DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Application Status
This action is written in response to applicant’s correspondence received 05/25/2024. Claims 1-20 are currently pending and are examined herein.
Information Disclosure Statement
The listing of references in the specification (please see at least ¶ [0007], [00127], [0090], [0092]) is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Claim Objections
Claims 1, 2, 8 and 15 are objected to because of the following informalities:
Claims 1, 8 and 15 recite, “the outlet of the liquid holder further comprises tip”. This is grammatically incorrect and should include an article, such as, “a tip”.
Claim 2 recites “and genetic target”, which likewise lacks an article.
Appropriate correction is required.
Objections to the Specification
The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code. Please see paragraph [00224]. Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01.
Priority
Applicant’s claim for the benefit of a prior-filed application under 35 U.S.C. 119(e) or under 35 U.S.C. 120, 121, 365(c), or 386(c) is acknowledged. Applicant has not complied with one or more conditions for receiving the benefit of an earlier filing date under 35 U.S.C. 119(e) as follows:
The later-filed application must be an application for a patent for an invention which is also disclosed in the prior application (the parent or original nonprovisional application or provisional application). The disclosure of the invention in the parent application and in the later-filed application must be sufficient to comply with the requirements of 35 U.S.C. 112(a) or the first paragraph of pre-AIA 35 U.S.C. 112, except for the best mode requirement. See Transco Products, Inc. v. Performance Contracting, Inc., 38 F.3d 551, 32 USPQ2d 1077 (Fed. Cir. 1994).
The disclosures of the prior-filed applications, Application No. 63/469,101, 63/469,078 and 63/542,271, fail to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) or pre-AIA 35 U.S.C. 112, first paragraph for one or more claims of this application.
Application No. 63/469,101:
Application No. 63/469,101 describes “a molecular method to detect fecal contamination around animal operations using Bacteroidales DNA as a biomarker” using “microfluidic paper-based analytical devices” (specification, page 1). The application does not describe a structure meeting the limitations of claim 1, a kit comprising such a structure as recited in claim 15, or a method of using a similar structure as recited in claim 8. It only describes a “microfluidic paper-based analytical device” in generic terms. Because the full limitations of the independent claims are not supported by the disclosure of the provisional application, their dependent claims are likewise unsupported.
Application No. 63/469,078:
Applicant also claims the benefit of prior-filed provisional Application No. 63/469,078. Application No. 63/469,078 has the same filing date as provisional Application No. 63/469,101 (05/26/2023). Application No. 63/469,078 discloses a drop dispensing device as part of a portable system for detecting the presence or absence of a microbial contaminant in fresh produce, on-farm (see pp. 1 of the specification). The device is a liquid holding that defines an interior in fluid communication with an inlet and outlet, a plunger configured to be movable up and down within at least a portion of the interior such that downward movement of the plunger causes any fluid contained therein to be displaced through the outlet, wherein the outlet of the liquid holder further comprises a tip comprising a capillary tube (Figure 1, p. 5). However, while the device is described as using paper-based isothermal amplification, it is not described as comprising two or more paper-based pads positioned in a stacked configuration relative to each other, one of which is loaded with reagents and one which is not, as required by independent claims 1, 8 and 15. The specification only discloses that the device is paper-based, combining DNA extraction and DNA amplification (using LAMP) (p. 1), and that papers will be placed inside a cartridge coupled with the drop dispenser (p. 5). The specification does not disclose the papers configured in the manner described in the instant claims, i.e., in a stacked configuration, wherein one paper comprises reagents and the other does not. Because the full limitations of the independent claims are not supported by the disclosure of the provisional application, their dependent claims are likewise unsupported.
Application No. 63/542,271:
Applicant also claims benefit of priority to provisional Application No. 63/542,271. Application No. 63/542,271 provides support for the structure as recited in instant claims 1, 8 and 15 at pages 31. The provisional application also provides support for the limitations of claims 3-5 (see e.g., p. 6); the method steps and components of claims 8-14 (pp. 9-11), and the kit components of claims 16-19 (Id.).
This provisional application provides support for the limitations of claims 1, 3-5, and 8-19. The effective filing date of claims 1, 3-5, and 8-19 is 10/03/2023.
However, the provisional application does not provide adequate support for claims 2, 6-7, or 20.
Regarding claims 2 and 20, the provisional application discloses only some of the recited SEQ ID NOs. SEQ ID NOs: 7-14 are disclosed in Table 1 on page 30 of the provisional specification. SEQ ID NOs: 1-6 and SEQ ID NOs: 15-27 are not disclosed in the provisional application. Thus, while effective filing date of claims 2 and 20 is 10/03/2023 insofar as it concerns the limitations of primers encoded by SEQ ID NOs: 7-14, the effective filing date of the claims insofar as it concerns primers encoding SEQ ID NOs: 1-6 and 15-27 is 05/25/2024, the filing date of the instant application.
Regarding claims 6-7, the provisional application does not disclose the tip of the drop dispensing device defining either of the recited angles. While the provisional specification does describe coating the outer surface of the liquid holder (i.e., a surface treatment of the holders) and tip with PEG (p. 6) (i.e., the outer surface of the holder is hydrophobic), and shows that the liquid holder and tip are part of a single unit, such that the coating would have been applied to both the outer surface of the holder and the tip (Figure 1), it does not describe the inner surface of the capillary tube as hydrophilic, nor the outer surface of the plunger as hydrophobic.
Based on the above, the effective filing date of claims 6 and 7 is 05/25/2024.
Summary
The effective filing date of claims 1, 3-5 and 8-19 is 10/03/2023. The effective filing date of claims 2, 6-7 and 20 is 05/25/2024.
Claim Rejections - 35 USC § 112(b)
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 4 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 4 recites the limitation "the imaging unit”. There is insufficient antecedent basis for this limitation in the claim. Claim 1, from which claim 4 depends, does not recite an imaging unit.
Amending the claim to either depend upon claim 3, which recites an imaging unit, or alternative to recite “an imaging unit”, would obviate this rejection.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
Determining the scope and contents of the prior art.
Ascertaining the differences between the prior art and the claims at issue.
Resolving the level of ordinary skill in the pertinent art.
Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1, 3-10, and 13-19 are rejected under 35 U.S.C. 103 as being unpatentable over Ranjbaran (Ranjbaran et al. A drop dispenser for simplify on-farm detection of foodborne pathogens. bioRxiv 2023.06.28.546938.) in view of Seok (Seok et al. A Paper-Based Device for Performing Loop-Mediated Isothermal Amplification with Real-Time Simultaneous Detection of Multiple DNA Targets. Theranostics. 2017 Jun 1;7(8):2220–2230.).
NOTE: The cited reference shares four out of five inventors named in this application. The reference was publicly available as of June 28, 2023, which is prior to the effective filing date of claims 1, 3-5 and 8-19 (10/03/2023) and the effective filing date of claims 2, 6-7 and 20 (05/25/2024). The reference’s publication date falls within one year of the effective filing date of the instant claims. However, the reference names an additional author not named in the present application (Raut). Per MPEP 2153.01(a), if, “ the application names fewer joint inventors than a publication (e.g., the application names as joint inventors A and B, and the publication names as authors A, B and C), it would not be readily apparent from the publication that it is an inventor-originated disclosure and the publication would be treated as prior art under AIA 35 U.S.C. 102(a)(1) unless there is evidence of record that an exception under AIA 35 U.S.C. 102(b)(1) applies.”. In the instant case, the contribution of the additional author is not readily apparent from the publication, and there is no evidence of record that an exception under 102(b)(1) applies.
NOTE: During examination, statements in the preamble reciting the purpose or intended use of the claimed invention must be evaluated to determine whether or not the recited purpose or intended use results in a structural difference (or, in the case of process claims, manipulative difference) between the claimed invention and the prior art (MPEP 211.02). If the body of a claim fully and intrinsically sets forth all of the limitations of the claimed invention, and the preamble merely states, for example, the purpose or intended use of the invention, rather than any distinct definition of any of the claimed invention’s limitations, then the preamble is not considered a limitation and is of no significance to claim construction (Id.). Further, “a preamble generally is not limiting when the claim body describes a structurally complete invention such that deletion of the preamble phrase does not affect the structure or steps of the claimed invention” (Id.). In the instant case, the body of the claim fully sets forth a structurally complete system able to detect contaminants, with structural components of a drop dispensing device, assay device, and a heating unit, and the preamble merely states the intended use of the invention. Therefore, for the purposes of comparison to the prior art, the intended use of the system is not considered a limitation.
Regarding claim 1, Ranjbaran teaches a portable testing system comprising: at least one drop dispensing device comprising:a liquid holder that defines an interior, the interior in fluid communication with an inlet of the liquid holder and an outlet of the liquid holder, and a plunger configured to be movable up and down within at least a portion of the interior of the liquid holder such that downward movement of the plunger within the interior causes any fluid contained in the interior to be displaced through the outlet of the liquid holder, wherein the outlet of the liquid holder further comprises tip comprising a capillary tube that defines an inner surface in fluid communication with the interior (Fig. 1A, reproduced below):
PNG
media_image1.png
214
300
media_image1.png
Greyscale
Ranjbaran further teaches use of the same drop dispenser in running LAMP assays (i.e., the system comprises at least one is isothermal amplification assay device) to detect E. coli contamination, in which the assay was incubated in a water bath (i.e., the system comprises a heating unit) (§ 2.7).
Ranjbaran does not explicitly teach that the LAMP assay device comprises two or more paper-based pads positioned in a stacked configuration relative to each other, at least one of the paper-based pads loaded with one or more reagents comprising primer sets for the amplification of a genetic target associated with contamination, and at least one of the paper-based pads that does not have the reagents thereon.
However, Rajbaran does teach that the drop dispenser is used to dispense a sample for performing LAMP assays, and suggests that the dispenser be part of a consumable kit for a paper-based LAMP biosensor for on-farm (i.e., in field) risk assessment of fresh produce.
Seok teaches a paper-based portable testing system for detecting the presence or absence of contamination (pathogens), the system comprising at least one isothermal amplification (LAMP) assay device comprising two or more paper-based pads positioned in a stacked configuration relative to each other, at least one of the paper-based pads loaded with one or more reagents comprising primer sets for the amplification of a genetic target associated with contamination, and at least one of the paper-based pads that does not have the reagents thereon:
PNG
media_image2.png
628
663
media_image2.png
Greyscale
Please note Figure 1(a) above, which shows, “a paper-based device for performing…LAMP” in which, “The structure of the paper device is fabricated by stacking of three functional layers including the transfer pad, fluidic channel pad, and reaction pad”.
Seok further teaches that the system is meant for, “point-of-care (POC) testing. It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the portable system comprising the drop dispenser device and heating unit for LAMP-mediated detection of contaminants, as taught by Ranjbaran, in the ways suggested by Ranjbaran, i.e., using a paper-based LAMP assay and using the system for on-farm (in field) detection of contaminants. It further would have been obvious to modify the system by using the paper-based portable system as taught by Seok. The ordinary artisan would have been motivated, with a reasonable expectation of success, to combine the teachings of Ranjbaran and Seok based on the fact that Ranjbaran both provides a portable device for on-farm (POC) LAMP assays and a suggestion to use paper-based assays, and on the fact that Seok’s paper-based assay was effective and suitable for POC systems.
Regarding claim 3, Seok teaches the system comprising a temperature control and imaging unit (p. 222, § LAMP assay in solution).
Regarding claim 4, Seok teaches that the imaging was performed with a high resolution, autofocus camera (i.e., a digital camera, Id.).
Regarding claim 5, Ranjbaran teaches wherein the heating unit comprises a water bath (§ 2.7), and Seok teaches wherein it is an incubator (§ LAMP analysis on the paper device, p. 2223).
Regarding claim 6, Ranjbaran teaches wherein the tip of the drop dispensing device defines an angle α between 0-20 degrees (15) (p. 13 § 3.1) and the outer surface of the tip is hydrophobic (p. 6 § 2.2).
Regarding claim 7, while Ranjbaran does not explicitly teach that the outer surface of the plunger is hydrophobic, Ranjbaran does teach that accuracy is important for such devices (p. 4). It would therefore have been obvious, based on sound scientific reasoning and common sense, to have modified said surface to be hydrophobic to increase the accuracy of the dispenser by ensuring that the plunger would retain as little liquid as possible on its surface.
Regarding claim 8, Ranjbaran and Seok both teach a method for identifying a genetic target associated with contamination in fresh produce, as described above. The combination of references further teaches the recited structure, as described above, including that the reagents pad comprises primer sets (see the Figure 1 caption of Seok). Seok shows loading the paper pads with a drop of the sample and solvent mixture (see Figure 1a), heating the reaction pad to initiate amplification as already described, and detecting a visual result (colorimetric) indicative of the presence or absence of the contaminant, also as described above.
Regarding claim 9, Ranjbaran teaches wherein the drop comprises a volume of 27 uL, specifically that the dispenser generated a range of drop volumes from 20 to 33 uL (p. 17). It would have been obvious to adjust the volume of the drop according to the required volume for a given reaction during routine optimization of the assay procedure.
Regarding claim 10, Seok and Ranjbaran both teach that the heating step is performed for between 45-120 minutes (60 min at 65°C at § 2.7 of Ranjbaran; 60 minutes at 63°C at p. 2223 of Seok, § LAMP analysis on the paper device).
Regarding claim 13, Ranjbaran teaches quantifying a concentration of the contaminant (see e.g., Table 4).
Regarding claim 14, it would have been obvious, based on sound scientific reasoning and common sense, to integrate (i.e., include) a heating and imaging unit in the portable POC system to enable POC analysis, rather than return the drop dispenser and assay device to an off-site laboratory.
Regarding claim 15, Ranjbaran and Seok teach the structural components of the recited system, and Ranjbaran further teaches that the drop dispenser system, “will be part of a larger kit that is intended to be used for running on-farm LAMP assays using crude samples” (§ 2.8).
Regarding claim 16, Ranjbaran teaches a plurality of collection flags, each flag comprising a film affixed to a support at a distance away from an end of the support such that the support can anchor the film a distance above a surface of an area where the support is positioned(“we fabricated and used collection flags for the LAMP assays. Each collection flag consists of one piece (5 cm × 30 cm) of a transparency film (Apollo Plain Paper Copier Transparency Film, 617993) attached to a wooden stick”; p. 11).
Regarding claims 17 and 18, Seok teaches that the paper device includes reaction and control pads as well as a heating unit, as already described.
Regarding claim 19, it would have been obvious to include sealing sampling containers comprising suitable media in the kit to enable sample collection without exposing the sample to contamination during collection, assay and/or transport.
Claims 2, 11-12 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Ranjbaran and Seok as applied to claims 1, 3-10, and 13-19, further in view of Wang (Wang et al. Loop-Mediated Isothermal Amplification Assays for Detecting Shiga Toxin-Producing Escherichia coli in Ground Beef and Human Stools. J Clin Microbiol. 2012 Jan;50(1):91-7.)
Ranjbaran and Seok render obvious the system of claim 1, method of claim 8, and kit of claim 15, from which the instantly rejected claims depend, as described above.
Ranjbaran and Seok do not teach wherein the primer sets are encoded by SEQ ID NO 1 and the genetic target is specific to E. coli (claims 2 and 20), a fecal indicator bacteria or pathogen (claims 11-12).
Wang teaches LAMP assays to detect pathogenic shiga-toxin-producing E. coli (STEC)(Title) in food products such as ground beef and produce (p. 91 first para).
Wang further teaches various primers useful for detecting STEC, including one with a sequence identical to SEQ ID NO: 1, denoted as stx1-F3 in Table 1 (TGATTTTTCACATGTTACCTTTC).
It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the systems, methods and kits for detecting contaminants on produce, as taught by Ranjbaran and Seok to comprise known LAMP primers for detecting STEC, a known pathogenic contaminant of produce, as taught by Wang. The ordinary artisan would have been motivated to detect STEC based on Wang’s teachings of its relevance to human health and its role as a known contaminant of fresh produce, and would have had a reasonable expectation that the disclosed primer would successfully have detected said contaminant based on Wang’s teachings of primers which are successfully used to detect it.
Claims 1, 3-10, 13-15 and 17-19 are rejected under 35 U.S.C. 103 as being unpatentable over Seok (Seok et al. A Paper-Based Device for Performing Loop-Mediated Isothermal Amplification with Real-Time Simultaneous Detection of Multiple DNA Targets. Theranostics. 2017 Jun 1;7(8):2220–2230.) in view of U.S. PGPUB 20160193601 to Magnusson (hereinafter ‘Magnusson’).
Regarding claims 1, 8 and 15, Seok teaches a paper-based portable testing system for detecting the presence or absence of contamination (pathogens), the system comprising at least one isothermal amplification (LAMP) assay device comprising two or more paper-based pads positioned in a stacked configuration relative to each other, at least one of the paper-based pads loaded with one or more reagents comprising primer sets for the amplification of a genetic target associated with contamination, at least one of the paper-based pads that does not have the reagents thereon, a heating unit, the method of claim 8, and the kit of claim 15, as already described in the rejections of those claims under 35 USC 103 over Ranjbaran in view of Seok, above. While Seok does not teach specifically detecting contaminants on produce or in a field, Seok does make clear that such systems are portable and appropriate for point-of-care detection of genetic signals of bacterial contaminants in samples, and it would have been obvious to the ordinary artisan to have modified the reagents to detect the contaminant of interest in any given setting, including disease-causing contaminants present in fresh produce.
Seok does not teach a drop dispensing device comprising: a liquid holder that defines an interior, the interior in fluid communication with an inlet of the liquid holder and an outlet of the liquid holder, and a plunger configured to be movable up and down within at least a portion of the interior of the liquid holder such that downward movement of the plunger within the interior causes any fluid contained in the interior to be displaced through the outlet of the liquid holder, wherein the outlet of the liquid holder further comprises tip comprising a capillary tube that defines an inner surface in fluid communication with the interior.
Seok does teach a drop dispensing device to deliver a droplet of sample in solution to the paper-based device (see Figure 1a).
Magnusson teaches a “single use capillary micropipette for dispensing a defined volume of a liquid” (Title).
Magnusson further teaches that the micropipette comprises a housing (liquid holder), a piston disposed therein (plunger) and a capillary tube connected to the housing (Abstract). These components are also depicted in Figure 1:
PNG
media_image3.png
421
278
media_image3.png
Greyscale
Per para [0036], “As shown, capillary micropipette 10 comprises a housing 20, a piston 50, and a capillary tube 90”.
Magnusson provides a teaching, suggestion or motivation to use the micropipette for point-of-care applications, noting, “Capillary micropipette of the present invention can be used for various applications where manual transferring and dispensing of a defined volume of a liquid sample from an open site, such as from a fingerstick blood or an open specimen container, are needed. The capillary micropipette is particularly suitable for providing a defined volume of blood or other biological samples for point-of-care diagnostic tests, such as for QuickRead diagnostic instruments from Orion Diagnostica, and other point-of-care instruments.” (para [0073]). Magnusson further notes that the micropipette enables delivery of a defined volume accurately and consistently (para [0071]).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the generic drop dispensing device for delivering sample droplets to the paper assay device, as taught by Seok, with the micropipette as taught by Magnusson. The ordinary artisan would have been motivated to do so, and have had a reasonable expectation that the micropipette would be an effective drop dispenser in a point-of-care or field assay, based on Magnusson’s teachings that the micropipette was particularly suitable for providing a defined volume of biological samples for point-of-care tests.
Regarding claim 3, Seok teaches the system comprising a temperature control and imaging unit (p. 222, § LAMP assay in solution).
Regarding claim 4, Seok teaches that the imaging was performed with a high resolution, autofocus camera (i.e., a digital camera, Id.).
Regarding claim 5, Seok teaches wherein the heating unit is an incubator (§ LAMP analysis on the paper device, p. 2223).
Regarding claims 6 and 7, Magnusson teaches that the tip defines a first and/or second angle of 0 degrees (see Fig. 1 above). While neither reference explicitly teaches that the outer surface of the plunger or tip are hydrophobic, Magnusson does teach that accuracy is important for such devices (see above). It would therefore have been obvious, based on sound scientific reasoning and common sense, to have modified said surfaces to be hydrophobic to increase the accuracy and consistency of the dispenser by ensuring that the amount of liquid retained on the surfaces of the micropipette is minimized.
Regarding claim 8, Seok teaches a method for identifying a genetic target associated with contamination, as described above. The combination of references further teaches the recited structure, as described above, including that the reagents pad comprises primer sets (see the Figure 1 caption of Seok). Seok shows loading the paper pads with a drop of the sample and solvent mixture (see Figure 1a), heating the reaction pad to initiate amplification as already described, and detecting a visual result (colorimetric) indicative of the presence or absence of the contaminant, also as described above.
Regarding claim 9, Seok teaches wherein the drop comprises a volume of 25 uL. It would have been obvious to adjust the volume of the drop according to the required volume for a given reaction during routine optimization of the assay procedure.
Regarding claim 10, Seok teaches that the heating step is performed for 60 minutes at 63°C at p. 2223 of Seok, § LAMP analysis on the paper device).
Regarding claim 13, Seok teaches quantifying a concentration of the contaminant (see e.g., Figure 3, which shows quantitative assays of DNA as a function of fluorescence).
Regarding claim 14, it would have been obvious, based on sound scientific reasoning and common sense, to integrate (i.e., include) a heating and imaging unit in the portable POC system to enable POC analysis, rather than return the drop dispenser and assay device to an off-site laboratory.
Regarding claim 15, it would have been obvious to incorporate the necessary components for the portable assay, including the heating unit, water bath, drop dispenser, and paper device, in a kit for ease of transportation and use.
Regarding claims 17 and 18, Seok teaches that the paper device includes reaction and control pads as well as a heating unit, as already described.
Regarding claim 19, it would have been obvious to include sealing sampling containers comprising suitable media in the kit to enable sample collection without exposing the sample to contamination during collection, assay and/or transport.
Claims 2, 11-12 and 20 are rejected under 35 U.S.C. 103 as being unpatentable over Seok and Magnusson as applied to claims 1, 3-10, 13-15 and 17-19, further in view of Wang (Wang et al. Loop-Mediated Isothermal Amplification Assays for Detecting Shiga Toxin-Producing Escherichia coli in Ground Beef and Human Stools. J Clin Microbiol. 2012 Jan;50(1):91-7.)
Seok and Magnusson render obvious the system of claim 1, method of claim 8, and kit of claim 15, from which the instantly rejected claims depend, as described above.
Seok and Magnusson do not teach wherein the primer sets are encoded by SEQ ID NO 1 and the genetic target is specific to E. coli (claims 2 and 20), a fecal indicator bacteria or pathogen (claims 11-12).
Wang teaches LAMP assays to detect pathogenic shiga-toxin-producing E. coli (STEC)(Title) in food products such as ground beef and produce (p. 91 first para).
Wang further teaches various primers useful for detecting STEC, including one with a sequence identical to SEQ ID NO: 1, denoted as stx1-F3 in Table 1 (TGATTTTTCACATGTTACCTTTC).
It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the systems, methods and kits for detecting contaminants on produce, as taught by Seok and Magnusson, to comprise known LAMP primers for detecting STEC, a known pathogenic contaminant of produce, as taught by Wang. The ordinary artisan would have been motivated to detect STEC based on Wang’s teachings of its relevance to human health and its role as a known contaminant of fresh produce, and would have had a reasonable expectation that the disclosed primer would successfully have detected said contaminant based on Wang’s teachings of primers which are successfully used to detect it.
Claim 16 is rejected under 35 U.S.C. 103 as being unpatentable over Seok and Magnusson as applied to claims 1, 3-10, 13-15 and 17-19, further in view of Therkorn (Therkorn et al. Field Performance of a Novel Passive Bioaerosol Sampler using Polarized Ferroelectric Polymer Films. Aerosol Sci Technol. 2017 ; 51(7): 787–800.).
Seok and Magnusson render obvious the kit of claim 15, from which the instantly rejected claim depends, as described above.
Seok and Magnusson do not teach wherein the kit includes a plurality of collection flags for the collection of bioaerosol samples, each collection flag comprising a film affixed to a support at a distance away from an end of the support such that, in use, the support can anchor the film a distance above a surface of an area in which the support is positioned.
The broadest reasonable interpretation of a collection flag encompasses any kind of surface, such as cloth or film, capable of collecting bioaerosol samples. The broadest reasonable interpretation of a support for the flags encompasses any support capable of holding said flags, including poles, stands, frames, etc.
Therkorn teaches passive bioaerosol samplers based on the use of polarized, ferroelectric polymer film (collection flags)(Abstract), each collection flag affixed to a support (see Fig. 2, reproduced below, where the film is affixed to the film holder in a spiral format)
PNG
media_image4.png
521
491
media_image4.png
Greyscale
Note that Fig. 1 shows the films both affixed to the film holder and supported by a pedestal base which anchors the film a distance above the area in which the support is positioned:
PNG
media_image5.png
304
340
media_image5.png
Greyscale
Therkorn further teaches that in “outdoor field testing”, “Compared to passive PTFE filters, which exclusively rely on gravitational particle deposition, REPS collected a 7-fold higher total microorganism quantity… Furthermore, REPS achieved this performance without any air movers, pumps, batteries or external power.” (Abstract).
It would have been prima facie obvious to a person having ordinary skill in the art before the effective filing date of the claimed invention to have modified the kit as taught by Seok and Magnusson to include a mode of collecting samples, such as the passive bioaerosol sampler as taught by Therkorn. The ordinary artisan would have been motivated by, and had a reasonable expectation of success, Therkorn’s teachings that these samplers were more effective at collecting airborne microbes than passive PTFE filters, and were able to do so in an outdoor environment without any batteries or external power, thus rendering the kit easily portable and usable even in environments without easy access to power.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 1, 3, 7-10, 13-15, and 17-19 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claim 1, 8 and 10-12 of copending Application No. 18674833 The copending and instant claims are related as follows:
Copending claim
Instant claim
A method for evaluating microbial contamination of an area of land, the method comprising: obtaining a plurality of samples from various locations in an area of land of interest; detecting the presence or absence of a genetic target associated with contamination in each sample and, if the genetic target is present, quantifying a concentration of the contamination present in the sample
8. The method of claim 1, wherein detecting the presence or absence of a genetic target associated with contamination in each sample is performed using a polymerase chain reaction (PCR) assay or an isothermal amplification assay.
The method of claim 1, wherein quantifying the presence or absence of a genetic target associated with contamination in each sample further comprises: providing at least one drop dispensing device comprising:a liquid holder that defines an interior, the interior in fluid communication with an inlet of the liquid holder and an outlet of the liquid holder, and a plunger configured to be movable up and down within at least a portion of the interior of the liquid holder such that downward movement of the plunger within the interior causes any fluid contained in the interior to be displaced through the outlet of the liquid holder, wherein the outlet of the liquid holder further comprises a tip comprising a capillary tube that defines an inner surface in fluid communication with the interior; providing at least one isothermal amplification assay device comprising two or more paper- based pads positioned in a stacked configuration relative to each other, at least one of the paper-based pads comprising a reaction pad loaded with one or more reagents comprising primer sets for the amplification of a genetic target associated with contamination, and at least one of the paper- based pads comprising a control pad that does not have amplification reagents thereon; suspending a collected sample in a solvent housed within the liquid holder of the drop dispensing device; loading the reaction pad of the assay device with the suspended sample by pressing the plunger of the drop dispensing device down to deliver at least a drop of the combined sample and solvent mixture to the reaction pad; heating the loaded reaction pad of the assay device to initiate amplification of the genetic target if present within the sample; and detecting a visual result in the heated reaction pad indicative of the presence or absence of the contamination in the sample.
12. The method of claim 9, further comprising capturing at least one image of the heated reaction pad of the assay device and quantifying the concentration of the contamination in the sample from the at least one image.
1. A portable testing system for detecting the presence or absence of contamination in a field, the system comprising: at least one drop dispensing device comprising:a liquid holder that defines an interior, the interior in fluid communication with an inlet of the liquid holder and an outlet of the liquid holder, and a plunger configured to be movable up and down within at least a portion of the interior of the liquid holder such that downward movement of the plunger within the interior causes any fluid contained in the interior to be displaced through the outlet of the liquid holder, wherein the outlet of the liquid holder further comprises tip comprising a capillary tube that defines an inner surface in fluid communication with the interior; at least one isothermal amplification assay device comprising two or more paper-based pads positioned in a stacked configuration relative to each other, at least one of the paper-based pads loaded with one or more reagents comprising primer sets for the amplification of a genetic target associated with contamination, and at least one of the paper-based pads that does not have the reagents thereon; and a heating unit.
3. The portable testing system of claim 1, further comprising a temperature control system, an imaging unit, or both a temperature control system and an imaging unit.
7. The portable testing system of claim 1, wherein an outer surface of the plunger of the drop dispensing device is hydrophobic.
8. A method for identifying a genetic target associated with contamination in fresh produce, the method comprising: providing at least one drop dispensing device comprising:a liquid holder that defines an interior, the interior in fluid communication with an inlet of the liquid holder and an outlet of the liquid holder, and a plunger configured to be movable up and down within at least a portion of the interior of the liquid holder such that downward movement of the plunger within the interior causes any fluid contained in the interior to be displaced through the outlet of the liquid holder, wherein the outlet of the liquid holder further comprises tip comprising a capillary tube that defines an inner surface in fluid communication with the interior; providing at least one isothermal amplification assay device comprising two or more paper- based pads positioned in a stacked configuration relative to each other, at least one of the paper- based pads comprising a reaction pad loaded with one or more reagents comprising primer sets for the amplification of a genetic target associated with contamination, and at least one of the paper- based pads comprising a control pad that does not have amplification reagents thereon; suspending a sample from a targeted field with a solvent housed within the liquid holder of the drop dispensing device; loading the reaction pad of the assay device with the suspended sample by pressing the plunger of the drop dispensing device down to deliver at least a drop of the combined sample and solvent mixture to the reaction pad; heating the loaded reaction pad of the assay device to initiate amplification of the genetic target if present within the sample; and detecting a visual result in the heated reaction pad indicative of the presence or absence of the contamination in the sample.
9. The method of claim 8, wherein the drop comprises a volume of 27 uL.
13. The method of claim 8, further comprises quantifying a concentration of the contamination present.
14. The method of claim 8, wherein the heating step is performed by an integrated heating and imaging unit and the method further comprises capturing at least one image of the reaction pad of the assay device.
15. A kit for detecting contamination in a field of interest, the kit comprising: at least one swab for obtaining a sample; at least one drop dispensing device comprising:a liquid holder that defines an interior, the interior in fluid communication with an inlet of the liquid holder and an outlet of the liquid holder, and a plunger configured to be movable up and down within at least a portion of the interior of the liquid holder such that downward movement of the plunger within the interior causes any fluid contained in the interior to be displaced through the outlet of the liquid holder, wherein the outlet of the liquid holder further comprises tip comprising a capillary tube that defines an inner surface in fluid communication with the interior; and at least one isothermal amplification assay device comprising two or more paper-based pads positioned in a stacked configuration relative to each other, at least one of the paper-based pads comprising a reaction pad loaded with one or more reagents comprising primer sets for the amplification of a genetic target associated with contamination, and at least one of the paper-based pads comprising a control pad that does not have amplification reagents thereon.
17. The kit of claim 15, further comprising a control for comparison with a reacted reaction pad to determine a baseline against which visual results of the reacted reaction pad can be measured.
18. The kit of claim 15, further comprising a heating element to initiate amplification of the genetic target when the one or more reagents of the assay device and the sample are combined
19. The kit of claim 15, further comprising one or more sealable containers comprising a media for use in wetting a leaf or collection flag prior to obtaining a sample therefrom.
11. The method of claim 9, wherein the heating step is performed for about 45 to about 120 minutes and the loaded reaction pad is heated to a temperature of at or between 60-70C.
10. The method of claim 8, wherein the heating step is performed for at or between about 45 to about 120 minutes and the loaded reaction pad is heated to a temperature of at or between 60-70C.
Although the claims at issue are not identical, they are not patentably distinct from each other because it would have been obvious to incorporate the additional elements of an integrated heating and/or imaging unit with which to perform the heating and imaging steps of the method, for ease of use in the field; incorporating the system into a kit with control, heating element and containers for ease of practicing the method and using the system; modify the outer plunger surface to be hydrophobic to increase accuracy and decrease liquid retention in the holder; and to optimize the volume of the droplet during routine optimization of the isothermal amplification reaction and sample characteristics; would all have been obvious for substantially the same reasons already discussed in the rejections of the claims under 35 U.S.C. above.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 2, 11-12 and 20 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims of copending Application No. 18674833, as applied to claims 1, 3, 7-10, 13-15, and 17-19 above, in view of Wang (cited above).
Although the claims at issue are not identical, they are not patentably distinct from each other because it would have been obvious to modify the system/method/kit as taught by the copending claims for use in targeting STEC contaminants in produce using STEC-specific primers, including SEQ ID NO: 1, as taught by Wang, for substantially the same reasons discussed above with regard to claims 2, 11-12 and 20.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claims 4 and 5 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims of copending Application No. 18674833, as applied to claims 1, 3, 7-10, 13-15, and 17-19 above, in view of Seok (cited above).
Although the claims at issue are not identical, they are not patentably distinct from each other because it would have been obvious to modify the system/method/kit as taught by the copending claims by including a water bath component and a high resolution digital camera, as taught by Seok, to facilitate ease of use in the field, for the same reasons already discussed above in the rejections of the claims under 35 U.S.C. 103.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claim 6 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims of copending Application No. 18674833, as applied to claims 1, 3, 7-10, 13-15, and 17-19 above, in view of Magnusson (cited above).
Although the claims at issue are not identical, they are not patentably distinct from each other because it would have been obvious to modify the system/method/kit as taught by the copending claims to include the particular micropipette drop dispenser as taught by Magnusson, for the same reasons discussed above in the rejection of the claim under 35 U.S.C. 103.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Claim 16 is provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims of copending Application No. 18674833, as applied to claims 1, 3, 7-10, 13-15, and 17-19 above, in view of Therkorn (cited above).
Although the claims at issue are not identical, they are not patentably distinct from each other because it would have been obvious to modify the system/method/kit as taught by the copending claims to include the plurality of collection flags as taught by Therkorn, for the same reasons discussed above in the rejection of the claim under 35 U.S.C. 103.
This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented.
Conclusion
No claims are allowed at this time.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to AMANDA M ZAHORIK whose telephone number is (703)756-1433. The examiner can normally be reached M-F 8:00-16:00 EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached on (571) 270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AMANDA M ZAHORIK/Examiner, Art Unit 1636
/BRIAN WHITEMAN/Primary Examiner, Art Unit 1636
Prosecution Insights