Prosecution Insights
Last updated: September 17, 2026
Application No. 18/684,059

Oligonucleotides for Modulating Synaptogyrin-3 Expression

Non-Final OA §101§102§103§112§DP
Filed
Feb 15, 2024
Priority
Aug 16, 2021 — EU 21191496.5 +1 more
Examiner
KONOPKA, CATHERINE ANNE
Art Unit
Tech Center
Assignee
Jay Therapeutics
OA Round
1 (Non-Final)
59%
Grant Probability
Moderate
1-2
OA Rounds
1y 2m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allowance Rate
118 granted / 201 resolved
-1.3% vs TC avg
Strong +65% interview lift
Without
With
+64.6%
Interview Lift
resolved cases with interview
Typical timeline
3y 10m
Avg Prosecution
72 currently pending
Career history
259
Total Applications
across all art units

Statute-Specific Performance

§101
5.1%
-34.9% vs TC avg
§103
32.6%
-7.4% vs TC avg
§102
13.8%
-26.2% vs TC avg
§112
30.4%
-9.6% vs TC avg
Black line = Tech Center average estimate • Based on career data from 201 resolved cases

Office Action

§101 §102 §103 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Application Status The preliminary amendment filed February 15, 2024 is acknowledged. Claims 1-10 and 12-15 are pending and under examination. Priority Acknowledgment is made of applicant' s claim for foreign priority under 35 U.S.C. 119 (a)-(d). However, the disclosure of the foreign Application No EP 21191496.5 fails to provide adequate support or enablement in the manner provided by 35 U.S.C. 112(a) for one or more claims of this application. The application fails to provide support for the claims under examination, since there is no disclosure therein of sequences or short oligonucleotides having complementary to SEQ ID NO 3 (i.e., human SYNGR-3. The first evidence of support for the human SYNGR-3 and oligonucleotides with complementary to SEQ ID NO 3 is in the PCT application PCT/EP2022/072878, filed August 16, 2022. As such, the effective filing date for all pending claims is August 16, 2022. Drawings The drawings are objected to because: First, the drawings are objected to because they were submitted in color, but there is no granted petition to accept color drawings. See 37 CFR 1.84(a)(2) (“The Office will accept color drawings in utility patent applications only after granting a petition filed under this paragraph explaining why the color drawings are necessary”). Applicants must either provide that explanation via a petition and comply with all requirements of 37 CFR 1.84(a)(2)(i)-(iii) OR submit replacement sheets in black and white and include a clear instruction to replace the color drawings with the replacement sheets. The examiner takes no position on whether color drawings are necessary as the only practical medium by which to disclose the subject matter sought to be patented in this utility patent application. Second, the drawings are objected to because the figures are referred to as “Figure” in the drawings. MPEP §608.02.V states that according to 37 C.F.R. 1.84(u)(1) “View numbers must be preceded by the abbreviation "FIG.". Corrected drawing sheets in compliance with 37 CFR 1.121(d) are required in reply to the Office action to avoid abandonment of the application. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. The figure or figure number of an amended drawing should not be labeled as “amended.” If a drawing figure is to be canceled, the appropriate figure must be removed from the replacement sheet, and where necessary, the remaining figures must be renumbered and appropriate changes made to the brief description of the several views of the drawings for consistency. Additional replacement sheets may be necessary to show the renumbering of the remaining figures. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Specification The use of the terms FuGENE, Opti-MEM, QuantStudio, and Dharmafect, which are trade names or marks used in commerce, has been noted in this application. The term should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Rejections - 35 USC § 112(d) The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claims 3-4 are rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Claim 3 recites “The oligonucleotide of claim 1, wherein the region is selected from… SEQ ID NOs. 115-121.” Claim 1 recites “An oligonucleotide… [comprising] a contiguous nucleotide sequence of at least 10 nucleotides in length that is at least 90% complementary to a region… set forth in SEQ ID NO. 1 or SEQ ID NO. 3 and where the region is comprised within a sequence set forth in SEQ ID NO. 38-54 or SEQ ID No. 69-79.” Two of the region options in claim 3, SEQ ID NOs 120 and 121, are not wholly contained within any of the regions recited in claim 1. SEQ ID NOs 120 and 121 overlap with SEQ ID NO 79, but extend two nucleotides further. Therefore, claim 3 allows an additional two nucleotides to the region of complementarity than claim 1. As a result, claim 3 does not encompass all the limitations of claim 1 from which it depends. Claim 4 also depends from claim 1 and also recites “a region selected from… SEQ ID NOs. 115-121”. Claim 4 does not encompass all the limitations of claim 1 from which it depends for the reasons outlined for claim 3 above. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1-4, 7 and 10 are rejected under 35 U.S.C. 101 because the claimed invention is directed to a judicial exception (i.e., a law of nature, a natural phenomenon, or an abstract idea) without significantly more. The claims are drawn to oligonucleotides. However, the claims do not include elements, when considered separately and in combination, that are sufficient to amount to significantly more than the judicial exceptions as outlined below. Subject Matter Eligibility Test for Products and Processes – Claims 1 and 2 Step 1 - Is the Claim to a Process, Machine, Manufacture or Composition of Matter? YES Claims 1 and 2 are directed to an oligonucleotide. Thus, the claims are directed to a statutory category (e.g., a product). Step 2A, Prong One - Does the Claim Recite a Judicial Exception? YES Judicial Exceptions have been identified by the courts by way of example, including natural phenomena, mental processes and natural correlations. The claims recite 1 judicial exception – an oligonucleotide, which is a natural product. For natural products, products that are not “markedly different” than their naturally occurring counterpart are judicial exceptions. See MPEP 2016.04((b). MPEP 2106.04(c) outlines the markedly different analysis. The claims recite an oligonucleotide comprising a contiguous sequence of at least 10 [or 15] nucleotides in length that is at least 90% complementary to a region of equal length of SYNGR-3 with SEQ ID NOs 1 or 3, specifically the region comprised within a sequence set for in SEQ ID NOs 38-54 and 69-79. The Specification defines “oligonucleotide” as a “molecule formed by covalent linkage of two or more nucleotides” (page 16) and does not limit oligonucleotide to just RNA. Thus, claims 1 and 2 encompass a piece of DNA or RNA (i.e., an oligonucleotide) that is at least 10 nucleotides long and is complementary to one of SEQ ID NOs 38-54 or 69-79. SEQ ID NO 38 is in the coding strand of the SYNGR-3 gene from mouse. (NC_000083.7, Mus musculus strain C57BL/6J chromosome 17, GRCm39, positions 178-193). An oligonucleotide that is 100% complementary to the SEQ ID NO 38 would be found on the non-coding DNA strand of the mouse SYNGR-3. Therefore, the closest naturally occurring counterpart to the claimed oligonucleotide is the non-coding strand of the SYNGR-3 mouse gene. Although the claims require 10-50 nucleotides, this limitation does not make the claimed oligonucleotide markedly different than the mouse chromosomal DNA. The courts have identified “isolated DNA” and “primers” as one such natural product that may not be markedly different from their counterpart, DNA in cells. Thus, the claimed oligonucleotide is not markedly different than its naturally occurring counterpart and constitutes a judicial exception. Step 2A, Prong Two - Does the Claim Recite an Additional Elements that Integrate the Judicial Exception into a Practical Application? NO The Supreme Court has long distinguished between principles themselves, which are not patent eligible, and the integration of those principles into practical applications, which are patent eligible. The phrase "integration into a practical application" requires an additional element or a combination of additional elements in the claim to apply, rely on, or use the judicial exception in a manner that imposes a meaningful limit on the judicial exception, such that it is more than a drafting effort designed to monopolize the exception. In this case, claims 1 and 2 do not recite additional elements other than the oligonucleotide. Step 2B - Does the Claim Recite Additional Elements that Amount to Significantly More than the Judicial Exception? NO The Supreme Court has identified a number of considerations for determining whether a claim with additional elements amounts to "significantly more" than the judicial exception(s) itself. The claim as a whole is evaluated as to whether it amounts to significantly more than the recited exception, i.e., whether any additional element, or combination of additional elements, adds an inventive concept to the claim (MPEP 2106.05). However, the additional elements, individually and in combination, do not amount to "significantly more" because claims 1 and 2 do not recite additional elements other than the oligonucleotide. Subject Matter Eligibility Test for Products and Processes – Dependent Claims Claims 3 and 4 do not include other elements of the oligonucleotide than what is found on the mouse SYNGR-3 DNA noncoding strand. As such claims 3-4 are not integrated into a practical application or amount to significantly more than the judicial exception. Claim 7 encompasses oligonucleotides that are “single stranded antisense oligonucleotides”. The Specification does not limit antisense oligonucleotides to RNA, and thus also encompass DNA. As mentioned above for claims 1-2, the courts have identified “isolated DNA” and “primers” as one such natural product that may not be markedly different from their counterpart, DNA in cells. Therefore “single-stranded” does not sufficiently distinguish the claimed oligonucleotides from the mouse SYNGR-3 DNA noncoding strand. Additionally, claim 7 does not recite additional elements that integrate the oligonucleotide into a practical application or amount to significantly more than the judicial exception. Claim 10 recites the oligonucleotide is in a pharmaceutical composition. DNA naturally occurs in cells, which is encompassed by a “pharmaceutical composition”. Thus, the closest naturally occurring counterpart to the claimed oligonucleotide is the mouse cell comprising the mouse SYNGR-3 DNA noncoding strand. The claimed oligonucleotide in a pharmaceutical composition is not markedly different than a mouse cell. Claim 10 does not recite additional elements that integrate the oligonucleotide in the pharmaceutical composition into a practical application or amount to significantly more than the judicial exception. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1-7, 10, and 12-13 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Khvorova (US 20220348918 A1, effectively filed March 29, 2021). Regarding claims 1, 2, 4 and 7, Khvorova teaches SYNGR-3 targeting oligonucleotides (Abstract). Khvorova teaches an siRNA (i.e., an oligonucleotide) with SEQ ID NO 180, and modified version SEQ ID NO 276 (Tables 11 and 14, SYNRG3_621). As shown below, Khvorova’s SEQ ID NOs 180 and 276 have 21 nucleotides (i.e., 10-50 nucleotides in length) with 18 nucleotides (i.e., at least 10, at least 15 nucleotides) that are 100% complementary to SEQ ID NO 1 in a region comprised within SEQ ID NO: 47. Thus, Khvorova’s siRNAs anticipated the claimed oligonucleotide. SEQ 1 (nts 3465-3498): gcttcttctccatcctcagctgggtgagtgaggg SEQ 47: TTCTCCATCCTCAGCTG Khvo 132 (sense): CCAUCCUCAGCUGGGA Khvo 180/276 (antisense): 3’-UAAGAGGUAGGAGUCGACCCU Regarding claim 3, Khvorova also teaches an siRNA with SEQ ID NO 183, and modified version SEQ ID NO 279 (Tables 11 and 14, SYNRG3_653). As shown below, Khvorova’s SEQ ID NOs 183 and 279 have 21 nucleotides (i.e., 10-50 nucleotides in length) with 19 nucleotides (i.e., at least 10, at least 15 nucleotides) that are 100% complementary to SEQ ID NO 3 in a region comprised within SEQ ID NO: 79. Thus, Khvorova’s siRNAs anticipated the claimed oligonucleotide. SEQ 3: accccgccccgcgcaggtggcgctcaccgtgaaggccctgcagcggttccgcctggg SEQ 79: ACCCCGCCCCGCGCAGGTGGCGCTCACCGTGAAGGCCCTGCAGCGGTTC Khvo 135: GCCCUGCAGCGGUUCA Khvo 183/279: (antisense) 3’-UCUUCCGGGACGUCGCCAAGU Regarding claims 5-6, Khvorova teaches the SEQ ID NO 276 has at least one phosphorothioate linkage (Table 14, # symbol), 2’-O-Methyl and 2’-F modified sugars (Table 14, m and f symbols). Regarding claim 10, Khvorova teaches delivering the siRNA with SEQ ID NO 276 to human SHSY5 cells and mouse N2A cells (i.e., the siRNA was in a pharmaceutical composition) ([0614]). Additionally, Khvorova teaches siRNAs in lipid nanoparticle formulations (i.e., in pharmaceutical compositions ([0606]). Regarding claims 12-13, Khvorova teaches the SYNGR3_621 (i.e., the siRNA with SEQ ID NO 276) reduces SYNGR3 by 40% (FIG. 2A). Khvorova teaches administering RNA agents of the invention (i.e., an siRNA with SEQ ID NO 276) for the purpose of reducing clinical manifestations (i.e., treating a symptom of) a neurodegenerative such as Alzheimer’s disease (AD) (i.e., a tauopathic disorder) ([0591]-[0592]). Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 8-9 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova (US 20220348918 A1, effectively filed March 29, 2021) as applied to claims 1-7, 10, and 12-13 above, and further in view of Roberts (Roberts et al., Nature Reviews Drug Discovery (2020), 19: 673-694). The teachings of Khvorova are recited above as for claims 1-7, 10 and 12-13 and are incorporated here. Khvorova also teaches RNA silencing agents include siRNAs and gapmer molecules ([0233]). Khvorova does not teaches the structure of gapmers or an oligonucleotide having a gapmer structure that targets the claimed regions. Roberts teaches RNAse-H competent antisense oligonucleotides (ASOs) called “gapmers” have a central DNA-based “gap” surrounded by chemically modified RNA-based flanking regions (page 674, ¶2). Roberts teaches two different gapmers having FDA approval, each of which has a central 10 DNA nucleotides and flanked on the 5’ and 3’ side with five 2’-O-methoxyethyl RNA nucleotides (i.e., formula 5’-F-G-F’-3’, with F and F’ each having five 2’-sugar modified nucleotides, and G having 10 nucleosides and recruits RNaseH) (Fig 1b-c). Roberts teaches the internucleotide linkages of the FDA-approved gapmers are phosphorothioate linkages (Fig 1b-c). Roberts teaches that ASO gapmers developed for treating AD are currently in clinical trials (page 675, ¶4; Table 2). Regarding claims 8-9, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have designed a gapmer ASO (i.e., the claimed oligonucleotide structure in claims 8-9) that targets the SYNGR-3 mRNA sequences disclosed in Khvorova. It would have amounted to designing known SYNGR-3 sequences with known gapmer structures by known means to yield predictable results. The skilled artisan would have predicted a gapmer ASO could be designed and made that targets a sequence in SEQ ID NO 47 or 79, and been motivated to have done so, because 1) Khvorova suggests using RNA silencing oligonucleotides with gapmer structure, and 2) Roberts teaches gapmers can be designed to treat Alzheimer’s disease, and 3) and SYNGR-3 has been implicated in AD. Claims 14-15 are rejected under 35 U.S.C. 103 as being unpatentable over Khvorova (US 20220348918 A1, effectively filed March 29, 2021) as applied to claims 1-7, 10, and 12-13 above, and further in view of Verstreken (US 20200216531 A1, published May 17, 2020). The teachings of Khvorova are recited above as for claims 1-7, 10 and 12-13 and are incorporated here. Khvorova does not teach which neurodegenerative symptoms that can be treated using the siRNA oligonucleotides. Verstreken teaches synaptogyrin-3 inhibitors for treating or inhibiting progression of tauopathies or symptoms of tauopathies (Abstract). Verstreken teaches synaptogyrin-3 inhibitors includes antisense oligonucleotides, gapmers and siRNAs ([0058]). Verstreken teaches symptoms of tauopathic disorders, including pre-synaptic dysfunction, can be treated using synaptogyrin-3 inhibitors ([0074], [0076]). Verstreken teaches knocking down expression of synaptogyrin-3 with shRNA rescued mobility of synaptic vesicles at pre-synaptic membranes (i.e., treated pre-synaptic dysfunction) ([0168]). Regarding claims 14-15, it would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have use Khvorova’s siRNA and treatment methods to specifically treat pre-synaptic disfunction. It would have amounted to treating a known symptom of tauopathies specifically caused by synaptogyrin-3 using known siRNAs by known means to yield predictable results. The skilled artisan reading Khvorova would have been motivated to learn the pathogenic mechanism of synaptogyrin-3 and its role in neurodegeneration, and Verstreken would have provided that mechanism. It would have been entirely predictable that Khvorova’s siRNA would have reduced presynaptic disfunction upon knockdown of synaptogyrin-3 because Verstreken teaches using a SYNGR-3-targeted shRNA, an analogous means to knockdown synaptogyrin-3 levels, reduced pre-synaptic dysfunction. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 1-10 and 12-15 are rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-8 of U.S. Patent No. 11,332,526 in view of Khvorova (US 20220348918 A1, effectively filed March 29, 2021). Claims 8-9 are rejected further in view of Roberts (Roberts et al., Nature Reviews Drug Discovery (2020), 19: 673-694). Patented claim 1 recites A method of inhibiting synaptogyrin-3 expression in a subject, the method comprising… treating the subject with a synaptogyrin-3 inhibitor selected from the group consisting of an antisense oligonucleotide, a gapmer, an siRNA, a shRNA, a CRISPR gRNA, and a nucleic acid encoding any one of the foregoing. Patented claim 2 recites wherein the synaptogyrin-3 inhibited by the synaptogyrin-3 inhibitor is human synaptogyrin-3. Patented claim 3 recites wherein the subject suffers from a disorder selected from the group consisting of Alzheimer's disease. Patented claims 4-5 recites wherein the subject suffers from… synaptic dysfunction, including pre-synaptic dysfunction. The patented claims do not recite specific target sequences for the siRNAs or gapmers, or nucleotide modifications. The patented claims do not recite specific structures for gapmers (claims 8-9). The teachings of Khvorova are recited above in paragraph 26-30 and 34 and are incorporated here. Briefly, Khvorova teaches two modified siRNAs that target a region within SEQ ID NOs 47 and 79. It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have used Khvorova’s siRNA targeting SEQ ID NO 47 or 79 with known stabilizing modifications. It would have amounted to using a known siRNA targeting sequence in the patented method to yield predictable results. The skilled artisan would have predicted that an siRNA targeting SEQ ID NO 47 or 79 could have been designed and tested because Khvorova demonstrates designing a plethora of SYNGR-3 targeting siRNAs and testing each one in cell culture. The skilled artisan would have been motivated to test the siRNAs in vivo because Khvorova teaches the siRNAs could be screened for treatments for AD. Regarding claims 8-9, the teachings of Roberts are recited above in paragraph 36 and are incorporated here. It would have been obvious to one skilled in the art before the effective filing date of the claimed invention to have designed the patented gapmer ASO targeting the SYNGR-3 mRNA sequences disclosed in Khvorova with the structure provided in Roberts. It would have amounted to designing known SYNGR-3 sequences with known gapmer structures by known means to yield predictable results. The skilled artisan would have predicted a gapmer ASO could be designed and made that targets a sequence in SEQ ID NO 47 or 79, and been motivated to have done so, because Roberts teaches gapmers with the claimed structure can be designed to treat Alzheimer’s disease. Conclusion No claims are allowable. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CATHERINE KONOPKA whose telephone number is (571)272-0330. The examiner can normally be reached Mon - Fri 7- 4. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Ram Shukla can be reached at (571)272-0735. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /CATHERINE KONOPKA/Primary Examiner, Art Unit 1635
Read full office action

Prosecution Timeline

Feb 15, 2024
Application Filed
Jun 25, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12723277
LINKED TARGET CAPTURE
4y 9m to grant Granted Sep 01, 2026
Patent 12698477
METHODS OF PRECONDITIONING VASCULAR CELLS FOR TRANSDUCTION, METHODS OF TRANSDUCTION AND METHODS OF PRESERVING TRANSDUCED CELLS
4y 8m to grant Granted Aug 04, 2026
Patent 12698504
Methods for Making and Using Genomically Recoded Cells
3y 2m to grant Granted Aug 04, 2026
Patent 12686865
COMPOSITIONS AND METHODS OF NUCLEIC ACID-TARGETING NUCLEIC ACIDS
4y 11m to grant Granted Jul 21, 2026
Patent 12678517
MIRI26-5P FOR TREATING MOTOR NEURON DISEASES
5y 8m to grant Granted Jul 14, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+64.6%)
3y 10m (~1y 2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 201 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month