Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Status of Claims
Claims 1-18 and 23-24 are pending and the subject of this NON-FINAL Office Action. This is the first office action on the merits.
Priority Note
Applicants have not filed English translations of the Chinese priority documents, nor the PCT; thus, priority cannot be verified.
Objection to Spec - Missing SEQ ID NOS
The Specification is objected to because Table 1, pages 29 and 57-60 contains nucleic acid sequences with 10 or more contiguous nucleotides without sequence identifiers. Applicants must correct this. See MPEP § 2422.
Claim Rejection - 35 USC § 112- Indefiniteness
The following is a quotation of 35 U.S.C. 112(b):
(B) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
Claims 1-8 are rejected under 35 U.S.C. 112(b) as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor regards as the invention.
The metes and bounds of the claims are so unclear and confusing that the Office cannot determine if the instant claims are patentable because it would require the Office to speculate as to the metes and bounds of the instant claims. See MPEP § 2173.06 (“Second, where there is a great deal of confusion and uncertainty as to the proper interpretation of the limitations of a claim, it would not be proper to reject such a claim on the basis of prior art. As stated in In re Steele, 305 F.2d 859, 134 USPQ 292 (CCPA 1962), a rejection under 35 U.S.C. 103 should not be based on considerable speculation about the meaning of terms employed in a claim or assumptions that must be made as to the scope of the claims.”). In fact, They appear to be a literal translation into English from a foreign document and are replete with grammatical and idiomatic errors. For example, “N1CUCCAGGUGN11-N12-N13GUAACGGACUUAGAUCCACUGUACGN39, wherein N1, N11, N12, NB and N39 represent nucleotide fragments.” This transitional phrase is not used in United States practice. Th term “represent” is inherently vague, meaning to serve as a sign or symbol of; to portray; to typify; to take the place of; and many other vague possible meanings.
As another example, “at least one base pair in N1 and N39 nucleotide sequences forms a complementary pair.” It is unclear what forms a base pair with what. Moreover, is N1 and N39 can be 10 bases each, but only one base pair is formed in claims 5-6, then this is contradictory.
Another example: “comprising following nucleotide sequences (a), (b) or (c): (a) . . . and (c) . . . .”
Another example: “a nucleic acid aptamer molecule derived from (a) at a position not including N1, N11, N12, N13 and N39 in the nucleotide sequence limited by (a), with substitution, missing and/or addition of one or several nucleotides, and having aptamer functions.” It is entirely unclear how an aptamer is “derived from” a sequence because derive is inherently vague. It can mean infer, deduce; bring; to take, receive, or obtain especially from a specified source; to obtain (a chemical substance) actually or theoretically from a parent substance. Further, how is it derived without N1, N11, N12, N13 and N39, which complete the sequence, and are required in (a)? The meaning of “with substitution, missing and/or addition of one or several nucleotides” also makes no sense. Which “several nucleotides” are referenced? Moreover, what numbers are encompassed by “several”? This term is inherently vague, as it can mean more than one; but also more than two but fewer than many; or even being a great many. What is an “aptamer function”? This is simply never clearly defined. The phraseology “with substitution, missing and/or addition” is also incoherent. How is a nucleotide “missing”? How is the same “one” nucleotide substituted, missing and added?
Many claims use the phrase “the N16 structure nucleotide sequence of (a),” however there is no “N16 structure recited. It is entirely unclear is this.
In claim 5, it is entirely unclear why 3’-5’ and 5’-3’ are recited because the nucleotide sequence in claim 1 is already inherently recited from 5’-3’ as this is the convention for writing sequences. Thus, claim 5 is confusing.
Claims 7-9 and others recite “the General Formula N16 structure” which has no antecedent basis.
Claim 10 recites “F30” which lacks antecedent basis, and is not clearly defined. Nor is “tRNA scaffold RNA sequences.” Thus, the metes and bounds of these phrases are unclear.
Claim 13 recites “refers to that the nucleic acid aptamer can enhance fluorescence intensity of fluorophore,” but it is entirely unclear what I meant by “refers to.” This is inherently vague as “refer” can mean to think of, regard, or classify within a general category or group; to think of, regard, or classify within a general category or group; to explain in terms of a general cause; to allot to a particular place, stage, or period; to regard as coming from or located in a specific area; to have relation or connection. Moreover, it is unclear what is the further limitation in this claim as “can” means what comes after is not required. Nor is it clear what is “appropriate” as this is a subjective, contextual term with no clear and consistent meaning. Finally, “enhance . . . by at least 2 times, at least 5 to ten times . . .” is entirely unclear as there is no baseline/referent, nor any unit of measure.
Similarly, in claim 14, “appropriate length that may be 2, 3, 4, 5, 6, 7, 8 or more” makes no sense. Moreover, periods in the middle of claims are not allowed. See MPEP __. Finally, this phrase is confusing: “Nucleotides of the concatemers can be selected from but are not limited to sequences SEQ ID No: 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12 and 13.” “Can be” provides no limitation; and if the concatemers are not limited to the listed sequences, then this is merely a suggestion. Once again, Applicants should read MPEP § 2111 which explains the conventional United States terminology used in claims such as transitional phrases.
In claim 15, the circles in the chemical formula are unrecognized symbols. Specifically,
PNG
media_image1.png
238
292
media_image1.png
Greyscale
Again, all uses of “represented” throughout the claims (e.g. claim 15) are inherently vague as explained above.
The use of quotations around terms of art like “alkyl” in claim 15 are inherently confusing. Quotation marks are punctuation marks used in pairs in various writing systems to identify direct speech, a quotation, or a phrase. There is no reason to use quotation marks for terms of art like “alkyl.”
As is the use of “preferably” throughout the claims, because it is unclear if these are merely examples, or further limitations.
Finally, claim 23 makes no sense. It recites
A kit, containing the nucleic acid aptamer molecule according to claim 1, and/or the expression vector and/or the host cell;
wherein
the host cell contains the expression vector, the expression vector contains DNA molecules for transcribing the nucleic acid aptamer molecules according to claim 1.
Both “the expression vector” and “the host cell” in the preamble lack antecedent basis. In addition, it is unclear if the expression vector merely contains vague “DNA molecules for transcribing the nucleic acid aptamer,” or Applicants intend to mean the expression vector contains the aptamer of claim 1. The specification never describes “DNA molecules for transcribing the nucleic acid aptamer” that are separate from the aptamer. Thus, this phraseology creates confusion as to the claim scope.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. § 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1-8 are rejected under 35 U.S.C. § 102(a)(1) as being anticipated by Chen et al, Real-time quantification of microRNAs by stem-loop RT-PCR, Nucleic Acids Res. 2005 Nov 27;33(20):e179. doi: 10.1093/nar/gni178, as evidenced by US 20050266418.
As best the Examiner can determine based on Figure 1, the claims are directed to designing the following primers and probe:
PNG
media_image2.png
406
650
media_image2.png
Greyscale
This is well-known since at least 2005.
As to claims 1-6 and 8, Chen teaches forward primer (GCCTGAAGCTGCCAGTTGA) that excludes last 6 bases of miRNA target (miR-21 minus aacugu in aagcugccaguugaagaacugu) and Tm 60°C (based on salt adjusted @ 250mM); stem-loop primer (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACAGTT) that has 6 bases (ACAGTT) complementary to miR and deltaGibbs of the 6 bases (-3.62 kcal/mol) versus forward primer (-21.98 kcal/mol) of -18.36kcal/mol (based on 37°C, 50nM salt, 1.5mM magnesium, 02.nM dNTP, and 250nM primer); reverse primer (GTGCAGGGTCCGAGGT) identical to stem, without 5 or bases of miR (ACAGTT) and Tm 57.51°C (based on salt adjusted @ 250mM); and probe (TGGATACGACACAGTTCT) split between stem-loop and miR (Fig. 1).
PNG
media_image3.png
562
392
media_image3.png
Greyscale
Further as to claim 4, US 20050266418 is the patent application for the technique of Chen et al. as shown in the Figures of US 20050266418 and the fact the same inventors (Chen and Ridzon from Applera assignee) are listed. US 20050266418 explicitly requires “the detector probes of the present teachings have a Tm of 63-69C” (para. 0039).
Prior Art
The following prior art is also pertinent: US 20060078924; US 20070111226; US 20070048757; US20100047784; CN103045723A (SEQ ID NO: 1); CN103757126 (SEQ ID NO: 2); CN108103201 (SEQ ID NO: 3); CN109295233 (SEQ ID NO: 4).
Conclusion
No claims are allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Aaron Priest whose telephone number is (571)270-1095. The examiner can normally be reached 8am-6pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/AARON A PRIEST/ Primary Examiner, Art Unit 1681
Prosecution Insights