DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
SEQ ID NOs: 20-29 in claims 5, 6, and 14-17 are the elected species and are being searched and examined.
Claim 7 and SEQ ID NOs: 7-19 and 30-58 in claims 5-6 and 14-17 remain withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected species, there being no allowable generic or linking claim. Election was made without traverse in the reply filed on 10/9/24.
Priority
Certified English translations of the foreign priority documents filed on 1/14/25 are acknowledged.
Drawings
The drawings were received on 1/14/25. These drawings are acceptable.
Claim Objections
Claim 1 is objected to because of the following informalities: the new limitation ‘recorded from database’ should be -- recorded form a database --. In addition, what database? Appropriate correction is required.
Claims 8, 11 and 14-19 are objected to because of the following informalities: the limitation ‘wherein the RBD comprises amino acid sequence at sites 319 to 401 of the spike protein and conserved amino acid sequences at sites N439, V483, and Q493’ in the claims are ambiguous. The structure of the RBD is not apparent because how can it comprise amino acid sequences at sites 319 to 401 or conserved amino acid sequences at sites N439, V483 and Q493. The claims as of now reads on a spike protein having amino acids at these sites which is redundant since a protein comprises amino acids. It appears that applicant might be trying to claim an RBD sequence having a region of a spike protein comprising amino acids 319 to 401 of a spike protein and conserved amino acids N439, V483 and Q493 of the same spike protein, but the wording is confusing.
Claims 11 and 14-19 are objected to because of the following informalities: the method steps for making the nCOVshRNA-2RBD are incomplete or confusing. The Office is not sure how to suggest amending the claim to fix the issues. For example, how do you detect mRNA expression on the shRNA and RNA interference effect of the RNA interference vector over coronavirus and its variants. What mRNA is being detected? How do you synthesis RDB comprising synthesizing of amino acid sequences at positions 319-510 of the coronavirus spike protein, conserved amino acid sequences at sites N439, V483, and Q493? The limitation ‘the siRNA targets to the common targets’ should read – siRNA targets the common target – to grammatically make sense. There should be a space between Q493 on line 17 of claim 11.
There are additional issues with these claims and too many in number to suggest how to correct without interfering with possibly how the applicant would prefer/intended the claimed invention to embrace. The Examiner of record suggests that the applicant contact the Examiner after reviewing the instant office action to discuss these objections.
Appropriate correction is required.
Response to Arguments
Applicant’s arguments, see page 10, filed 1/14/25, with respect to improper markush rejection have been fully considered and are persuasive. The rejection of claims 5-7 and 14-17 has been withdrawn because the even though the sequences in the claims are directed to siRNA targeting different genes of species of Covid 19 having distinct nucleotide sequences, they are directed to targeting to Covid 19 nucleotide sequences and can be used to inhibit expression of Covid 19 sequences in a cell.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 3-4, 8-11 and 18-19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claimed invention is directed to a product comprising a siRNA drug for treating a coronavirus infection (Covid) comprising a shRNA that targets common regions of coronavirus and connecting the shRNA to receptor binding domains (RBD) of coronavirus to the ends of the shRNA and a method of making the RBD-shRNA-RDB compound.
With respect to the claims embracing a siRNA comprising an antisense and a sense RNA selected from common conserved genes of coronavirus and its variants recorded from a database. The coronavirus comprises 45 species distributed between four genera: alphacoronavirus, betacoronavirus, deltacoronavirus, and gammacoronavirus virus (page 14 of WO2023023597, of record). The limitation for the targets of the siRNA is very broad because the targeted region is conserved genes, but not limited to ultra-conserved genes, conserved genes, and/or genes spliced by conservative microsatellite genes. The specification obtained RNAi sequences from E, M, N, ORFlab, and S genes of the 18 Covid-19 strains (page 10). The common siRNA of each strain is shown in table 1 and its sequence is marked as SEQ ID NOs: 7-40. Tables 2 to 5 (SEQ ID NOs: 41-58) is the common target siRNA of NC-045512.2, Delta strain and Omicron strain. The specification asserts that these siRNA exists common conserved sequences remains unchanged and theoretically has targeted interference effect. The specification does not disclose any other genes of different types of coronavirus or make siRNA to genes from different types of coronavirus. Other than strains of Covid 19, a sequence search of publicly available database does not show that there are well-known common targets of coronavirus sequences (e.g., 229E, NL63, OC43, HKU1, MERs-CoV and SARS-CoV) with an interference effect. In other words, SEQ ID NOs:41-58 would not target other coronaviruses, including 229E, NL63, OC43, HKU1, MERs-CoV and SARS-CoV. Neither the prior art nor the instant disclosure provide a structure/function correlation between Covid-19 (SARS-CoV2 or 2019 nCoV) strains and genus of coronavirus, including other covid strains, including 229E, NL63, OC43, HKU1, MERs-CoV and SARS-CoV. Other than the specification showing common target sequences between Covid-19 strains, the skilled artisan would have to further experiment with each SEQ ID NOs or new siRNA and determine if they target all coronaviruses and have an interference effect.
The term ‘database’ in claim 1 is very broad and reads on any database, including public and non-public databases. The specification describes only whole genome (cDNA) sequences of beta coronavirus genus from the Genbank database. There is a variation amongst possible database embraces by this term. The specification provides written description for beta coronavirus genus from the Genbank database, but does not provide sufficient description for the genus of databases.
The claimed invention further embraces the RBD is the receptor binding domain of a spike protein from a coronavirus and is a ligand to a human angiotensin converting enzyme II (ACE2) from targets cells of coronavirus. Instant claims 8, 11, and 18 and claims dependent therefrom recite that the RBD polypeptide comprises amino acid sequence at sites 319 to 401 of the spike protein (amino acid sequences at positions 319-510 of the coronavirus spike protein) and conserved amino acid sequence at sites N439, V483, and Q493 that can bind to human ACE2 receptors and are not prone to variation. The claims do not define which coronavirus is the source of the RBD and embraces any RDB from any coronavirus. The coronavirus comprises 45 species distributed between four genera: alphacoronavirus, betacoronavirus, deltacoronavirus, and gammacoronavirus virus (page 14 of WO2023023597, of record). The RDB domains of coronavirus (SARS-CoV, 2019-nCoV and MERS-CoV) are known in the prior art. See Tai et al. (Cellular & Molecular Immunology 17: 613-620, 2020, of record). A RBD is a key part of a virus located in its ‘spike’ domain that allows it to dock to a body receptor (e.g., ACE-2 receptor in humans) and gain entry into cells to lead to infection (pages 2-4 of the as-filed specification. A skilled artisan would possess the knowledge that each S domain of a coronavirus varies considerably. See Mou et al. (Journal of Virology Vol. 87, pages 9779-9383, 2013). For example, the S domain of SARS-CoV is different than Middle East respiratory syndrome-related coronavirus (MERS-CoV) because the MERS-CoV assembles into trimers forming the “spikes’ which bind and fuse to the DPP4/CD26 receptor. Neither the prior art nor the instant disclosure provide written description for other coronaviruses (including MERS-CoV) spike protein at these sites (sites 319 to 401 or at sites N439, V483, and Q493) that can bind human ACE2 receptors and are not prone to variation. Other than S protein for COVID-19, the specification does not appear to provide written description for any other S protein from a coronavirus.
Furthermore, the limitation ‘conserved amino acid sequence at sites N439, V483, and Q493’ is a very broad limitation and is not limited to any specific protein (e.g., coronavirus protein). Coronavirus is a large family of respiratory viruses that include COVID-19, MERS and SARS. There are even sub-species of these three viruses. For example, COVID-19 has delta and omicron. The coronavirus has 45 species (WO 2023/023597, of record). The specification describes this amino acid sequence with respect to SARS CoV S protein (pages 23-26), but does not describe that these sites of the protein are conserved in any protein that has a function a RBD polypeptide of a coronavirus. The specification discloses collecting amino acid sequence for RBD of S protein gene sequence from SARS-CoV, MERS, and SARS-CoV 2 based on global influenza shared avian database and the GenBank database. The specification does not appear to define the results of the study and provide written support for a genus of S proteins that can bind to human ACE2 receptors and are not prone to variation. The specification does not provide written support of a structure-function correlation between S protein of SARS CoV S protein and other proteins, including S protein from MERS. The skilled artisan would have to further experiment with any protein to determine if they have a conserved amino acid sequence with the desired biological activity.
In view of the foregoing, it is clear that the instant disclosure fails to convey to the skilled artisan that the claims had written description for the claimed genus of RBD polypeptides of coronavirus and shRNA before the effective filing date.
Response to Arguments
Applicant's arguments filed 1/14/25 have been fully considered but they are not persuasive because applicant does not appear to address the merits of the written description rejection. See 37 CFR 1.111(b) which requires a response to a non-final Office action “be reduced to a writing which distinctly and specifically points out the supposed errors in the examiner’s action.” Other than explaining the amended claims and what each claim entails, the applicant does not appear to provide any argument(s) to point out the supposed errors in the written description for the Office to address.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 11 and 14-19 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 11 recites the limitation " the siRNA" in line 4. There is insufficient antecedent basis for this limitation in the claim. Claims 14-19 are also rejected because they depend on claim 11.
The following is a quotation of 35 U.S.C. 112(d):
(d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph:
Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers.
Claim 3 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. The limitation ‘wherein the common genes comprise but are not limited to ultra-conserved genes, conserved genes, and/or genes spliced by conserved ultraconservative microsatellite gene’ now does not further limit amended claim 1 because amended claim 1 is limited to common conserved genes of coronavirus and its variants from database. “comprise but not limited to…” in Claim 3 does not require that the common conserved genes are further limited from the database.
Claim 10 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. The limitation ‘form RBD-siRNA/Lip’ does not further limit claim 1 because claim 1 is limited to a shRNA.
Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements.
Claim Rejections - 35 USC § 103
The text of those sections of Title 35, U.S. Code not included in this action can be found in a prior Office action.
Claims 1, 3-6, 8, 10, 11, and 14-18 are rejected under 35 U.S.C. 103 as being unpatentable over Ebben et al. (WO 2023023597 (‘597), EFD 8/18/21) taken with Fu et al. (Journal of Controlled Release 335, 584-595, 2021, on-line 6/3/21), both of record.
‘597 discloses a virus like particle (VLP) comprising a viral spike protein configured to bind to an angiotensin-converting enzyme 2 (ACE2) receptor and at least one additional viral structural protein. The spike protein can be derived from SARS-CoV or SARS-CoV-2, Accession # QHD43416 (‘597, page 13). The at least one additional viral structural protein may be a nucleocapsid protein, an envelope protein, a membrane protein or a fragment or complex thereof (page 14). The VLP may further comprise an encapsulated cargo molecule including nucleic acid molecules (interfering RNA or mRNA), chemotherapeutic agents, imaging agents, and/or other agents (page 17). The interfering RNA can be a small hairpin RNA (shRNA). Interfering RNA can be used to treat a COVID infection (pages 16-18 and 39). The interfering RNA can be capable of hybridizing a target sequence comprising SEQ ID NOs: 3-17 in table 1. ‘597 teaches a siRNA that would read on the siRNA comprising SEQ ID NO: 21 (Qy) recited in the instant claims. See SEQ ID NO: 12 (Db).
Qy 1 GGTTGAAGCAGTTAATTAAAG 21
|||||||||||||||||||||
Db 1 GGTTGAAGCAGTTAATTAAAG 21
The RNAi can be a shRNA comprising a loop region that separates the region comprising the sequence which bind to the nucleic acid sequence (page 18). Each shRNA target sequences has homology with sequences within the RNA genome of multiple endemic betacoronavirus, including but not limited to HCoV-229E, HCoV-OC43, HCoV-NL63 and HCoV-HKU1 (pages 41-43). A transfection agent such as liposomes can be used to deliver the VLP (page 27). SARS-CoV 2 virus-like particles containing viral spike protein with tropism for lung epithelial ACE2 receptors and packaged with multiple shRNAs targeting the viral genome and/or viral replicase-encoding mRNA are delivered to the lungs of SARS-CoV-2 infected individuals (pages 39-40).
‘597 does not specifically teach a drug comprising RBD·shRNA·RBD with a liposome.
However, before the time of the effective filing date, Fu et al. teach extracellular vesicle (EVs) membranes with SARS-CoV-2 spike protein RBD through engineering the vesicular stomatitis virus (VSV)-G protein (page 585). RBD-tagged EVs required the ACE2 receptor for cellular uptake and were able to specifically trend to target cells or tissues that highly express ACE2. Fu et al. teach making S protein that bind to ACE2 receptor and the S protein. Since the S protein in the instant claims is not modified and reads on a S protein found in nature, the S protein taught by Fu et al. would inherently comprise an amino acid sequence comprising a region of the spike protein, wherein the region has amino acids at positions 319 to 401 and amino acids at sites N439, V483 and Q493 of the spike protein (pages 586-588). Fu et al. showed that siRNA encapsulated in the RBD-tagged EVs can effectively be delivered to lung tissue and inhibits SARS-CoV-2 infection. EVs are natural transport nano-vesicles and can be used to deliver nucleic acid to cells, release cargo and mediate physiological or pathological processes (page 584).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of ‘597 taken with Fu et al. to use a RBD polypeptide of the coronavirus as the sequence that binds to ACE2 and make RBD·shRNA·RBD with a liposome, namely to arrive at the claimed invention. A person of ordinary skill in the art would have been motivated to make a liposome comprising RBD-shRNA-RBD instead of making an EV comprising the shRNA and attaching RBD to the EV to reduce the time or any issues with attaching RBD to an EV comprising the siRNA. See MPEP 2143 I. Examples of Rationales (B) Simple substitution of one known element for another to obtain predictable results or (G) some motivation in the prior art that would have led one of ordinary skill in the art to modify the prior art reference to arrive at the claimed invention. It would have been obvious to a person of ordinary skill in the art to connect RBD polypeptide to the terminus of each strand of the shRNA to reduce exposing the shRNA to RNA-degrading enzymes in the cell. One of ordinary skill in the art would have been motivated to use SEQ ID NO: 12 taught by ‘597 as the siRNA in the shRNA since ‘597 teaches that SEQ ID NO: 12 can be used to treat a COVID infection in a cell. Since SEQ ID NO: 12 reads on a sequence in instant claims 5-6 and 14-17 and these claims are dependent on claim 1, 3 and 11-12, which are directed to siRNA targeting a common sequence from a coronavirus, SEQ ID NO: 12 would read on the limitation ‘the antisense and sense siRNA strand are selected from common conserved genes of coronavirus and its variants from database’. One of ordinary skill in the art would have been motivated to study the function of these compositions to inhibit COVID-19 in a cell line or an animal model infected with COVID-19. Making shRNAs would require making a first oligonucleotide strand and a second oligonucleotide strand, wherein the second oligonucleotide strand is complementary to the first oligonucleotide strand and either linking the stands using a loop or non-complementary oligonucleotides.
With respect to the new steps in amended claim 11 and claims dependent therefrom, several of the method steps are routinely used in the prior art to make siRNA and verify the siRNA can reduce expression of a target sequence. The method steps of making the nCOV shRNA·2RBD drug would be made obvious when making the shRNA from the designated siRNA and attaching the RBD to the ends of the shRNA. The specification does not teach that method steps possess an unexpected result or additional method steps and/or materials that were not routinely used in the prior art to make siRNA or a composition comprising shRNA·RBD. See MPEP 2141 II.C. Rationales to support rejections under 35 U.S.C. 103 recites, “Prior art is not limited to the references being applied, but includes the understanding of one of ordinary skill in the art.”
MPEP 2141. FACTORS TO CONSIDER IN DETERMINING LEVEL OF ORDINARY SKILL
The person of ordinary skill in the art is a hypothetical person who is presumed to have known the relevant art at the relevant time. Factors that may be considered in determining the level of ordinary skill in the art may include: (1) "type of problems encountered in the art;" (2) "prior art solutions to those problems;" (3) "rapidity with which innovations are made;" (4) "sophistication of the technology; and" (5) "educational level of active workers in the field." In re GPAC, 57 F.3d 1573, 1579, 35 USPQ2d 1116, 1121 (Fed. Cir. 1995). "In a given case, every factor may not be present, and one or more factors may predominate." Id. See also Custom Accessories, Inc. v. Jeffrey-Allan Indust., Inc., 807 F.2d 955, 962, 1 USPQ2d 1196, 1201 (Fed. Cir. 1986); Environmental Designs, Ltd. v. Union Oil Co., 713 F.2d 693, 696, 218 USPQ 865, 868 (Fed. Cir. 1983).
Since COVID-19 has several different variants (alpha, gamma, beta, delta, omicron), it would have been obvious for a person of ordinary skill in the art to design and screen common gene sequences from COVID-19 and design siRNA that target a common region of the different variants COVID-19 to assist in targeting multiple strains at one time (pages 41-43 of ‘597). As taught by ‘597, one of ordinary skill in the art can make siRNA targeting a sequence of COVID-19, wherein the siRNA has a sense and an antisense strand with a length of 21nt (pages 16-19 and 41 of ‘597). ‘597 teaches making the siRNA into a shRNA with a loop region connected the two strands. A person of ordinary skill in the art would have been motivated to screen the siRNA as taught by ‘597 to verify that the siRNA silence COVID-19 mRNA in a cell using a vector encoding the shRNA (pages 16-19 of ‘597). As discussed above, one of ordinary skill in the art would have been motivated to make RBD from a coronavirus spike protein (COVID-19) so the composition can bind to human ACE2 receptors. As mentioned above, since the S protein in the instant claims is not modified from the S protein known in the prior art and reads on a S protein found in nature, the S protein taught by Fu et al. would inherently comprise an amino acid sequence comprising a region of the spike protein (pages 586-588). One of ordinary skill in the art would have been motivated to make nCOVshRNA·2RBD drug comprising linking the shRNA taught by ‘597 with the RBD taught by Fu et al. to deliver reduce expression in cells infected with COVID-19. The specification does not define ‘gene synthesis method’ and doesn’t provide any additional method steps. Thus, the method steps to make the drug would read on this method. ‘597 and Fu et al. do not teach high performance liquid chromatography (HPLC) to purify the shRNA·2RBD, however, HPLC is routinely used in the art to successfully purify nucleic acids and/or proteins and can be used to purify the structure RBD-shRNA-RBD. “Prior art is not limited to just the references being applied, but includes understanding of one of ordinary skill in the art.” See MPEP 2141(III).
With respect to the limitation directed to the amino acid sequence of the spike protein recited in instant claims 8, 11, and 19, the limitation is confusing and appears to read on the RBD polypeptide having an amino acid sequence at sites 319 to 401 of the spike protein and amino acids at sites N439, V483 and Q493 that can bind to ACE2 and are not prone to variation. The spike protein would have an amino acid at those sequences since a protein comprises an amino acid sequence. ‘597 teaches that the spike protein can be derived from SARS-CoV or SARS-CoV-2, Accession # QHD43416 (page 13). Fu et al. or ‘597 teach making a S protein comprising an amino acid sequence that would read on the regions having amino acid sequences at positions 319 to 401 and at N493, V483, and Q493 of the spike protein, wherein the spike protein binds to human ACE2 receptors. The Spike protein taught by either ‘597 or Fu et al. is not mutated, thus it is not prone to variation.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Response to Arguments
Applicant's arguments filed 1/14/25 have been fully considered but they are not persuasive.
In response to applicant’s argument that the present application distinguishes from Ebben and Fu et al. and the combination of the two aspects of the introduction of antisense and sense siRNA with nucleotide sequences screened from the common conserved genes of coronavirus and the connection of the RBD being a ligand to a ACE2 receptor from target cells susceptible of infection by coronavirus with the shRNA having a target RNA interference function, the argument is not found persuasive because Ebben teaches a siRNA (SEQ ID NO: 12) that would read on the siRNA (SEQ ID NO: 21) recited in the instant claims and Ebben taken with Fu et al. make obvious using RBD to delivery shRNA to a cell infected with SARS-CoV-2.
The second paragraph under the 103 argument section in the response filed on 1/14/25 is applicant stating the claimed invention and how targeting common genes in a coronavirus using siRNA would function. There does not appear to be any arguments in this paragraph that need to be addressed by the Office.
Claims 9 and 19 are rejected under 35 U.S.C. 103 as being unpatentable over Ebben (‘597) and Fu et al. (supra) as applied to claims 1, 3-6, 8, 10-11, and 14-18 above, and further in view of Zhao et al. (Topics in Chemistry 2020, 378:41, pages 1-42, of record).
Ebben taken with Fu et al. do not specifically teach wherein the RBD is connected to the shRNA by chemical coupling or covalent coupling via a disulfide bond, a phosphodiester bond, a dithiophosphate bond, a thioether bond, an oxime bond, an amido bond or a Maleimide-sulfhydryl bond.
However, before the time of the effective filing date, successfully connecting a protein sequence to a terminus of a nucleic acid molecule using the method steps in instant claims 9 and 19 were known in the prior art as taught by Zhao et al. (pages 7-9 and Figure 4). One of the common strategies to conjugate a nucleic acid to protein is amine thiol cross-linking or disulfide coupling (page 11, table 1 and Figure 4).
It would have been prima facie obvious to a person of ordinary skill in the art before the time of the effective filing date to combine the teaching of Ebben and Fu et al. taken with Zhao et al. to use known chemical steps to connect the RBD polypeptide to the terminal ends of the shRNA, namely to arrive at the claimed invention. One of ordinary skill in the art would have been motivated to combine the teaching to connect the RBD polypeptide with the terminal of the 3’ antisense and the terminal of the 5’ sense strand using chemical coupling or covalent coupling. These methods are routinely used in the prior art to successfully attach a polypeptide to a terminus of a siRNA. One of ordinary skill in the art would have been motivated to combine the teaching to use any method known to one of ordinary skill in the art to successfully couple the RBD polypeptide to the terminal ends of the shRNA.
Therefore the invention as a whole would have been prima facie obvious to one ordinary skill in the art before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains.
Response to Arguments
Applicant's arguments filed 1/14/25 have been fully considered but they are not persuasive because applicant does not appear to provide argument(s) against this rejection.
Conclusion
See attached PTO-326 for disposition of claims.
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. US 20040248299 teaches that HPLC is successfully used in the prior art to isolate siRNA (paragraphs 101 and 253). US 20210299244 teach that COVID-19 spike proteins can be isolated using HPLC (paragraph 28).
Applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a).
A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Brian Whiteman whose telephone number is (571)272-0764. The examiner can normally be reached on Monday thru Friday; 6:00 AM to 3:00PM.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at (571)-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of an application may be obtained from the Patent Application Information Retrieval (PAIR) system. Status information for published applications may be obtained from either Private PAIR or Public PAIR. Status information for unpublished applications is available through Private PAIR only. For more information about the PAIR system, see http://pair-direct.uspto.gov. Should you have questions on access to the Private PAIR system, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative or access to the automated information system, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/BRIAN WHITEMAN/ Primary Examiner, Art Unit 1636