Prosecution Insights
Last updated: October 04, 2026
Application No. 18/682,176

microRNA BIOMARKER FOR EARLY DIAGNOSIS OF MILD COGNITIVE IMPAIRMENT OR ALZHEIMER TYPE DEMENTIA

Non-Final OA §101§102§112
Filed
Feb 08, 2024
Priority
Aug 13, 2021 — RE 10-2021-0107017 +3 more
Examiner
PRIEST, AARON A
Art Unit
1681
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Alz-Dementia Korea Co.
OA Round
1 (Non-Final)
61%
Grant Probability
Moderate
1-2
OA Rounds
6m
Est. Remaining
87%
With Interview

Examiner Intelligence

Grants 61% of resolved cases
61%
Career Allowance Rate
495 granted / 808 resolved
+1.3% vs TC avg
Strong +26% interview lift
Without
With
+25.7%
Interview Lift
resolved cases with interview
Typical timeline
3y 2m
Avg Prosecution
45 currently pending
Career history
840
Total Applications
across all art units

Statute-Specific Performance

§101
7.8%
-32.2% vs TC avg
§103
33.0%
-7.0% vs TC avg
§102
22.1%
-17.9% vs TC avg
§112
23.3%
-16.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 808 resolved cases

Office Action

§101 §102 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Status of Claims Claims 6-14 and 16-25 are pending. Claims 6-14 are the subject of this NON-FINAL Office Action. This is the first office action on the merits. Election/Restrictions Applicant’s election without traverse of Group I (claims 6-14) in the reply filed on 06/12/2026 is acknowledged. Claims 16-25 are withdrawn. Objection to Specification The sequences listed at paragraphs 0095, 0097 and 0101 as SEQ ID NOS: 1-5 do not match SEQ ID NOS: 1-5 of the sequence listing. This must be corrected. Claim Interpretations The claims are littered with intended uses that fail to distinguish the claimed composition/product over the prior art products. For example, in claim 6 preamble “for early diagnosis of mild cognitive impairment or Alzheimer type dementia.” In claim 7: “serving as a linker.” In claims 10-14: “the kit is used for RT-PCR, real-time PCR, isothermal PCR, Northern blotting, RNA protection assay, or microarray chip”; and “the kit is used for a medical device for HTS (high-throughput-screening)-based multiplexed POCT (point-of-care-testing).” All descriptions of the “medical devices” in claims 11-14 are mere intended use as well because the medical devices are not required in the kit. “Antisense oligonucleotide” is undefined in the specification; thus, it is any oligonucleotide. Claim Rejection - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 6-14 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. Specifically, the claims are directed to natural sequences, without significantly more. First, under Step 1, the claims are directed to a “biosensor,” which is broadly interpreted in light of the specification as any generic agent capable of detection (e.g. primer, probe, antibody, protein, etc.). Thus, the claims are directed to products. Under step 2A, the claimed “biosensor” “agent” (e.g. oligo) is clearly a natural sequence such as SEQ ID NO: 1. See MPEP § 2106.04(b)(II). This is shown below: PNG media_image1.png 234 694 media_image1.png Greyscale As to steps 2A-2B, none of the claims recite additional elements that render the natural sequences markedly different from a product of nature. Specifically, claim 6 is a bare “agent” with a natural sequence as shown above. Claim 7 is so unclear that its scope is impossible to determine. Claims 8-9 merely recite oligo, primer or probe structure, but these are all structures that carry a mere natural sequence without any other non-natural component. See MPEP § 2106.04(c). Moreover, claims 10-14 recite components not required in the kit; rather only intended uses. Thus, nothing in the claims recites additional components that render the product claims markedly different from a natural sequence. Thus, the claims fail to pass muster under Section 101. Claim Rejection - 35 USC § 112 – Written Description The following is a quotation of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claims 7 and 9-14 are rejected under 35 U.S.C. 112(a) as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, at the time the application was filed, had possession of the full scope of the claimed invention. The specification does not demonstrate possession of “a nano-fluorescent complex having biotin-streptavidin serving as a linker and a fluorophore of various wavelengths and a quencher bound to the complex.” “[T]he purpose of the written description requirement is to ‘ensure that the scope of the right to exclude, as set forth in the claims, does not overreach the scope of the inventor’s contribution to the field of art as described in the patent specification.”’ Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1353–54 (Fed. Cir. 2010) (en banc). Whether the disclosure of a patent satisfies the written description requirement is a question of fact. See id. at 1351. The test for sufficiency of the written description support is “whether the disclosure of the application relied upon reasonably conveys to those skilled in the art that the inventor had possession of the claimed subject matter as of the filing date sought.” Id. This “possession” test “requires an objective inquiry into the four corners of the specification from the perspective of a person of ordinary skill in the art.” Id. Possession shown by evidence “outside of the specification is not enough,” and “a description that merely renders the invention obvious does not satisfy the requirement.” Id. at 1352. Instead, it is the specification itself that must demonstrate possession. Id. Where, as here, a genus is claimed using functional language to define a desired result, “the specification must demonstrate that the applicant has made a generic invention that achieves the claimed result and do so by showing that the applicant has invented species sufficient to support a claim to the functionally-defined genus.” Id. at 1349; AbbVie Deutschland GmbH v. Janssen Biotech, Inc., 759 F.3d 1285, 1299 (Fed. Cir. 2014). A “sufficient description of a genus instead requires the disclosure of either a representative number of species falling within the scope of the genus or structural features common to the members of the genus so that one of skill in the art can ‘visualize or recognize’ the members of the genus.” Ariad Pharms., 598 F.3d at 1350. Such correlations may be established “by the inventor as described in the specification,” or they may be “known in the art at the time of the filing date.” See AbbVie, 759 F.3d at 1301. And any claimed functions of the various generic terms and phrases that “merely draw[s] a fence around the outer limits of a purported genus [and] is not an adequate substitute for describing a variety of materials constituting the genus and showing that one has invented a genus and not just a species.” See Ariad, 598 F.3d at 1350. Here, the specification simply never explains in any detail whatsoever what is a “nano-fluorescent complex.” The specification merely repeats the claim language that it has “biotin-streptavidin serving as a linker and a fluorophore of various wavelengths and a quencher bound to the complex.” However, the specification never explains what the biotin-streptavidin links; nor any fluorophores, their wavelengths, their location in the “complex,” their number and interactions, or any other features; nor any quenchers; much less what this “complex” looks like. The claims and specification merely state to throw these components together. Applicants cannot rely on any familiar structures in the art because “nano-fluorescent complex” is never used in the art. Applicants have invented a phrase, then completely failed to define it in any detail. In other words, Applicants present a wish or plan to later develop this new “nano-fluorescent complex,” and fail to disclose any species whatsoever. In light of this complete dearth of species and detail, the “nano-fluorescent complex” is not described in any detail that approaches anywhere near “full, clear, concise, and exact terms.” Claim Rejections - 35 USC § 112- Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (B) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claim 6-14 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. It is not clear from claim 6 or the specification what are SEQ ID NOS: 1-5. Starting with claim 6, the run-on clause at the body of the claim is confusing: “an agent capable of detecting any one of miRNAs selected from the group consisting of nucleotide sequences of SEQ ID NOs: 1 to 5 as an effective component.” It is not clear if the sequences are describing the miRNAs, or the “agent.” It is also unclear what “effective component” is referencing. Moreover, the specification describes SEQ ID NOS: 1-5 as “miRNA mimics” (para. 0095, for example- “The miRNA mimics are miRNAs that can function similarly to the novel miRNAs in living human body, and they were prepared as a double strand (specifically, the sequence of miRNA 1 mimic is 5′-CAACAGAGCAAGACUCUGUC-3′ (1-AS) (SEQ ID NO: 1)”); yet, the sequence listing shows SEQ ID NOS: 1-5 as non-miRNA (e.g. SEQ ID NO: 1 is caacagagcaagactctgtc). Thus, it is not clear if SEQ ID NOS: 1-5 are miRNAs or just oligonucleotides. Claim 6 is confusing because on one hand the claims is a “biosensor composition,” yet on the other hand a “biosensor.” Claim 6 preamble states “A biosensor composition . . . , the biosensor comprising . . . .” Moreover, this inconsistent language introduces missing antecedent basis for “the biosensor.” As explained above with regards to written description, the “nano-fluorescent complex” metes and bounds are completely unclear. The specification simply never explains what the biotin-streptavidin links; nor any fluorophores, their wavelengths, their location in the “complex,” their number and interactions, or any other features; nor any quenchers; much less what this “complex” looks like. It is impossible to determine the metes and bounds of this “nano-fluorescent complex” invented by Applicants. The “all-in-one” medical device of claims 13-14 is unclear. Applicants fail to explain what constitutes “all.” Thus, it is impossible to determine what “all-in-one” means. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. § 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. Claims 6-14 are rejected under 35 U.S.C. § 102(a)(1) as being anticipated by GIERSE (US 20040132063). As to claims 6-14, GIERSE teaches a probe comprising caacagagcaagactctgtc (here, SEQ ID NO: 1; GIERSE SEQ ID NO: 1112 in Table 1), which can be labeled, e.g. with fluorescent labels for use in qPCR, for example (paras. 0047, 0187, 0189). GIERSE also teaches kits comprising such oligos, for use in HTS and POCT devices (paras. 0046-47, 0187). Conclusion No claims are allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to Aaron Priest whose telephone number is (571)270-1095. The examiner can normally be reached 8am-6pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /AARON A PRIEST/Primary Examiner, Art Unit 1681
Read full office action

Prosecution Timeline

Feb 08, 2024
Application Filed
Jul 16, 2026
Non-Final Rejection mailed — §101, §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12746539
MULTIPLEXED POLYMERASE CHAIN REACTION IN MICROPIPETTE FORMAT
2y 11m to grant Granted Sep 29, 2026
Patent 12736524
RECEPTORS FOR CYCLIC DINUCLEOTIDES AND METHODS FOR SCREENING AGONISTS OR INHIBITORS THEREOF
2y 11m to grant Granted Sep 15, 2026
Patent 12735744
Compositions and Methods for Detecting C1orf43 Nucleic Acid
2y 7m to grant Granted Sep 15, 2026
Patent 12716104
SAMPLE POOLING ASSAY
2y 7m to grant Granted Aug 25, 2026
Patent 12703885
METHOD FOR PREDICTING THE RESPONSE TO CDK4/6 INHIBITOR THERAPY IN CANCER PATIENTS
3y 1m to grant Granted Aug 11, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
61%
Grant Probability
87%
With Interview (+25.7%)
3y 2m (~6m remaining)
Median Time to Grant
Low
PTA Risk
Based on 808 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month