50% 2F content of the parent molecule, which is also a functional siRNA (see also DV6/DV7 in Fig. 2A, testing up to 41% 2F content). Thus, the instant 2F content of ~29% is within the range taught within the art.
Regardless, as Foster tackles a daunting number of potential permutations, a skilled artisan can also use their prior observation, i.e. creating a similar graph of fig. 1A and 1B of Foster for a sequence in their hands, or the prior art of record and modify select positions. Thus, Foster provides both a finite number of modifications (2OMe and 2F) to test and strategy to identify select positions to try further optimization of “ESC” parent molecule was “achieved by a >50% reduction in 2’-F content (and a concomitant increase in 2’-OMe content) across both strands of the siRNA” (pg. 714).
Regarding unexpected results (5) argument, as noted in prior Action, the Remarks point to Fig. 5A and 5B to demonstrate unexpected results.
Keating does not test the AD-569262/569263 in vivo; however, they are very efficient in inhibiting the target gene in vitro (see action, Table 25, inhibition at least 75% with free uptake conditions, i.e. without transfection agent, and 100% with transfection agent).
Instant specification Table 2 provides in vitro results of SEQ ID NO: 3/33 in transfection reagent (Lipofectamine RNAiMAX) at concentration (excerpt of Table 2 is noted below).
PNG
media_image6.png
125
646
media_image6.png
Greyscale
Comparing similar conditions in Keating with the use of transfection agent and an unmodified sequence, the results are noted below (Table 33, it should be noted it is not clear if Keating’s duplex is unmodified or modified, since it uses the same Duplex number for both modified and unmodified form):
PNG
media_image7.png
89
299
media_image7.png
Greyscale
Comparing similar concentration (0.1 nM), claimed product notes ~11% target remaining, while Keating has 41% remaining, the differences may be due to the cell-types. The PCH are primary cynomolgus hepatocytes (par. 703), which are isolated healthy liver tissue and closely mimic in vivo conditions, while Huh-7 cell is a dividing cancer cell line. Thus the differences may be due to the transfection efficiency between the two cell lines; since for Keating at a higher dose of 10 nM, there is only 7% target mRNA remaining.
Thus, it can be argued that the inhibition levels are similar and it not unexpected.
Although Keating does not provide in vivo results for the AD-569262/siRNA of SEQ ID NO: 1529, in vivo results are provided for AD-1181519, AD-569268, and AD-570714 (see Fig. 10, with some reaching inhibition levels below 20% for at least 57 days) and their corresponding in vitro results are similar to AD-569262 (see excerpt of Table 33 of noted products with similar results).
PNG
media_image8.png
219
449
media_image8.png
Greyscale
Thus, it is reasonable to expect that SEQ ID NO: 1264 (AD-569262) in vivo effects would be similar as those products for which the in vivo results are provided.
Thus, the results are not unexpected and the rejection of the examined claims is maintained.
Double Patenting
The rejection of claims 15, 22-23 is maintained and new claims 32-37 are rejected as noted below.
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 15, 22-23, 32-37 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1, 53, 54, 55, 56, and 58 of copending Application No. 18/487663 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other.
Claim 1 of ‘663 teaches an isolated oligonucleotide comprising a sense strand and an antisense strand, wherein the sense strand comprises a nucleotide sequence that is substantially identical to region comprising 19-25 nt. between any one of the nucleotide positions selected from, one species is b) 772-801 from the 5’ end of a human complement C3 mRNA sequence according to SEQ ID NO: 1 and the antisense strand is substantially complementary to the sense strand to form a double stranded region. Instant sense SEQ ID NO: 33 reads on position 774-792 of SEQ ID NO: 1, while antisense strand is complementary to position 772-792 of SEQ ID NO: 1. Here, the SEQ ID NO: 3 would be a species strand of the genus “antisense strand is substantially complementary to the sense strand,” thus reading on cl. 1.
Claim 53(i) of ‘663 teaches the exact antisense strand SEQ ID NO: 451, corresponding to instant cl. 15, 32, 35.
Claim 54(i) of ‘663 teaches the exact sense strand SEQ ID NO: 444, corresponding to instant cl. 15, 32, 35.
Claim 55(i) and (iii) of ‘663 teaches both antisense and sense strands SEQ ID NO: 451/444 and SEQ ID NO: 457/444, corresponding to instant cl. 15, 32, 35.
The G1b conjugated to SEQ ID NO: 444 is a ligand-conjugated delivery system, thus corresponds to instant cl. 22, 33, 36.
Claim 58 of ‘663 corresponds to instant cl. 23, 34, 37.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Response to Arguments
The Remarks of 02/02/2026 simply note the following conclusory statement without an argument or provision of evidence: Applicant disagrees and insists that the instant claims are patentably distinct from those of the ‘663 application.
Thus, the provisional nonstatutory double patenting rejection is maintained.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to KEYUR A. VYAS whose telephone number is (571)272-0924. The examiner can normally be reached M-F 9am - 4 pm (EST).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Jennifer Dunston can be reached on 571-272-2916. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/KEYUR A VYAS/Examiner, Art Unit 1637
/Jennifer Dunston/Supervisory Patent Examiner, Art Unit 1637