DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Status of the Claims
Applicant’s submission filed 02 June 2026 has been entered. Claims 1-2, 6-11, 14-15, 19-20, and 22-25 are pending. Claims 1, 11, 19, and 23 have been amended, while claim 21 has been cancelled without prejudice or disclaimer and claims 24-25 have been newly added. Therefore, prosecution on the merits continues for claims 1-2, 6-11, 14-15, 19-20, and 22-25. All arguments have been fully considered with the status of each prior ground of rejection set forth below.
Status of Prior Rejections/Response to Arguments
RE: Rejection of claims 1-2, 6-11, 14-15, and 19-23 under 35 USC 103 over Cherqui in view of Lundberg et al
The cancellation of claim 21 renders the rejection moot for that claim. For the remaining claims, Applicant’s arguments filed 02 June 2026 have been fully considered but they are not persuasive.
Applicant has traversed the rejection, asserting in Pages 1-2 of the Remarks filed 02 June 2026 that Cherqui fails to teach or suggest that the efficacy of the gene editing ranges at least from about 17% to 30%. In response, the Examiner respectfully submits that Cherqui teaches that the CRISPR gene editing system – including crRNAs – are comprised within a self-inactivating lentiviral vector. See, for example, Paragraphs [0045] and [0102] of Cherqui. With that, Cherqui further teaches that the use of a self-inactivating lentiviral vector allows for a gene correction of about 20% in HSPCs affected by Adrenoleukodystrophy. See, for example, Paragraphs [0078]-[0080] of Cherqui. Therefore, the ordinary artisan would have reasonably expected the gene correction efficacy to also be about 20% in HSPCs expressing a mutated frataxin gene, as they are contacted with a self-inactivating lentiviral vector comprising a CRISPR gene system. The Examiner also notes that it is not required that the expectation of success be a certainty; only one that is reasonable to a person of ordinary skill. In re Longi, 759 F.2d 887, 897 (Fed. Cir. 1985) (“Only a reasonable expectation of success, not absolute predictability, is necessary for a conclusion of obviousness”).
Applicant has further traversed the rejection, asserting on Pages 2-4 of the Remarks filed 02 June 2026 that the ordinary artisan would not have been motivated to utilize two crRNA sequences as instantly claimed given the disclosure of Lundberg et al. In response, the Examiner respectfully submits that Lundberg et al disclose the deletion of an abnormal repeat expansion within the FXN gene, wherein two double-stranded DNA breaks are induced at either side of the expanded region. See, for example, Paragraph [0083] of Lundberg et al. As crRNAs guide the CRISPR/Cas9 system to the target nucleic acids for the double-stranded breaks (Lundberg et al: Paragraphs [0076], [0080]-[0081]), the ordinary artisan would have understood that two crRNAs are required to create the double-stranded breaks on either side of the abnormal repeat expansion within the FXN gene.
With that, Applicant has further traversed the rejection, asserting on Pages 2-4 of the Remarks filed 04 February 2026 that the ordinary artisan would not have been motivated to select SEQ ID NOs: 16242 and 16721 from the disclosure of Lundberg et al since SEQ ID NO: 16721 is not on the prioritized list of crRNAs. In response, the Examiner respectfully submits that a reference may be relied upon for all that it would have reasonably suggested to one having ordinary skill in the art, even nonpreferred embodiments. See MPEP § 2123: Merck & Co. v. Biocraft Labs., Inc. 874 F.2d 804, 10 USPQ2d 1843 (Fed. Cir. 1989), cert. denied, 493 U.S. 975 (1989); Upsher-Smith Labs. v. Pamlab, LLC, 412 F.3d 1319, 1323, 75 USPQ2d 1213, 1215 (Fed. Cir. 2005). In the instant case, not having SEQ ID NO: 16721 on the prioritized list does not constitute a teaching away from the use of it, and the ordinary artisan still would have been motivated to substitute the crRNA sequences of Cherqui with the crRNA sequence of Lundberg et al since they allow for the removal of GAA repeats within the first intron of a mutated human FXN gene (Cherqui: Paragraph [0102]; Lundberg et al: Paragraph [0214], [0223]).
Applicant has further traversed the rejection, asserting in Pages 5-6 of the Remarks filed 02 June 2026 that arriving at the claimed invention involves more than a simple substitution of crRNA sequences, as the effectiveness of a crRNA pair relies on multiple factors. With that, Applicant furthers the traversal, asserting that Lundberg et al fail to reduce to practice the excision of a GAA repeat expansion using any gRNA pair. In response, the Examiner respectfully submits that the ordinary artisan would have reasonably been able to substitute the crRNA sequences of Cherqui and Lundberg et al since both are concerned with the removal of an expanded region within the first intron of a mutated FXN gene, thereby making the CRISPR/Cas9 RNA sequences functionally comparable. Although there may be discrepancies between the crRNA pairs based on the multiple factors, it would not have been outside the skillset of the ordinary artisan nor cause undue experimentation to arrive at the claimed crRNA pair and determine the gene editing efficacy, as “experiments involving repetition or commonly used techniques” are enabled. See Cephalon, Inc. v. Watson Pharm., Inc., 707 F.3d 1330, 1339-40 (Fed. Cir. 2013).
Applicant has lastly traversed the rejection, asserting in Pages 4-5 and 7 of the Remarks filed 02 June 2026 that the removal of the GAA expansion in intron 1 of the FXN gene using a CRISPR/Cas9 gene editing system having crRNAs as set forth in instant SEQ ID NOs: 18 and 21 unexpectedly had a gene editing efficiency that can reach 60% with no off-target activity or cytotoxic effects. Applicant cites Paragraphs [0147], [0160]-[0164] and Figures 11A-B of the instant disclosure to support this assertion. In response, the Examiner respectfully reminds Applicant that, in submitting evidence asserted to establish unobvious results, there is a burden on Applicant to indicate how the examples asserted to represent the claimed invention are considered to relate to the examples intended to represent the prior art and, particularly, to indicate how those latter examples do represent the closest prior art. The evidence relied upon should also be reasonably commensurate in scope with the subject matter claimed and illustrate the claimed subject matter relative to the prior art subject matter. See MPEP § 2145. It should also be established that the differences in the results are in fact unexpected and unobvious and of both statistical and practical significance. See MPEP § 716.02(b). In the instant case, the referenced paragraphs and figures are not commensurate in scope with the instant claims. More specifically, the instant claims require the gene editing of HSPCS, whereas the supporting data for the purported unexpected results performs gene editing on lymphoblasts. As lymphoblasts are not HSPCs, and the ordinary artisan would understand that gRNA cutting efficiency is highly cell-type dependent, the unexpected results are not commensurate in scope with the instant claims.
Therefore, the rejection is maintained and amended to encompass the claims as currently written.
RE: Rejection of claims 1-2, 6-11, 14-15, and 19-23 over claims 1-12 of US Patent No. 12,011,488 B2 in view of Lundberg et al
The cancellation of claim 21 renders the rejection moot for that claim. For the remaining claims, Applicant has traversed the rejection, asserting in Page 8 of the Remarks filed 02 June 2026 that the patented claims do not recite a gene editing efficacy that ranges from at least about 17% to about 30%, as now required within independent claims 1, 11, and 19. In response, the Examiner respectfully submits that Applicant’s amendment presents a new limitation that has not previously been considered and thus obviates the rejection of record.
Therefore, the rejection is withdrawn.
RE: Rejection of claims 1-2, 6-11, 14-15, and 19-23 over claims 1-5 and 13-14 of US Patent No. 12,012,437 B2 in view of Lundberg et al and Cherqui
The cancellation of claim 21 renders the rejection moot for that claim. For the remaining claims, Applicant has traversed the rejection, asserting in Page 8 of the Remarks filed 02 June 2026 that the patented claims do not recite a gene editing efficacy that ranges from at least about 17% to about 30%, as now required within independent claims 1, 11, and 19. In response, the Examiner respectfully submits that the disclosure of Cherqui reasonably suggests a gene editing efficacy of about 20%. See, for example, Paragraphs [0045], [0080], and [0102] of Cherqui.
Therefore, the rejection is withdrawn and amended to encompass the claims as written.
RE: Provisional rejection of claims 1-2, 6-11, 14-15, and 19-23 over claims 1-12 of copending Application No. 18/658138 in view of Lundberg et al and Cherqui
The cancellation of claim 21 renders the rejection moot for that claim. For the remaining claims, Applicant has traversed the rejection, asserting in Page 9 of the Remarks filed 02 June 2026 that the patented claims do not recite a gene editing efficacy that ranges from at least about 17% to about 30%, as now required within independent claims 1, 11, and 19. In response, the Examiner respectfully submits that the disclosure of Cherqui reasonably suggests a gene editing efficacy of about 20%. See, for example, Paragraphs [0045], [0080], and [0102] of Cherqui.
Therefore, the rejection is withdrawn and amended to encompass the claims as written.
New/Maintained Grounds of Rejection
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 23-25 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Regarding claims 23 and 25: The instant claims each recite the limitation “wherein efficacy of the gene editing ranges from about 40% to 62%”. The scope of each claim is indefinite, as the recited range does not fall within the range of “at least from about 17% to 30%” recited within parent claims 19 and 11, respectively. Therefore, the ordinary artisan cannot determine the metes and bounds of the claim, thus rendering the scope of the claim indefinite.
Appropriate correction is required.
Regarding claim 24: The instant claim recites the limitation “wherein efficacy of the gene editing ranges from about 17% to 62%”. The scope of the claim is indefinite, as the recited range is broader than the range of “at least from about 17% to 30%” recited within parent claim 1. Therefore, the ordinary artisan cannot determine the metes and bounds of the claim, thus rendering the scope of the claim indefinite.
Appropriate correction is required.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 24 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends.
Regarding claim 24: The instant claim recites the limitation “wherein efficacy of the gene editing ranges from about 17% to 62%”. As this broadens the scope of parent claim 1 – which recites that “the efficacy of gene editing ranges at least from about 17% to 30” – dependent claim 24 fails to further limit the parent claim.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-2, 6-11, 14-15, 19-20, and 24 are rejected under 35 U.S.C. 103 as being obvious over Cherqui (WO 2017/165167 A1, of record on IDS filed 05 May 2025) in view of Lundberg et al (US 2019/0160186 A1, of record).
Cherqui is considered prior art under 35 USC 102(a)(1) when considering the priority date for instant claims 1-2 and 6-18 is 16 March 2020. Therefore, even though the inventor is the same for the reference application and the instant application, the publication date of the reference application is greater than one year before the effective filing date of the instant application and cannot be excepted under 35 USC 102(b)(1). See MPEP § 2153. Likewise, Lundberg et al is considered prior art under 35 USC 102(a)(1) and 35 USC 102(a)(2) when considering the priority date for instant claims 1-2 and 6-18 is 16 March 2020.
Regarding claims 1-2, 6, 11, 19, and 24: Cherqui discloses methods for treating a disease or disorder associated with mitochondrial dysfunction through ex vivo introduction of a nucleic acid molecule into hematopoietic stem and progenitor cells (HSPCs) followed by transplantation of the HSPCs into a subject in need of treatment (Abstract).
As such, Cherqui discloses the treatment of Friedreich’s ataxia in a subject via the administration of a CRISPR/Cas system to HSPCs of the subject, wherein the HSPCs express a mutated human frataxin (hFXN) gene comprising a trinucleotide extension mutation that results in the expansion of GAA repeats in the first intron of the hFXN gene, and wherein the administration of the CRISPR/Cas system removes the expanded GAA repeats and increases the levels of hFXN protein and hFXN mRNA in the HSPCs relative to the levels of hFXN protein and hFXN mRNA in the HSPCs prior to gene editing (Abstract; Paragraphs [0007]-[0008], [0014], [0031], [0039], [0041]-[0045], [0068]-[0071], [0074]-[0075], [0078]-[0079], [0081], [0102]; Figures 2-3). Cherqui further discloses that the mitochondrial function of the gene edited HSPCs is enhanced relative to the mitochondrial function of the HSPCs prior to gene editing (Paragraphs [0084], [0094]-[0096]).
Cherqui further discloses that the CRISPR/Cas system – including crRNAs – is comprised within a self-inactivating lentiviral vector, wherein administration of self-inactivating lentiviral vectors to HSPCs has been found to have a gene correction efficacy of about 20% (Paragraphs [0045], [0078]-[0080], [0102]).
Cherqui does not disclose that the CRISPR/Cas system comprises crRNA sequences having a sequence as set forth in instant SEQ ID NO: 18 and instant SEQ ID NO: 21, as required by instant claims 1, 11, and 19.
Lundberg et al, however, disclose materials and methods for editing and/or modulating the expression of the FXN gene in a cell by genome editing, and methods of treatment therefrom (Abstract).
As such, Lundberg et al disclose ex vivo and in vivo methods for removing an abnormal repeat expansion within the first intron of a mutated FXN gene using a CRISPR/Cas genome engineering system, wherein two double-stranded DNA breaks are induced at either side of the expanded region (Paragraphs [0020], [0036], [0083], [0226]-[0227], [0230], [0273], [0275]). Lundberg et al further disclose that the CRISPR/Cas9 RNA sequences (crRNAs) include those as shown in SEQ ID NOs: 16242 and 16721, which have 100% identity to instant SEQ ID NOs: 18 and 21, respectively (Paragraphs [0387]-[0390]; Tables 5-6). See sequence alignment at the end of the Office action.
Lundberg et al further disclose that the efficacy of the gene editing treatment is at least 10% (Paragraph [0376])
Therefore, it would have been prima facie obvious to have substituted the crRNA sequences within the system of Cherqui with the crRNA sequences detailed in Lundberg et al, as doing so would have been a simple substitution of one crRNA sequence for another. See MPEP § 2143(I)(B). One of ordinary skill in the art before the effective filing date of the instant invention would have recognized that the CRISPR/Cas9 RNA sequences are functionally comparable, as both sets allow for the removal of an expanded region within the first intron of a mutated FXN gene, and would have thereby been able to substitute the sequences with predictable results.
Consequently, Cherqui as modified by Lundberg et al render obvious the treatment of Friedreich’s ataxia (claim 6) in a subject via the administration of a CRISPR/Cas system comprising crRNA sequences as set forth in SEQ ID NOs: 16242 and 16721 – which have 100% identity to instant SEQ ID NOs: 18 and 21, respectively – to HSPCs of the subject, wherein the HSPCs express a mutated human frataxin (hFXN) gene comprising a trinucleotide extension mutation that results in the expansion of GAA repeats in the first intron of the hFXN gene (claim 2), and wherein the administration of the CRISPR/Cas system increases the levels of hFXN protein, hFXN mRNA, and mitochondrial function in the HSPCs relative to the levels and function seen in non-edited HSPCs. As the CRISPR/Cas system is provided by a self-inactivating lentiviral vector having a gene correction efficacy of about 20% in HSPCs (claim 24), this therefore renders obvious the methods of instant claims 1, 11, and 19.
Regarding claims 7-8: Following the discussion of claim 1, Cherqui further discloses that the subject is human (Paragraphs [0031]-[0032], [0073]). This therefore reads on the method of the instant claims.
Regarding claims 9, 14, and 20: Following the discussion of claims 1, 11, and 19, Cherqui further discloses that the restored expression of the hFXN protein in the HSPCs corrects the neurologic, cardiac and muscular complications the subject was experiencing within about 6-12 months (Paragraphs [0013], [0072]). This therefore reads on the methods of the instant claims.
Regarding claims 10, 15, and 22: Following the discussion of claims 1, 11, and 19, Cherqui further discloses that the HSPCs are further contacted with a carrier DNA enhancer (Paragraphs [0055]-[0057], [0079]). This therefore reads on the methods of the instant claims.
Claims 1-2, 6-11, 14-15, 19-20, and 23-25 are rejected under 35 U.S.C. 103 as being obvious over Cherqui (WO 2017/165167 A1, of record on IDS filed 05 May 2025) in view of Lundberg et al (US 2019/0160186 A1, of record), and further in view of Rocca et al (2019 International Ataxia Research Conference, 2019).
The discussion of Cherqui in view of Lundberg et al regarding claims 11, 15, 19, and 22 can be observed above and is relied upon herein, the content of which is incorporated in its entirety. Cherqui in view of Lundberg et al render obvious claims 1-2, 6-11, 14-15, 19-20, and 24. Rocca et al is considered prior art under 35 USC 102(a)(1), having a publication date of 14 November 2019.
Regarding claims 23 and 25: As aforementioned in the discussion of claims 15 and 22 above, Cherqui discloses that the HSPCs are further contacted with a carrier DNA enhancer.
The combination of Cherqui and Lundberg et al fail to teach that the efficacy of gene editing ranges from about 40% to 62%, as required by instant claims 23 and 25.
Rocca et al, however, disclose a CRISPR/Cas9 method to remove the GAA expansion in the intron 1 of the frataxin gene in FRDA patient HSPCs (Page 112). As such, Rocca et al disclose the successful gene correction of up to 55% of CD34+ cells isolated from FRDA patients accompanied by an increase in frataxin expression (Page 112).
Therefore, it would have been prima facie obvious to have modified the method of Cherqui in view of Lundberg et al such that the gene editing efficacy within the FXN-mutated HSPCs is about 55%, as suggested in Rocca et al. One of ordinary skill in the art before the effective filing date of the invention would have been motivated to increase the gene editing efficacy of the CRISPR/Cas system, as it allows for a more efficient rescue of the FXN-mutated HSPCs, and would have recognized that it would have been a matter of routine optimization of the self-inactivating lentiviral vector construct to allow for such gene editing efficacy (Cherqui: Paragraphs [0078]-[0080]). See MPEP § 2144.05(II). Furthermore, the ordinary artisan would have had a reasonable expectation of success given that Cherqui provides the structure of the self-inactivating lentiviral vector and it would not have been outside the skillset of the ordinary artisan to tailor the construct. See MPEP § 2143(I)(G).
Consequently, Cherqui as modified by Lundberg et al render obvious the treatment of Friedreich’s ataxia, wherein the gene correction efficacy is about 55%. This therefore renders obvious the methods of instant claims 23 and 25.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded
in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-2, 6-11, 14-15, 19-20, and 23-25 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-12 of U.S. Patent No. 12,011,488 B2. The instant application is a CONTINUATION of US Patent No. 12,011,488 B2.
Although the claims at issue are not identical, they are not patentably distinct from each other because the patented claims render obvious the instant claims. More specifically, the patented claims are not identical because no single patented claim discloses all of the limitations of any of the instant claims; however, each of the limitations of the instant claims are disclosed by separate patented claims. The fact that each of the elements were claimed in the patent, just not in a single claim, still renders obvious the instant invention because each of the features, though separately claimed, can be physically combined into a single embodiment.
Patent claim 1 is directed to a method of treating a mitochondrial disease or disorder in a subject comprising contacting hematopoietic stem progenitor cells (HSPCs) expressing a dysfunctional human frataxin (hFXN) or reduced levels of hFXN mRNA with a CRISPR/Cas gene editing system creating gene edited HSPCs:
wherein the dysfunctional hFXN comprises a trinucleotide extension mutation;
wherein the step of contacting comprises expressing the gene editing system in a sample of HSPCs obtained from the subject to obtain the gene edited HSPCs, and thereafter, transplanting the gene edited HSPCs into the subject; and
wherein when expressed in the HSPCs, the gene editing system removes the trinucleotide extension mutation in the dysfunctional hFXN and restores levels of hFXN in the HSPCs to levels expressed in HSPCs not having a dysfunctional hFXN or increased relative to the levels of hFXN in the cell prior to gene editing, thereby treating the mitochondrial disease or disorder.
Patent claim 4 further limits the method of patent claim 1, wherein the CRISPR/Cas system comprises the crRNA sequences UP4 (SEQ ID NO: 18) and DN4 (SEQ ID NO: 21).
Patent claim 6 further limits the method of patent claim 1, wherein the mitochondrial disease or disorder is Friedreich’s ataxia.
It is of note that although the patent claims do not disclose that the mitochondrial function is enhanced in the gene edited HSPCs compared to HSPCs that have not been gene edited, nor that the efficacy of the gene editing ranges at least from about 17% to 30%, the mitochondrial function will inherently be enhanced and the gene editing efficacy will inherently be at least from about 17% to 30% since the patent claims and instant claims recite the same method steps. See MPEP § 2112.02.
Furthermore, since instant claim 1 utilized the “comprising” transitional phrase and is open to additional method steps, the method of patent claim 1 anticipates on the method of instant claims 1, 19, and 24. This open-language is also relevant for instant claim 11, wherein the claim language of patent claim 11 comprises an additional method step, but ultimately anticipates the method of instant claim 11.
With that, each of patent claims 2 and 6-10 are identical to each of instant claims 2, 6-10, 14-15, 20, and 22.
Furthermore, since patent claim 10 teaches the use of a carrier DNA enhancer, the gene editing efficacy will inherently be from about 40% to 62% since the patent claims and instant claims recite the same method steps. See MPEP § 2112.02. This therefore anticipates each of instant claims 23 and 25.
Claims 1-2, 6-11, 14-15, 19-20, and 23-25 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5 and 13-14 of U.S. Patent No. 12,012,437 B2 in view of Lundberg et al (US 2019/0160186 A1, of record), Cherqui (WO 2017/165167 A1, of record on IDS filed 05 May 2025), and Rocca et al (2019 International Ataxia Research Conference, 2019).
Although the claims at issue are not identical, they are not patentably distinct from each other because the patented claims render obvious the instant claims. More specifically, the patented claims are not identical because no single patented claim discloses all of the limitations of any of the instant claims; however, each of the limitations of the instant claims are disclosed by separate patented claims, or rendered obvious by the accompanying prior art. The fact that each of the elements were claimed in the patent application, just not in a single claim, still renders obvious the instant invention because each of the features, though separately claimed, can be physically combined into a single embodiment.
Patent claim 1 is directed to a method of treating a mitochondrial disease or disorder in a subject comprising:
(a) contacting a hematopoietic stem and progenitor cell (HSPC) from the subject expressing a dysfunctional endogenous human frataxin (hFXN) gene or reduced levels of hFXN mRNA with a gene editing system to produce a functional hFXN gene,
wherein the dysfunctional endogenous hFXN gene comprises a trinucleotide extension mutation, and
wherein following contacting the HSPC, the gene editing system removes the trinucleotide extension mutation in the dysfunctional endogenous hFXN gene, thereby producing HSPCs expressing a functional hFXN gene; and
(b) transplanting the HSPCs expressing the functional hFXN gene into the subject,
wherein upon transplantation into the subject, the HSPCs transfer a functional hFXN gene, a functional hFXN mRNA, a functional protein or a combination thereof from the HSPC or a cell differentiated therefrom to a cell in a tissue or to the central nervous system (CNS) correcting neurologic, cardiac and/or muscular complications within about 6-12 months post-transplantation, thereby treating the mitochondrial disease or disorder.
Patent claims 2 and 14 further limit patent claim 1, wherein the gene editing system is a CRISPR/Cas9 gene editing system.
The patent claims do not disclose that the CRISPR/Cas system comprises crRNA sequences having a sequence as set forth in instant SEQ ID NO: 18 and instant SEQ ID NO: 21, nor that the mitochondrial function is enhanced in the gene edited HSPCs compared to HSPCs that have not been gene edited, nor that the gene editing efficacy is at least from about 17% to 30%.
Lundberg et al, however, disclose ex vivo and in vivo methods for removing an abnormal repeat expansion within the FXN gene using a CRISPR/Cas genome engineering system (Paragraphs [0020], [0036], [0083]). Lundberg et al further disclose that the CRISPR/Cas9 RNA sequences include those as shown in SEQ ID NOs: 16242 and 16721, which have 100% identity to instant SEQ ID NOs: 18 and 21, respectively (Paragraphs [0387]-[0390]; Tables 5-6). See sequence alignment at the end of the Office action.
With that, Cherqui discloses the treatment of Friedreich’s ataxia in a subject via the administration of a CRISPR/Cas system to HSPCs of the subject, wherein the HSPCs express a mutated human frataxin (hFXN) gene comprising a trinucleotide extension mutation that results in the expansion of GAA repeats in the first intron of the hFXN gene, and wherein the administration of the CRISPR/Cas system removes the expanded GAA repeats and increases the levels of hFXN protein and hFXN mRNA in the HSPCs relative to the levels of hFXN protein and hFXN mRNA in the HSPCs prior to gene editing (Abstract; Paragraphs [0007]-[0008], [0014], [0031], [0039], [0041]-[0045], [0068]-[0071], [0074]-[0075], [0078]-[0079], [0081], [0102]; Figures 2-3). Cherqui further discloses that the mitochondrial function of the gene edited HSPCs is enhanced relative to the mitochondrial function of the HSPCs prior to gene editing (Paragraphs [0084], [0094]-[0096]).
Cherqui further discloses that the CRISPR/Cas system – including crRNAs – is comprised within a self-inactivating lentiviral vector, wherein administration of self-inactivating lentiviral vectors to HSPCs has been found to have a gene correction efficacy of about 20% (Paragraphs [0045], [0078]-[0080], [0102]).
Therefore, it would have been prima facie obvious to substitute the CRISPR/Cas9 RNA sequences within the patent claims with the CRISPR/Cas9 RNA sequences detailed in Lundberg et al, as doing so would have been a simple substitution of one CRISPR/Cas9 RNA sequence for another. See MPEP § 2143(I)(B). One of ordinary skill in the art before the effective filing date of the instant invention would have recognized that the CRISPR/Cas9 RNA sequences are functionally comparable, and would have thereby been able to substitute the sequences with predictable results.
Furthermore, it would have been prima facie obvious to have modified the method of the patent claims such that the mitochondrial function of the gene edited HSPCs is enhanced relative to the mitochondrial function of the HSPCs prior to gene editing, and the gene editing efficacy is about 20%, as detailed in Cherqui. One of ordinary skill in the art would have been motivated to improve the mitochondrial function within the HPSCs and associated gene editing efficacy to allow for the treatment of the mitochondrial disorder, and would have had a reasonable expectation of success given that the methods of the patent claims and Cherqui are essentially similar. See MPEP§ 2143(I)(G).
Consequently, since instant claim 1 utilized the “comprising” transitional phrase and is open to additional method steps, the combined method of patent claims 1-2 and 14 as modified by Lundberg et al render obvious the method of instant claims 1, 9, and 24.
With that, each of patent claims 3-5 are exactly or substantially identical to each of instant claims 6-8, respectively. Likewise, patent claim 13 reads on instant claim 2 alone and instant claims 11, 14, and 19-20 when combined with the method rendered obvious by patent claims 1-2 and 14 in view of Lundberg et al and Cherqui.
Furthermore, although the patent does not disclose the limitations from instant claims 10, 15, 22-23, and 25, the subject matter is known from the prior art and can be further incorporated into the method rendered obvious by patent claims 1-2 and 13-14 in view of Lundberg et al and Cherqui:
Cherqui teaches the limitations recited in instant claims 10, 15, and 22.
Rocca et al teach the limitations recited in instant claims 23 and 25.
Claims 1-2, 6-11, 14-15, 19-20, and 23-25 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-12 of copending Application No. 18/658138 in view of Lundberg et al (US 2019/0160186 A1, of record), Cherqui (WO 2017/165167 A1, of record on IDS filed 05 May 2025), and Rocca et al (2019 International Ataxia Research Conference, 2019).
Although the claims at issue are not identical, they are not patentably distinct from each other because the patented claims render obvious the instant claims. More specifically, the copending claims are not identical because no single copending claim discloses all of the limitations of any of the instant claims; however, each of the limitations of the instant claims are disclosed by separate copending claims, or rendered obvious by the accompanying prior art. The fact that each of the elements were claimed in the copending application, just not in a single claim, still renders obvious the instant invention because each of the features, though separately claimed, can be physically combined into a single embodiment.
Copending claim 1 is directed to a method of treating a mitochondrial disease or disorder in a subject comprising:
contacting a hematopoietic stem and progenitor cell (HSPC) of the subject expressing a dysfunctional endogenous human frataxin (hFXN) gene or reduced levels of hFXN mRNA with a gene editing system to produce a functional hFXN gene,
wherein the dysfunctional endogenous hFXN gene comprises a trinucleotide extension mutation, and
wherein following contacting the HSPC, the gene editing system removes the trinucleotide extension mutation in the dysfunctional endogenous hFXN gene, thereby producing HSPCs expressing a functional hFXN gene; and
and wherein the HSPCs transfer a functional hFXN gene, a functional hFXN mRNA, a functional protein or a combination thereof from the HSPC or a cell differentiated therefrom to a cell in a tissue or to the central nervous system (CNS) correcting neurologic, cardiac and/or muscular complications, thereby treating the mitochondrial disease or disorder.
Copending claims 2 and 14 further limit copending claim 1, wherein the gene editing system is a CRISPR/Cas9 gene editing system.
The copending claims do not disclose that the CRISPR/Cas system comprises crRNA sequences having a sequence as set forth in instant SEQ ID NO: 18 and instant SEQ ID NO: 21, nor that the mitochondrial function is enhanced in the gene edited HSPCs compared to HSPCs that have not been gene edited, nor that the gene editing efficacy is at least from about 17% to 30%.
Lundberg et al, however, disclose ex vivo and in vivo methods for removing an abnormal repeat expansion within the FXN gene using a CRISPR/Cas genome engineering system (Paragraphs [0020], [0036], [0083]). Lundberg et al further disclose that the CRISPR/Cas9 RNA sequences include those as shown in SEQ ID NOs: 16242 and 16721, which have 100% identity to instant SEQ ID NOs: 18 and 21, respectively (Paragraphs [0387]-[0390]; Tables 5-6). See sequence alignment at the end of the Office action.
With that, Cherqui discloses the treatment of Friedreich’s ataxia in a subject via the administration of a CRISPR/Cas system to HSPCs of the subject, wherein the HSPCs express a mutated human frataxin (hFXN) gene comprising a trinucleotide extension mutation that results in the expansion of GAA repeats in the first intron of the hFXN gene, and wherein the administration of the CRISPR/Cas system removes the expanded GAA repeats and increases the levels of hFXN protein and hFXN mRNA in the HSPCs relative to the levels of hFXN protein and hFXN mRNA in the HSPCs prior to gene editing (Abstract; Paragraphs [0007]-[0008], [0014], [0031], [0039], [0041]-[0045], [0068]-[0071], [0074]-[0075], [0078]-[0079], [0081], [0102]; Figures 2-3). Cherqui further discloses that the mitochondrial function of the gene edited HSPCs is enhanced relative to the mitochondrial function of the HSPCs prior to gene editing (Paragraphs [0084], [0094]-[0096]).
Cherqui further discloses that the CRISPR/Cas system – including crRNAs – is comprised within a self-inactivating lentiviral vector, wherein administration of self-inactivating lentiviral vectors to HSPCs has been found to have a gene correction efficacy of about 20% (Paragraphs [0045], [0078]-[0080], [0102]).
Therefore, it would have been prima facie obvious to have substituted the CRISPR/Cas9 RNA sequences within the copending claims with the CRISPR/Cas9 RNA sequences detailed in Lundberg et al, as doing so would have been a simple substitution of one CRISPR/Cas9 RNA sequence for another. See MPEP § 2143(I)(B). One of ordinary skill in the art before the effective filing date of the instant invention would have recognized that the CRISPR/Cas9 RNA sequences are functionally comparable, and would have thereby been able to substitute the sequences with predictable results.
Furthermore, it would have been prima facie obvious to have modified the method of the copending claims such that the mitochondrial function of the gene edited HSPCs is enhanced relative to the mitochondrial function of the HSPCs prior to gene editing, and the gene editing efficacy is about 20%, as detailed in Cherqui. One of ordinary skill in the art would have been motivated to improve the mitochondrial function within the HPSCs and associated gene editing efficacy to allow for the treatment of the mitochondrial disorder, and would have had a reasonable expectation of success given that the methods of the copending claims and Cherqui are essentially similar. See MPEP§ 2143(I)(G).
Consequently, since instant claim 1 utilized the “comprising” transitional phrase and is open to additional method steps, the combined method of copending claims 1-2 and 14 render obvious the method of instant claims 1 and 24.
With that, each of copending claims 3-5 are exactly or substantially identical to each of instant claims 6-8, respectively. Likewise, copending claim 12 reads on instant claim 2 alone and instant claims 11 and 19 when combined with the method rendered obvious by copending claims 1-2 and 14 in view of Lundberg et al and Cherqui.
Furthermore, although the copending application does not disclose the limitations from instant claims 9-10, 14-15, 20, 22-23, and 25, the subject matter is known from the prior art and can be further incorporated into the method rendered obvious by copending claims 1-2 and 14 in view of Lundberg et al and Cherqui:
Cherqui teaches the limitations recited in instant claims 9-10, 14-15, 20, and 22.
Rocca et al teach the limitations recited in instant claims 23 and 25.
This is a provisional nonstatutory double patenting rejection.
Conclusion
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALYSSA G WESTON whose telephone number is (571)272-0337. The examiner can normally be reached Monday-Thursday 8AM - 4PM (CT); Friday 8AM - 11AM (CT).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ALYSSA G WESTON/Examiner, Art Unit 1633
/CHRISTOPHER M BABIC/Supervisory Patent Examiner, Art Unit 1633
Sequence Alignment
Query Match 100.0%; Length 20; Matches 20; Mismatches 0; Gaps 0
Qy 1 TTACGCCACGGCTTGAAAGG 20 (INSTANT SEQ ID NO: 18)
||||||||||||||||||||
Db 1 TTACGCCACGGCTTGAAAGG 20 (LUNDBERG ET AL SEQ ID NO: 16242)
Query Match 100.0%; Length 20; Matches 20; Mismatches 0; Gaps 0
Qy 1 ACCGGGCGTCATATGGTAAG 20 (INSTANT SEQ ID NO: 21)
||||||||||||||||||||
Db 1 ACCGGGCGTCATATGGTAAG 20 (LUNDBERG ET AL SEQ ID NO: 16721)