DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Continued Examination Under 37 CFR 1.114
A request for continued examination under 37 CFR 1.114, including the fee set forth in 37 CFR 1.17(e), was filed in this application after final rejection. Since this application is eligible for continued examination under 37 CFR 1.114, and the fee set forth in 37 CFR 1.17(e) has been timely paid, the finality of the previous Office action has been withdrawn pursuant to 37 CFR 1.114. Applicant's submission filed on 04 February 2026 has been entered.
Status of the Claims
Applicant’s submission filed 04 February 2026 has been entered. Claims 1-2, 6-11, 14-15, and 19-23 are pending. Claims 1, 9-11, and 14-15 have been amended, while claims 12-13 and 16-18 have been cancelled without prejudice or disclaimer and claims 19-23 have been newly added. Therefore, prosecution on the merits continues for claims 1-2, 6-11, 14-15, and 19-23. All arguments have been fully considered with the status of each prior ground of rejection set forth below.
Priority
Applicant’s newly added independent claim 19 and dependents thereof require the nucleic acid sequences as set forth in SEQ ID NO: 18 and SEQ ID NO: 21. Therefore, instant claims 1-2, 6-11, 14-15, and 19-23 all have an effective filing date of 16 March 2020. See the Office action filed 26 August 2025 for more details.
Status of Prior Rejections/Response to Arguments
RE: Objection to claims 1 and 11-12
The cancellation of instant claim 12 renders the objections moot for that claim. For the remaining claims, Applicant’s amendments to each of instant claims 1 and 11 correct the minor informalities, thus obviating the objections of record.
Therefore, the objections are withdrawn.
RE: Rejection of claims 1-2 and 6-18 under 35 USC 112(b)
The cancellation of claims 12-13 and 16-18 renders the rejection moot for those claims. For the remaining claims, Applicant’s amendments to each of independent claims 1 and 11 corrects the antecedent basis, thus obviating the rejections of record.
Therefore, the rejections are withdrawn.
RE: Rejection of claims 1-2 and 6-18 under 35 USC 103 over Cherqui in view of Lundberg et al
The cancellation of claims 12-13 and 16-18 renders the rejection moot for those claims. For the remaining claims, Applicant’s arguments filed 04 February 2026 have been fully considered but they are not persuasive.
Applicant has traversed the rejection, asserting on Page 10 of the Remarks filed 04 February 2026 that the cited references fail to teach or suggest that: (1) the HSPCs are edited using a CRISPR/Cas9 gene editing system comprising crRNA sequences having nucleic acid sequence as set forth in instant SEQ ID NO: 18 and SEQ ID NO: 21; (2) said gene edited HSPCs have increased levels of functional hFXN protein and hFXN mRNA as compared to levels of hFXN protein and hFXN mRNA-in the non-edited HSPCs; and (3) that the gene edited HSPCs have increased mitochondrial function as compared to mitochondrial function in the non-edited HSPCs. In response, the Examiner respectfully submits that Cherqui discloses that the edited HSPCs have increased levels of functional hFXN protein, hFXN mRNA, and mitochondrial function when compared to non-edited HSPCs. See, for example, Paragraphs [0008], [0072], [0075], [0084], [0094] and Figures 2-3 of Cherqui. Furthermore, Cherqui as modified by Lundberg et al render obvious the editing of the HPSCs using a CRISPR/Cas9 gene editing system comprising crRNA sequences having nucleic acid sequence as set forth in instant SEQ ID NO: 18 and SEQ ID NO: 21. See Pages 12-13 of the Office action filed 26 August 2025.
Applicant has further traversed the rejection, asserting on Pages 10-12 of the Remarks filed 04 February 2026 that the ordinary artisan would not have been motivated to utilize two crRNA sequences as instantly claimed given the disclosure of Lundberg et al. In response, the Examiner respectfully submits that Lundberg et al disclose the deletion of an abnormal repeat expansion within the FXN gene, wherein two double-stranded DNA breaks are induced at either side of the expanded region. See, for example, Paragraph [0083] of Lundberg et al. As crRNAs guide the CRISPR/Cas9 system to the target nucleic acids for the double-stranded breaks (Lundberg et al: Paragraphs [0076], [0080]-[0081]), the ordinary artisan would have understood that two crRNAs are required to create the double-stranded breaks on either side of the abnormal repeat expansion within the FXN gene.
With that, Applicant has further traversed the rejection, asserting on Pages 11-12 of the Remarks filed 04 February 2026 that the ordinary artisan would not have been motivated to select SEQ ID NOs: 16242 and 16721 from the disclosure of Lundberg et al since SEQ ID NO: 16721 is not on the prioritized list of crRNAs. In response, the Examiner respectfully submits that a reference may be relied upon for all that it would have reasonably suggested to one having ordinary skill in the art, even nonpreferred embodiments. See MPEP § 2123: Merck & Co. v. Biocraft Labs., Inc. 874 F.2d 804, 10 USPQ2d 1843 (Fed. Cir. 1989), cert. denied, 493 U.S. 975 (1989); Upsher-Smith Labs. v. Pamlab, LLC, 412 F.3d 1319, 1323, 75 USPQ2d 1213, 1215 (Fed. Cir. 2005). In the instant case, not having SEQ ID NO: 16721 on the prioritized list does not constitute a teaching away from the use of it, and the ordinary artisan still would have been motivated to substitute the crRNA sequences of Cherqui with the crRNA sequence of Lundberg et al since they allow for the removal of GAA repeats within the first intron of a mutated human FXN gene (Cherqui: Paragraph [0102]; Lundberg et al: Paragraph [0214], [0223]).
Applicant has further traversed the rejection, asserting on Pages 13-14 of the Remarks filed 04 February 2026 that the ordinary artisan would not have expected that the combined used of SEQ ID NO: 16242 and SEQ ID NO: 16721 of Lundberg et al would lead to an increase in human frataxin protein, mRNA, and mitochondrial function within the gene edited HSPCs, as the claimed counterparts of instant SEQ ID NO: 18 and instant SEQ ID NO: 21 had an enhanced gene editing efficiency. In response, the Examiner respectfully submits that the ordinary artisan would have recognized that crRNAs that allow for the deletion of expanded GAA repeats within the first intron a mutated FXN gene in an HSPC would lead to an increase in human frataxin protein, mRNA, and mitochondrial function within the gene edited HSPCs given the disclosure of Cherqui. More specifically, Cherqui discloses that the edited HSPCs have increased levels of functional hFXN protein, hFXN mRNA, and mitochondrial function when compared to non-edited HSPCs, wherein the gene editing includes the deletion of expanded GAA repeats within the first intron a mutated FXN gene. See, for example, Paragraphs [0008], [0072], [0075], [0084], [0094], [0102] and Figures 2-3 of Cherqui. It is also of note that the gene editing efficiency is not required within each of independent claims 1, 11, and 19.
Applicant has lastly traversed the rejection, asserting in Page 15 of the Remarks filed 04 February 2026 that the removal of the GAA expansion in intron 1 of the FXN gene using a CRISPR/Cas9 gene editing system having crRNAs as set forth in instant SEQ ID NOs: 18 and 21 unexpectedly had a gene editing efficiency that can reach 60% with no off-target activity or cytotoxic effects. In response, the Examiner respectfully reminds Applicant that, in submitting evidence asserted to establish unobvious results, there is a burden on Applicant to indicate how the examples asserted to represent the claimed invention are considered to relate to the examples intended to represent the prior art and, particularly, to indicate how those latter examples do represent the closest prior art. The evidence relied upon should also be reasonably commensurate in scope with the subject matter claimed and illustrate the claimed subject matter relative to the prior art subject matter. See MPEP § 2145. It should also be established that the differences in the results are in fact unexpected and unobvious and of both statistical and practical significance. See MPEP § 716.02(b). In the instant case, Applicant has failed to indicate how the alleged unexpected results differ from the closest prior art.
Therefore, the rejection is maintained and amended to encompass the claims as currently written.
RE: Rejection of claims 1-2 and 6-18 over claims 1-12 of US Patent No. 12,011,488 B2
The cancellation of claims 12-13 and 16-18 renders the rejection moot for those claims. For the remaining claims, Applicant has requested that the rejection be held in abeyance on Pages 15-16 of the Remarks filed 04 February 2026. In response, the Examiner respectfully reminds Applicant that 37 CFR 1.111 requires that replies by Applicant or patent owner must reply to every ground of objection and rejection in the prior Office action. Only objections or requirements as to form not necessary to further consideration of the claims may be requested to be held in abeyance until allowable subject matter is indicated. Non-statutory double patenting rejections may not be held in abeyance. See MPEP §714.02. It is of note that Applicant did not traverse the NSDP rejection.
Therefore, the rejection is maintained and amended to encompass the claims as currently written.
RE: Rejection of claims 1-2 and 6-18 over claims 1-5 and 13-14 of US Patent No. 12,012,437 B2 in view of Lundberg et al and Cherqui
The cancellation of claims 12-13 and 16-18 renders the rejection moot for those claims. For the remaining claims, Applicant has requested that the rejection be held in abeyance on Page 16 of the Remarks filed 04 February 2026. In response, the Examiner respectfully reminds Applicant that 37 CFR 1.111 requires that replies by Applicant or patent owner must reply to every ground of objection and rejection in the prior Office action. Only objections or requirements as to form not necessary to further consideration of the claims may be requested to be held in abeyance until allowable subject matter is indicated. Non-statutory double patenting rejections may not be held in abeyance. See MPEP §714.02. It is of note that Applicant did not traverse the NSDP rejection.
Therefore, the rejection is maintained and amended to encompass the claims as currently written.
RE: Provisional rejection of claims 1-2 and 6-18 over claims 1-12 of copending Application No. 18/658138 in view of Lundberg et al and Cherqui
The cancellation of claims 12-13 and 16-18 renders the rejection moot for those claims. For the remaining claims, Applicant has requested that the rejection be held in abeyance on Page 16 of the Remarks filed 04 February 2026. In response, the Examiner respectfully reminds Applicant that 37 CFR 1.111 requires that replies by Applicant or patent owner must reply to every ground of objection and rejection in the prior Office action. Only objections or requirements as to form not necessary to further consideration of the claims may be requested to be held in abeyance until allowable subject matter is indicated. Non-statutory double patenting rejections may not be held in abeyance. See MPEP §714.02. It is of note that Applicant did not traverse the NSDP rejection.
Therefore, the rejection is maintained and amended to encompass the claims as currently written.
Maintained Grounds of Rejection
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 1-2, 6-11, 14-15, and 19-23 are rejected under 35 U.S.C. 103 as being obvious over Cherqui (WO 2017/165167 A1, of record on IDS filed 05 May 2025) in view of Lundberg et al (US 2019/0160186 A1, of record).
Cherqui is considered prior art under 35 USC 102(a)(1) when considering the priority date for instant claims 1-2 and 6-18 is 16 March 2020. Therefore, even though the inventor is the same for the reference application and the instant application, the publication date of the reference application is greater than one year before the effective filing date of the instant application and cannot be excepted under 35 USC 102(b)(1). See MPEP § 2153. Likewise, Lundberg et al is considered prior art under 35 USC 102(a)(1) and 35 USC 102(a)(2) when considering the priority date for instant claims 1-2 and 6-18 is 16 March 2020.
Regarding claims 1-2, 6, 11, and 19: Cherqui discloses methods for treating a disease or disorder associated with mitochondrial dysfunction through ex vivo introduction of a nucleic acid molecule into hematopoietic stem and progenitor cells (HSPCs) followed by transplantation of the HSPCs into a subject in need of treatment (Abstract).
As such, Cherqui discloses the treatment of Friedreich’s ataxia in a subject via the administration of a CRISPR/Cas system to HSPCs of the subject, wherein the HSPCs express a mutated human frataxin (hFXN) gene comprising a trinucleotide extension mutation that results in the expansion of GAA repeats in the first intron of the hFXN gene, and wherein the administration of the CRISPR/Cas system removes the expanded GAA repeats and increases the levels of hFXN protein and hFXN mRNA in the HSPCs relative to the levels of hFXN protein and hFXN mRNA in the HSPCs prior to gene editing (Abstract; Paragraphs [0007]-[0008], [0014], [0031], [0039], [0041]-[0045], [0068]-[0071], [0074]-[0075], [0078]-[0079], [0081], [0102]; Figures 2-3). Cherqui further discloses that the mitochondrial function of the gene edited HSPCs is enhanced relative to the mitochondrial function of the HSPCs prior to gene editing (Paragraphs [0084], [0094]-[0096]).
Cherqui does not disclose that the CRISPR/Cas system comprises crRNA sequences having a sequence as set forth in instant SEQ ID NO: 18 and instant SEQ ID NO: 21, as required by instant claims 1, 11, and 19.
Lundberg et al, however, disclose materials and methods for editing and/or modulating the expression of the FXN gene in a cell by genome editing, and methods of treatment therefrom (Abstract).
As such, Lundberg et al disclose ex vivo and in vivo methods for removing an abnormal repeat expansion within the first intron of a mutated FXN gene using a CRISPR/Cas genome engineering system, wherein two double-stranded DNA breaks are induced at either side of the expanded region (Paragraphs [0020], [0036], [0083], [0226]-[0227], [0230], [0273], [0275]). Lundberg et al further disclose that the CRISPR/Cas9 RNA sequences (crRNAs) include those as shown in SEQ ID NOs: 16242 and 16721, which have 100% identity to instant SEQ ID NOs: 18 and 21, respectively (Paragraphs [0387]-[0390]; Tables 5-6). See sequence alignment at the end of the Office action.
Therefore, it would have been prima facie obvious to substitute the crRNA sequences within the system of Cherqui with the crRNA sequences detailed in Lundberg et al, as doing so would have been a simple substitution of one crRNA sequence for another. See MPEP § 2143(I)(B). One of ordinary skill in the art before the effective filing date of the instant invention would have recognized that the CRISPR/Cas9 RNA sequences are functionally comparable, as both sets allow for the removal of an expanded region within the first intron of a mutated FXN gene, and would have thereby been able to substitute the sequences with predictable results.
Consequently, Cherqui as modified by Lundberg et al render obvious the treatment of Friedreich’s ataxia (claim 6) in a subject via the administration of a CRISPR/Cas system comprising crRNA sequences as set forth in SEQ ID NOs: 16242 and 16721 – which have 100% identity to instant SEQ ID NOs: 18 and 21, respectively – to HSPCs of the subject, wherein the HSPCs express a mutated human frataxin (hFXN) gene comprising a trinucleotide extension mutation that results in the expansion of GAA repeats in the first intron of the hFXN gene (claim 2), and wherein the administration of the CRISPR/Cas system increases the levels of hFXN protein, hFXN mRNA, and mitochondrial function in the HSPCs relative to the levels and function seen in non-edited HSPCs. This therefore renders obvious the methods of instant claims 1, 11, and 19.
Regarding claims 7-8: Following the discussion of claim 1, Cherqui further discloses that the subject is human (Paragraphs [0031]-[0032], [0073]). This therefore reads on the method of the instant claims.
Regarding claims 9, 14, and 20: Following the discussion of claims 1, 11, and 19, Cherqui further discloses that the restored expression of the hFXN protein in the HSPCs corrects the neurologic, cardiac and muscular complications the subject was experiencing within about 6-12 months (Paragraphs [0013], [0072]). This therefore reads on the methods of the instant claims.
Regarding claims 10, 15, and 22: Following the discussion of claims 1, 11, and 19, Cherqui further discloses that the HSPCs are further contacted with a carrier DNA enhancer (Paragraphs [0055]-[0057], [0079]). This therefore reads on the methods of the instant claims.
Regarding claims 21 and 23: Following the discussion of claims 19 and 22, Lundberg et al further disclose that the efficacy of the gene editing treatment is at least 10% (Paragraph [0376]). As 10% reads on “about 12%” as instantly claimed, this therefore renders obvious the methods of the instant claims for the same reasons as detailed in the rejection of claim 19. See MPEP § 2131.03.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1-2, 6-11, 14-15, and 19-23 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-12 of U.S. Patent No. 12,011,488 B2 in view of Lundberg et al (US 2019/0160186 A1, of record). The instant application is a CONTINUATION of US Patent No. 12,011,488 B2.
Although the claims at issue are not identical, they are not patentably distinct from each other because the patented claims render obvious the instant claims. More specifically, the patented claims are not identical because no single patented claim discloses all of the limitations of any of the instant claims; however, each of the limitations of the instant claims are disclosed by separate patented claims, or rendered obvious by the accompanying prior art. The fact that each of the elements were claimed in the patent application, just not in a single claim, still renders obvious the instant invention because each of the features, though separately claimed, can be physically combined into a single embodiment.
Patent claim 1 is directed to a method of treating a mitochondrial disease or disorder in a subject comprising contacting hematopoietic stem progenitor cells (HSPCs) expressing a dysfunctional human frataxin (hFXN) or reduced levels of hFXN mRNA with a CRISPR/Cas gene editing system creating gene edited HSPCs:
wherein the dysfunctional hFXN comprises a trinucleotide extension mutation;
wherein the step of contacting comprises expressing the gene editing system in a sample of HSPCs obtained from the subject to obtain the gene edited HSPCs, and thereafter, transplanting the gene edited HSPCs into the subject; and
wherein when expressed in the HSPCs, the gene editing system removes the trinucleotide extension mutation in the dysfunctional hFXN and restores levels of hFXN in the HSPCs to levels expressed in HSPCs not having a dysfunctional hFXN or increased relative to the levels of hFXN in the cell prior to gene editing, thereby treating the mitochondrial disease or disorder.
Patent claim 4 further limits the method of patent claim 1, wherein the CRISPR/Cas system comprises the crRNA sequences UP4 (SEQ ID NO: 18) and DN4 (SEQ ID NO: 21).
Patent claim 6 further limits the method of patent claim 1, wherein the mitochondrial disease or disorder is Friedreich’s ataxia.
It is of note that although the patent claims do not disclose that the mitochondrial function is enhanced in the gene edited HSPCs compared to HSPCs that have not been gene edited, the mitochondrial function will inherently be enhanced since the patent claims and instant claims recite the same method steps. See MPEP § 2112.02.
Furthermore, since instant claim 1 utilized the “comprising” transitional phrase and is open to additional method steps, the method of patent claim 1 anticipates on the method of instant claims 1 and 19. This open-language is also prevalent for instant claim 11, wherein the claim language of patent claim 11 comprises an additional method step, but ultimately anticipates the method of instant claim 11.
With that, each of patent claims 2 and 6-10 are identical to each of instant claims 2, 6-10, 14-15, 20, and 22.
Furthermore, although the patent does not disclose the limitations from instant claims 21 and 23, the subject matter is known from the prior art and can be further incorporated into the method anticipated by patent claims 1, 4, and 6:
Lundberg et al teach the limitations recited in instant claims 21 and 23.
Claims 1-2, 6-11, 14-15, and 19-23 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-5 and 13-14 of U.S. Patent No. 12,012,437 B2 in view of Lundberg et al (US 2019/0160186 A1, of record) and Cherqui (WO 2017/165167 A1, of record on IDS filed 05 May 2025).
Although the claims at issue are not identical, they are not patentably distinct from each other because the patented claims render obvious the instant claims. More specifically, the patented claims are not identical because no single patented claim discloses all of the limitations of any of the instant claims; however, each of the limitations of the instant claims are disclosed by separate patented claims, or rendered obvious by the accompanying prior art. The fact that each of the elements were claimed in the patent application, just not in a single claim, still renders obvious the instant invention because each of the features, though separately claimed, can be physically combined into a single embodiment.
Patent claim 1 is directed to a method of treating a mitochondrial disease or disorder in a subject comprising:
(a) contacting a hematopoietic stem and progenitor cell (HSPC) from the subject expressing a dysfunctional endogenous human frataxin (hFXN) gene or reduced levels of hFXN mRNA with a gene editing system to produce a functional hFXN gene,
wherein the dysfunctional endogenous hFXN gene comprises a trinucleotide extension mutation, and
wherein following contacting the HSPC, the gene editing system removes the trinucleotide extension mutation in the dysfunctional endogenous hFXN gene, thereby producing HSPCs expressing a functional hFXN gene; and
(b) transplanting the HSPCs expressing the functional hFXN gene into the subject,
wherein upon transplantation into the subject, the HSPCs transfer a functional hFXN gene, a functional hFXN mRNA, a functional protein or a combination thereof from the HSPC or a cell differentiated therefrom to a cell in a tissue or to the central nervous system (CNS) correcting neurologic, cardiac and/or muscular complications within about 6-12 months post-transplantation, thereby treating the mitochondrial disease or disorder.
Patent claims 2 and 14 further limit patent claim 1, wherein the gene editing system is a CRISPR/Cas9 gene editing system.
The patent claims do not disclose that the CRISPR/Cas system comprises crRNA sequences having a sequence as set forth in instant SEQ ID NO: 18 and instant SEQ ID NO: 21, nor that the mitochondrial function is enhanced in the gene edited HSPCs compared to HSPCs that have not been gene edited.
Lundberg et al, however, disclose ex vivo and in vivo methods for removing an abnormal repeat expansion within the FXN gene using a CRISPR/Cas genome engineering system (Paragraphs [0020], [0036], [0083]). Lundberg et al further disclose that the CRISPR/Cas9 RNA sequences include those as shown in SEQ ID NOs: 16242 and 16721, which have 100% identity to instant SEQ ID NOs: 18 and 21, respectively (Paragraphs [0387]-[0390]; Tables 5-6). See sequence alignment at the end of the Office action.
With that, Cherqui discloses the treatment of Friedreich’s ataxia in a subject via the administration of a CRISPR/Cas system to HSPCs of the subject, wherein the HSPCs express a mutated human frataxin (hFXN) gene comprising a trinucleotide extension mutation that results in the expansion of GAA repeats in the first intron of the hFXN gene, and wherein the administration of the CRISPR/Cas system removes the expanded GAA repeats and increases the levels of hFXN protein and hFXN mRNA in the HSPCs relative to the levels of hFXN protein and hFXN mRNA in the HSPCs prior to gene editing (Abstract; Paragraphs [0007]-[0008], [0014], [0031], [0039], [0041]-[0045], [0068]-[0071], [0074]-[0075], [0078]-[0079], [0081], [0102]; Figures 2-3). Cherqui further discloses that the mitochondrial function of the gene edited HSPCs is enhanced relative to the mitochondrial function of the HSPCs prior to gene editing (Paragraphs [0084], [0094]-[0096]).
Therefore, it would have been prima facie obvious to substitute the CRISPR/Cas9 RNA sequences within the patent claims with the CRISPR/Cas9 RNA sequences detailed in Lundberg et al, as doing so would have been a simple substitution of one CRISPR/Cas9 RNA sequence for another. See MPEP § 2143(I)(B). One of ordinary skill in the art before the effective filing date of the instant invention would have recognized that the CRISPR/Cas9 RNA sequences are functionally comparable, and would have thereby been able to substitute the sequences with predictable results.
Furthermore, it would have been prima facie obvious to modify the method of the patent claims such that the mitochondrial function of the gene edited HSPCs is enhanced relative to the mitochondrial function of the HSPCs prior to gene editing, as detailed in Cherqui. One of ordinary skill in the art would have been motivated to improve the mitochondrial function within the HPSCs to allow for the treatment of the mitochondrial disorder, and would have had a reasonable expectation of success given that the methods of the patent claims and Cherqui are essentially similar. See MPEP§ 2143(I)(G).
Consequently, since instant claim 1 utilized the “comprising” transitional phrase and is open to additional method steps, the combined method of patent claims 1-2 and 14 as modified by Lundberg et al render obvious the method of instant claims 1 and 9.
With that, each of patent claims 3-5 are exactly or substantially identical to each of instant claims 6-8, respectively. Likewise, patent claim 13 reads on instant claim 2 alone and instant claims 11, 14, and 19-20 when combined with the method rendered obvious by patent claims 1-2 and 14 in view of Lundberg et al and Cherqui.
Furthermore, although the patent does not disclose the limitations from instant claims 10, 15, and 21-23, the subject matter is known from the prior art and can be further incorporated into the method rendered obvious by patent claims 1-2 and 13-14 in view of Lundberg et al and Cherqui:
Cherqui teaches the limitations recited in instant claims 10, 15, and 22.
Lundberg et al teach the limitations recited in instant claims 21 and 23.
Claims 1-2, 6-11, 14-15, and 19-23 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-12 of copending Application No. 18/658138 in view of Lundberg et al (US 2019/0160186 A1, of record) and Cherqui (WO 2017/165167 A1, of record on IDS filed 05 May 2025).
Although the claims at issue are not identical, they are not patentably distinct from each other because the patented claims render obvious the instant claims. More specifically, the copending claims are not identical because no single copending claim discloses all of the limitations of any of the instant claims; however, each of the limitations of the instant claims are disclosed by separate copending claims, or rendered obvious by the accompanying prior art. The fact that each of the elements were claimed in the copending application, just not in a single claim, still renders obvious the instant invention because each of the features, though separately claimed, can be physically combined into a single embodiment.
Copending claim 1 is directed to a method of treating a mitochondrial disease or disorder in a subject comprising:
contacting a hematopoietic stem and progenitor cell (HSPC) of the subject expressing a dysfunctional endogenous human frataxin (hFXN) gene or reduced levels of hFXN mRNA with a gene editing system to produce a functional hFXN gene,
wherein the dysfunctional endogenous hFXN gene comprises a trinucleotide extension mutation, and
wherein following contacting the HSPC, the gene editing system removes the trinucleotide extension mutation in the dysfunctional endogenous hFXN gene, thereby producing HSPCs expressing a functional hFXN gene; and
and wherein the HSPCs transfer a functional hFXN gene, a functional hFXN mRNA, a functional protein or a combination thereof from the HSPC or a cell differentiated therefrom to a cell in a tissue or to the central nervous system (CNS) correcting neurologic, cardiac and/or muscular complications, thereby treating the mitochondrial disease or disorder.
Copending claims 2 and 14 further limit copending claim 1, wherein the gene editing system is a CRISPR/Cas9 gene editing system.
The copending claims do not disclose that the CRISPR/Cas system comprises crRNA sequences having a sequence as set forth in instant SEQ ID NO: 18 and instant SEQ ID NO: 21, nor that the mitochondrial function is enhanced in the gene edited HSPCs compared to HSPCs that have not been gene edited.
Lundberg et al, however, disclose ex vivo and in vivo methods for removing an abnormal repeat expansion within the FXN gene using a CRISPR/Cas genome engineering system (Paragraphs [0020], [0036], [0083]). Lundberg et al further disclose that the CRISPR/Cas9 RNA sequences include those as shown in SEQ ID NOs: 16242 and 16721, which have 100% identity to instant SEQ ID NOs: 18 and 21, respectively (Paragraphs [0387]-[0390]; Tables 5-6). See sequence alignment at the end of the Office action.
With that, Cherqui discloses the treatment of Friedreich’s ataxia in a subject via the administration of a CRISPR/Cas system to HSPCs of the subject, wherein the HSPCs express a mutated human frataxin (hFXN) gene comprising a trinucleotide extension mutation that results in the expansion of GAA repeats in the first intron of the hFXN gene, and wherein the administration of the CRISPR/Cas system removes the expanded GAA repeats and increases the levels of hFXN protein and hFXN mRNA in the HSPCs relative to the levels of hFXN protein and hFXN mRNA in the HSPCs prior to gene editing (Abstract; Paragraphs [0007]-[0008], [0014], [0031], [0039], [0041]-[0045], [0068]-[0071], [0074]-[0075], [0078]-[0079], [0081], [0102]; Figures 2-3). Cherqui further discloses that the mitochondrial function of the gene edited HSPCs is enhanced relative to the mitochondrial function of the HSPCs prior to gene editing (Paragraphs [0084], [0094]-[0096]).
Therefore, it would have been prima facie obvious to substitute the CRISPR/Cas9 RNA sequences within the copending claims with the CRISPR/Cas9 RNA sequences detailed in Lundberg et al, as doing so would have been a simple substitution of one CRISPR/Cas9 RNA sequence for another. See MPEP § 2143(I)(B). One of ordinary skill in the art before the effective filing date of the instant invention would have recognized that the CRISPR/Cas9 RNA sequences are functionally comparable, and would have thereby been able to substitute the sequences with predictable results.
Furthermore, it would have been prima facie obvious to modify the method of the patent claims such that the mitochondrial function of the gene edited HSPCs is enhanced relative to the mitochondrial function of the HSPCs prior to gene editing, as detailed in Cherqui. One of ordinary skill in the art would have been motivated to improve the mitochondrial function within the HPSCs to allow for the treatment of the mitochondrial disorder, and would have had a reasonable expectation of success given that the methods of the patent claims and Cherqui are essentially similar. See MPEP§ 2143(I)(G).
Consequently, since instant claim 1 utilized the “comprising” transitional phrase and is open to additional method steps, the combined method of copending claims 1-2 and 14 render obvious the method of instant claim 1.
With that, each of copending claims 3-5 are exactly or substantially identical to each of instant claims 6-8, respectively. Likewise, copending claim 12 reads on instant claim 2 alone and instant claims 11 and 19 when combined with the method rendered obvious by copending claims 1-2 and 14 in view of Lundberg et al and Cherqui.
Furthermore, although the copending application does not disclose the limitations from instant claims 9-10, 14-15, and 20-23, the subject matter is known from the prior art and can be further incorporated into the method rendered obvious by copending claims 1-2 and 14 in view of Lundberg et al and Cherqui:
Cherqui teaches the limitations recited in instant claims 9-10, 14-15, 20, and 22.
Lundberg et al teach the limitations recited in instant claims 21 and 23.
This is a provisional nonstatutory double patenting rejection.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALYSSA G WESTON whose telephone number is (571)272-0337. The examiner can normally be reached Monday-Thursday 8AM - 4PM (CT); Friday 8AM - 11AM (CT).
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ALYSSA G WESTON/Examiner, Art Unit 1633
/CHRISTOPHER M BABIC/Supervisory Patent Examiner, Art Unit 1633
Sequence Alignment
Query Match 100.0%; Length 20; Matches 20; Mismatches 0; Gaps 0
Qy 1 TTACGCCACGGCTTGAAAGG 20 (INSTANT SEQ ID NO: 18)
||||||||||||||||||||
Db 1 TTACGCCACGGCTTGAAAGG 20 (LUNDBERG ET AL SEQ ID NO: 16242)
Query Match 100.0%; Length 20; Matches 20; Mismatches 0; Gaps 0
Qy 1 ACCGGGCGTCATATGGTAAG 20 (INSTANT SEQ ID NO: 21)
||||||||||||||||||||
Db 1 ACCGGGCGTCATATGGTAAG 20 (LUNDBERG ET AL SEQ ID NO: 16721)