DETAILED ACTION
Notice of Pre-AIA or AIA Status
1. The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Restriction/Election
2. Restriction is required under 35 U.S.C. 121 and 372.
This application contains the following inventions or groups of inventions, which are not so linked as to form a single general inventive concept under PCT Rule 13.1.
In accordance with 37 CFR 1.499, applicant is required, in response to this action, to elect a single invention to which the claims must be restricted.
Group I. Claims 1-2, 4-5 and 10-15 are drawn to an isolated nucleic acid, vector, microbial cell and method for producing a protein of interest, classified in A61K 38/00.
Group II. Claims 6 and 9 are drawn to an isolated protein and protein preparation, classified in C12N 9/96.
3. The invention listed in Group l-II above do not relate to a single general inventive concept under PCT Rule 13.1 because, under PCT Rule 13.2, they lack the same or corresponding special technical features for the following reasons: because the invention of Group II does not escape the prior art (see Database EMBL, June 2016, of record in the application) which discloses a the protein and a protein preparation (see entire document). Therefore, these inventions are deemed to lack unity of invention because they are not so linked as to form a single general inventive concept under PCT Rule 13.1.
Species Election:
4. Upon election of one of Groups I and II applicant is required to make a further election of a single nucleotide or amino acid sequence for examination on the merits, because the structures are different thus represents different products. Under PCT 13.1 applicant is entitled to the first product and these represents multiple products.
Applicant is reminded that upon the cancellation of claims to a non-elected invention,
the inventorship must be amended in compliance with 37 CFR 1.48(b) if one or more of
the currently named inventors is no longer an inventor of at least one claim remaining in
the application. Any amendment of inventorship must be accompanied by a petition
under 37 CFR 1.48(b) and by the fee required under 37 CFR 1.17(1).
Applicant is advised that the reply to this requirement to be complete must include an
election of the invention to be examined even though the requirement be traversed (37
CFR 1.143).
Applicant is advised that the reply to this requirement to be complete must include (i) an election of a species or a grouping of patentably indistinct species to be examined even though the requirement may be traversed (37 CFR 1.143) and (ii) identification of the claims encompassing the elected species or grouping of patentably indistinct species, including any claims subsequently added. An argument that a claim is allowable or that all claims are generic is considered nonresponsive unless accompanied by an election.
The election may be made with or without traverse. To preserve a right to petition, the election must be made with traverse. If the reply does not distinctly and specifically point out supposed errors in the election of species requirement, the election shall be treated as an election without traverse. Traversal must be presented at the time of election in order to be considered timely. Failure to timely traverse the requirement will result in the loss of right to petition under 37 CFR 1.144. If claims are added after the election, applicant must indicate which of these claims are readable on the elected species or grouping of patentably indistinct species.
5. During a telephone conversation with Mr. Bill Brazil on February 3, 2026, a provisional election was made without traverse to prosecute the Invention of Group I, claims 1-2, 4-5 and 10-15 (with species SEQ ID NO: 1). Affirmation of this election must be made by applicant in responding to this Office action. Claims 6 and 9 are withdrawn from further consideration by the examiner, 37 CFR 1.142 (b), as being drawn to a non-elected invention.
6. The Preliminary Amendment filed on February 14, 2024, has been received and entered.
Claim Disposition
7. Claims 3 and 7-8 are cancelled. Claims 1-2, 4-6 and 9-15 are pending. Claims 1-2, 4-5 and 10-15 are under examination. Claims 6 and 9 are further consideration by the examiner, 37 CFR 1.142 (b), as being drawn to a non-elected invention.
Information Disclosure Statement
8. The Information Disclosure Statements filed on June 21, 2023 and December 12, 2024, have been received and entered. The references cited on the PTO-1449 Form have been considered by the examiner and a copy is attached to the instant Office action.
Drawing
9. The drawings filed on February 14, 2024, are objected to by the examiner. Note that FIG 3 has no labels besides 1-12 and is very pale and should have some marginal labels. In addition, FIG 9 is not clear enough, not legible and bears no explanation for the labels like ‘UN’.
Appropriate correction is required.
Specification Objection
10. The specification is objected to for the following informalities:
The specification is objected to because the organism names are not always italicized (see page 45, ‘Bacillus’; pages 7 and 53 for ‘Trichoderma’; and more organisms on page 11).
Appropriate correction is required.
Claim objection
11. Claims 1-2, 4-5 and 10-15 are objected to for the following informalities:
For clarity and precision of claim language it is suggested that claim 1 is amended to recite “….comprising a nucleotide sequence that is at least 90% identical to a nucleotide sequence selected from the group consisting of….”. See also claim 2 with similar language.
Claim 1 is objected to for the recitation of non-elected subject matter. The dependent claims hereto are also included.
For clarity it is suggested that claim 4 is amended to read, “A vector comprising [[a]] the isolated nucleic acid of claim 1”.
For clarity claim 5 should be amended to recite, “…. comprising the vector of claim 4, wherein the vector is introduced one or more times into the cell”.
For clarity it is suggested that claim 10 is amended to recite, “sequence identity”.
For clarity it is suggested that claim 11 is amended to read, “The recombinant microbial cell of claim 10, wherein the cell is selected from the group consisting of…”.
For clarity it is suggested that claim 12 is amended to read, “…fermenting the microbial cell of claim 11…”. The dependent claims hereto are also included.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
12. Claims 1-2, 4-5 and 10-15 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AlA), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or
a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claimed invention is directed to “an isolated nucleic acid, vector, recombinant microbial cell, fermentation broth and method for producing a protein. The claimed invention encompasses a large variable genus of nucleic acid sequence that can be at least 80% identical to the 9 structures recited in claim 1 and that could encode the protein that is 85% identical to the 8 structures in claim 2. The art generally acknowledges that several different DNAs can encode the same protein, and that a single modification to the gene structure can be detrimental to the protein structure, thus the invention needs to be adequately described. The claimed invention does not set forth what protein is encoded in claim 2 or if said protein is functional. The recombinant cell is not defined either the expresses the protein and from which the fermentation broth is obtained. Thus the claimed invention is not adequately described and no correlation is made between structure and function. The claimed invention is also directed to any vector comprising ‘a’ nucleic acid which reads on fragments, derivatives, analogs and any variant of the sequences, which is not adequately described because it is overly broad. The claimed invention is not commensurate in scope with the disclosure.
A large variable genus of products, are encompassed in the claims as well as modifications that are not described. The specification fails to provide a representative number of species for the claimed genus to show that applicant was in possession of the claimed genus. A representative number of species means that the species, which are adequately described, are representative of the entire genus.
The written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, disclosure of drawings, or by disclosure of relevant identifying characteristics, for example, structure or other physical and/or chemical properties, by
functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. Vas-Cath Inc. v. Mahurkar, 935 F.2d 1555, 1563-64, 19 USPQ2d 1111, 1117 (Fed. Cir. 1991), states that "applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed" (See page 1117). The specification does not "clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed" (See Vas-Cath at page 1116). The skilled artisan cannot envision the detailed chemical structure of the encompassed genus, and therefore, conception is not achieved until reduction to practice has occurred, regardless of the complexity or simplicity of the method of isolation. Adequate written description requires more than a mere statement that it is part of the invention and reference to a potential method of isolating it. The compound itself is required. See Fiers v. Revel, 25 USPQ2d 1601 at 1606 (CAFC 1993).
Therefore, for all these reasons the specification lacks adequate written description, and one of skill in the art cannot reasonably conclude that the applicant had possession of the claimed invention at the time the instant application was filed.
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
13. Claim 5 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 5 lacks clear antecedent basis for the recitation of “introduced vectors”.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
14. Claim(s) 1-2 and 10-11 are rejected under 35 U.S.C. 102 (a)(1) as being anticipated by Accession No: A0A147KK87_THECS, 2016 (see alignment below).
The reference provides a structure that is 100% identical to SEQ ID NO:1 (nucleic acid) and that encodes SEQ ID NO: 2 (a protein). The reference also discloses a cell such as a bacteria (i.e Thermobifida, gram positive) expressing the expression product of SEQ ID NO:2 that meets the at least 85% language. Therefore, the limitations of the claims are met by the reference.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
15. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
16. Claim(s) 1-2, 4-5 and 10-15 is/are rejected under 35 U.S.C. 103 as being unpatentable over Accession No: A0A147KK87_THECS, 2016 (see alignment below) in view of WO2008/065200 (record in the application) and WO2013/043860 (of record in the application).
The teaching of the primary reference pertaining to claims 1-2 and 10-11 is above.
The primary reference does not per se teach a vector and that the proteins are essentially free of contaminating DNA, however, the secondary reference teaches host cells capable of producing recombinant enzymes free of DNA. The nucB coding nuclease from Bacillus subtilis and lichenformis was cloned under pstS promoter. The promoter is induced at the end of the fermentation process, when the DNAse is needed for cleaning the fermentation broth from excess DNA. In addition, the nuclease activity of the nuclease is tested by adding cell free supernatant from the fermentation broth wherein the nuclease and the protein of interest was expressed to DNA samples (see end of example 5). Further, the tertiary reference discloses a method for reducing the DNA content in the production of recombinant protein by Trichoderma reesi by increasing the activity of the endogenous DNAse. Additions, it is disclosed the possible use of the culture broth for reducing the DNA content of other recombinant host cells (see paragraph 84). Both the secondary and tertiary references disclose methods for the production of a recombinant protein in a microorganism wherein a DNAse is further produced in order to decrease the DNA content in the final protein preparation.
Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to arrive at the claimed invention as a whole because the combined teaching of the references renders the claims as obvious. The references are considered to be analogous art, thus motivation to combine exists. It would be obvious to modify the primary reference that discloses the structure to add the method of producing a protein because the primary reference discloses expression of the protein in a cell and it would be obvious to add a vector to introduce the gene.
Moreover, the Supreme Court pointed out in KSR, “a patent composed of several elements is not proved obvious merely by demonstrating that each of its elements was, independently, known in the prior art.” KSR, 127 S. Ct. at 1741. The Court thus reasoned that the analysis under 35 U.S.C. 103 "need not seek out precise teachings directed to the specific subject matter of the challenged claim, for a court can take account of the “inferences and creative steps that a person of ordinary skill in the art would employ.” Id. at 1741. The Court further advised that “[a] person of ordinary skill is…a person of ordinary creativity, not an automation.” Id. at 1742. Therefore, the claimed invention was obvious to make and use at the time the invention was made and was prima facie obvious.
Alignments
RESULT 1
A0A147KK87_THECS
ID A0A147KK87_THECS Unreviewed; 239 AA.
AC A0A147KK87;
DT 08-JUN-2016, integrated into UniProtKB/TrEMBL.
DT 08-JUN-2016, sequence version 1.
DT 08-OCT-2025, entry version 47.
DE RecName: Full=GmrSD restriction endonucleases C-terminal domain-containing protein {ECO:0000259|Pfam:PF07510};
GN ORFNames=AC529_05610 {ECO:0000313|EMBL:KUP97706.1};
OS Thermobifida cellulosilytica TB100.
OC Bacteria; Bacillati; Actinomycetota; Actinomycetes; Streptosporangiales;
OC Nocardiopsidaceae; Thermobifida.
OX NCBI_TaxID=665004 {ECO:0000313|EMBL:KUP97706.1, ECO:0000313|Proteomes:UP000074382};
RN [1] {ECO:0000313|Proteomes:UP000074382}
RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA].
RC STRAIN=TB100 {ECO:0000313|Proteomes:UP000074382};
RA Toth A., Baka E., Luzics S., Bata-Vidacs I., Nagy I., Balint B., Herceg R.,
RA Olasz F., Wilk T., Nagy T., Kriszt B., Nagy I., Kukolya J.;
RT "Plant polysaccharide degrading enzyme system of Thermpbifida
RT cellulosilytica TB100 revealed by de novo genome project data.";
RL Acta Aliment. 0:0-0(2017).
CC -!- CAUTION: The sequence shown here is derived from an EMBL/GenBank/DDBJ
CC whole genome shotgun (WGS) entry which is preliminary data.
CC {ECO:0000313|EMBL:KUP97706.1}.
CC ---------------------------------------------------------------------------
CC Copyrighted by the UniProt Consortium, see https://www.uniprot.org/terms
CC Distributed under the Creative Commons Attribution (CC BY 4.0) License
CC ---------------------------------------------------------------------------
DR EMBL; LGEM01000021; KUP97706.1; -; Genomic_DNA.
DR RefSeq; WP_068754933.1; NZ_KQ950181.1.
DR AlphaFoldDB; A0A147KK87; -.
DR STRING; 665004.AC529_05610; -.
DR PATRIC; fig|665004.4.peg.1568; -.
DR OrthoDB; 5196645at2; -.
DR Proteomes; UP000074382; Unassembled WGS sequence.
DR InterPro; IPR011089; GmrSD_C.
DR PANTHER; PTHR24094:SF15; AMP-DEPENDENT SYNTHETASE_LIGASE DOMAIN-CONTAINING PROTEIN-RELATED; 1.
DR PANTHER; PTHR24094; SECRETED PROTEIN; 1.
DR Pfam; PF07510; GmrSD_C; 1.
PE 4: Predicted;
KW Reference proteome {ECO:0000313|Proteomes:UP000074382};
KW Signal {ECO:0000256|SAM:SignalP}.
FT SIGNAL 1..30
FT /evidence="ECO:0000256|SAM:SignalP"
FT CHAIN 31..239
FT /note="GmrSD restriction endonucleases C-terminal domain-
FT containing protein"
FT /evidence="ECO:0000256|SAM:SignalP"
FT /id="PRO_5007549910"
FT DOMAIN 100..193
FT /note="GmrSD restriction endonucleases C-terminal"
FT /evidence="ECO:0000259|Pfam:PF07510"
FT REGION 175..197
FT /note="Disordered"
FT /evidence="ECO:0000256|SAM:MobiDB-lite"
SQ SEQUENCE 239 AA; 25917 MW; F046F61DF04185E7 CRC64;
Alignment Scores:
Length: 239
Score: 1111.00 Matches: 209
Percent Similarity: 100.0% Conservative: 0
Best Local Similarity: 100.0% Mismatches: 0
Query Match: 99.9% Indels: 0
Gaps: 0
US-18-683-749-1 (1-630) x A0A147KK87_THECS (1-239)
Qy 1 TTAGATGATTTGTTAGCGGAACTGGAAGAAATTGAAGCGGATGTGCCTGCGACAGCGGAA 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 31 LeuAspAspLeuLeuAlaGluLeuGluGluIleGluAlaAspValProAlaThrAlaGlu 50
Qy 61 TCACAAGCACCTGAAGGAGATGCGGATGCAGTCGAAGCACGTCAACGCTTAGGAGAAATC 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 51 SerGlnAlaProGluGlyAspAlaAspAlaValGluAlaArgGlnArgLeuGlyGluIle 70
Qy 121 CCTATCGCAGAACCGGCGCCTAGAGGAGATTATGATAGAGATGAATTTGGCTCAGGCTGG 180
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 71 ProIleAlaGluProAlaProArgGlyAspTyrAspArgAspGluPheGlySerGlyTrp 90
Qy 181 ATCGATACGGATGGCAATGGCTGCTCTACGCGTAATGATATTCTTGCACGCGATCTTGAA 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 91 IleAspThrAspGlyAsnGlyCysSerThrArgAsnAspIleLeuAlaArgAspLeuGlu 110
Qy 241 AATGTCCAACTTGCGTCTGATGGCTGCAAAGTGTTGTCTGGAACACTTCATGATCCGTAT 300
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 111 AsnValGlnLeuAlaSerAspGlyCysLysValLeuSerGlyThrLeuHisAspProTyr 130
Qy 301 ACAGGCGCGACGATTGAATTTACATCAGAAAAACCTCAAGCAGTTCAAATCGATCATGTG 360
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 131 ThrGlyAlaThrIleGluPheThrSerGluLysProGlnAlaValGlnIleAspHisVal 150
Qy 361 GTTCCGTTGTCACTTGCGTGGCGCATGGGAGCATCTCGGTGGGATCGTGATACACGGGTC 420
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 151 ValProLeuSerLeuAlaTrpArgMetGlyAlaSerArgTrpAspArgAspThrArgVal 170
Qy 421 GAATTTGCAAATGATCCGGGCAATCTGTTAGCGTCAGATGGCCCGGCGAATAGAGAAAAA 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 171 GluPheAlaAsnAspProGlyAsnLeuLeuAlaSerAspGlyProAlaAsnArgGluLys 190
Qy 481 TCAGATTCTGGACCGGGCGAATGGCAACCTTATGAAGGCTTTCAATGCACATATGCAGTC 540
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 191 SerAspSerGlyProGlyGluTrpGlnProTyrGluGlyPheGlnCysThrTyrAlaVal 210
Qy 541 CTGTATATTGATGTGCTGTATCGCTATGATTTACCGGTGAGCGAACAAGATTATGAAGGA 600
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 211 LeuTyrIleAspValLeuTyrArgTyrAspLeuProValSerGluGlnAspTyrGluGly 230
Qy 601 CTGAGCGCAATGTTGGATACGTGCGCA 627
|||||||||||||||||||||||||||
Db 231 LeuSerAlaMetLeuAspThrCysAla 239
RESULT 2
A0ABY4L089_THEAE
ID A0ABY4L089_THEAE Unreviewed; 239 AA.
AC A0ABY4L089;
DT 08-OCT-2025, integrated into UniProtKB/TrEMBL.
DT 08-OCT-2025, sequence version 1.
DT 08-OCT-2025, entry version 1.
DE SubName: Full=HNH endonuclease {ECO:0000313|EMBL:UPT21090.1};
GN ORFNames=FOF52_09060 {ECO:0000313|EMBL:UPT21090.1};
OS Thermobifida alba (Thermomonospora alba).
OC Bacteria; Bacillati; Actinomycetota; Actinomycetes; Streptosporangiales;
OC Nocardiopsidaceae; Thermobifida.
OX NCBI_TaxID=53522 {ECO:0000313|EMBL:UPT21090.1, ECO:0000313|Proteomes:UP000832041};
RN [1] {ECO:0000313|EMBL:UPT21090.1, ECO:0000313|Proteomes:UP000832041}
RP NUCLEOTIDE SEQUENCE [LARGE SCALE GENOMIC DNA].
RC STRAIN=DSM 43795 {ECO:0000313|EMBL:UPT21090.1,
RC ECO:0000313|Proteomes:UP000832041};
RA Luzics S., Horvath B., Nagy I., Toth A., Nagy I., Kukolya J.;
RT "Thermobifida alba genome sequencing and assembly.";
RL Submitted (APR-2020) to the EMBL/GenBank/DDBJ databases.
CC ---------------------------------------------------------------------------
CC Copyrighted by the UniProt Consortium, see https://www.uniprot.org/terms
CC Distributed under the Creative Commons Attribution (CC BY 4.0) License
CC ---------------------------------------------------------------------------
DR EMBL; CP051627; UPT21090.1; -; Genomic_DNA.
DR Proteomes; UP000832041; Chromosome.
PE 4: Predicted;
KW Endonuclease {ECO:0000313|EMBL:UPT21090.1};
KW Hydrolase {ECO:0000313|EMBL:UPT21090.1};
KW Nuclease {ECO:0000313|EMBL:UPT21090.1};
KW Reference proteome {ECO:0000313|Proteomes:UP000832041}.
SQ SEQUENCE 239 AA; 25713 MW; 3A77B8DDB2C2CDC9 CRC64;
Alignment Scores:
Length: 239
Score: 961.00 Matches: 177
Percent Similarity: 91.4% Conservative: 14
Best Local Similarity: 84.7% Mismatches: 18
Query Match: 86.4% Indels: 0
Gaps: 0
US-18-683-749-1 (1-630) x A0ABY4L089_THEAE (1-239)
Qy 1 TTAGATGATTTGTTAGCGGAACTGGAAGAAATTGAAGCGGATGTGCCTGCGACAGCGGAA 60
|||:::|||:::||| ||||||||||||||||||||| |||:::|||
Db 31 LeuGluAspValLeuAspValLeuGluGluIleGluAlaAspAlaProSerThrGlyAla 50
Qy 61 TCACAAGCACCTGAAGGAGATGCGGATGCAGTCGAAGCACGTCAACGCTTAGGAGAAATC 120
|||:::||| ||||||:::||| |||||||||||||||||| :::
Db 51 ProGlnSerProGlyThrAspAlaGluAlaAlaGluAlaArgGlnArgLeuAspAlaMet 70
Qy 121 CCTATCGCAGAACCGGCGCCTAGAGGAGATTATGATAGAGATGAATTTGGCTCAGGCTGG 180
|||||||||||||||||||||||||||||||||:::||||||||||||||||||||||||
Db 71 ProIleAlaGluProAlaProArgGlyAspTyrGluArgAspGluPheGlySerGlyTrp 90
Qy 181 ATCGATACGGATGGCAATGGCTGCTCTACGCGTAATGATATTCTTGCACGCGATCTTGAA 240
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 91 IleAspThrAspGlyAsnGlyCysSerThrArgAsnAspIleLeuAlaArgAspLeuGlu 110
Qy 241 AATGTCCAACTTGCGTCTGATGGCTGCAAAGTGTTGTCTGGAACACTTCATGATCCGTAT 300
:::|||::: ||| ||||||||||||||||||||||||||||||||||||||||||
Db 111 AspValGluPheAlaProAspGlyCysLysValLeuSerGlyThrLeuHisAspProTyr 130
Qy 301 ACAGGCGCGACGATTGAATTTACATCAGAAAAACCTCAAGCAGTTCAAATCGATCATGTG 360
|||||| ||||||||||||||||||||| |||||||||||||||||||||||||||
Db 131 ThrGlyLysThrIleGluPheThrSerGluAspProGlnAlaValGlnIleAspHisVal 150
Qy 361 GTTCCGTTGTCACTTGCGTGGCGCATGGGAGCATCTCGGTGGGATCGTGATACACGGGTC 420
||||||||||||||||||||||||||||||||| |||||||||||||||||||||
Db 151 ValProLeuSerLeuAlaTrpArgMetGlyAlaAspGlyTrpAspArgAspThrArgVal 170
Qy 421 GAATTTGCAAATGATCCGGGCAATCTGTTAGCGTCAGATGGCCCGGCGAATAGAGAAAAA 480
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 171 GluPheAlaAsnAspProGlyAsnLeuLeuAlaSerAspGlyProAlaAsnArgGluLys 190
Qy 481 TCAGATTCTGGACCGGGCGAATGGCAACCTTATGAAGGCTTTCAATGCACATATGCAGTC 540
||||||||||||||||||||||||||||||:::|||||||||||||||||||||||||||
Db 191 SerAspSerGlyProGlyGluTrpGlnProHisGluGlyPheGlnCysThrTyrAlaVal 210
Qy 541 CTGTATATTGATGTGCTGTATCGCTATGATTTACCGGTGAGCGAACAAGATTATGAAGGA 600
:::|||||||||||||||||||||||||||||||||||||||:::||||||::::::|||
Db 211 IleTyrIleAspValLeuTyrArgTyrAspLeuProValSerAspGlnAspHisLysGly 230
Qy 601 CTGAGCGCAATGTTGGATACGTGCGCA 627
|||||| ||||||||||||||||||
Db 231 LeuSerThrMetLeuAspThrCysAla 239
Conclusion
17. No claims are presently allowable.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to HOPE A ROBINSON whose telephone number is (571) 272-0957. The examiner can normally be reached 9-5pm on Monday to Friday.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Robert Mondesi can be reached on (408) 918-7584. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/HOPE A ROBINSON/Primary Examiner, Art Unit 1652