Prosecution Insights
Last updated: September 17, 2026
Application No. 18/685,648

TARGETED INTEGRATION AT BETA-GLOBIN LOCUS IN HUMAN HEMATOPOIETIC STEM AND PROGENITOR CELLS

Non-Final OA §103§112
Filed
Feb 22, 2024
Priority
Aug 23, 2021 — provisional 63/236,178 +1 more
Examiner
DACE DENITO, ALEXANDRA GERALDINE
Art Unit
Tech Center
Assignee
The J David Glastone Institutes Atestamentary Trust Established Under The Will Of J David Gladstone
OA Round
1 (Non-Final)
57%
Grant Probability
Moderate
1-2
OA Rounds
1y 0m
Est. Remaining
96%
With Interview

Examiner Intelligence

Grants 57% of resolved cases
57%
Career Allowance Rate
36 granted / 63 resolved
-2.9% vs TC avg
Strong +39% interview lift
Without
With
+39.1%
Interview Lift
resolved cases with interview
Typical timeline
3y 7m
Avg Prosecution
38 currently pending
Career history
109
Total Applications
across all art units

Statute-Specific Performance

§101
5.1%
-34.9% vs TC avg
§103
39.9%
-0.1% vs TC avg
§102
15.5%
-24.5% vs TC avg
§112
27.7%
-12.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 63 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Applicant’s claim to priority from Provisional Application No. 63/236,178 filed 08/23/2021 and from International Application No. PCT/US2022/075313 filed 08/23/2022 is hereby acknowledged. Application Status This Application is a National Stage entry under 35 U.S.C. § 371 of International Application No. PCT/US2022/075313 filed 08/23/2022. This Office Action is in response to communication filed 08/27/2025. Amendments to claims filed 08/27/2025 are hereby acknowledged. Claims 2-3, 5, 12, 14, 21, 23, 25, 27-32 and 35-40 are cancelled. Therefore, claims 1, 4, 6-11, 13, 15-20, 22, 24, 26, and 33-34 are pending and under consideration in this Office Action. Information Disclosure Statement The information disclosure statement (IDS) submitted on 03/04/2025 is hereby acknowledged. The submission is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. However, the listing of references in the specification is not a proper information disclosure statement. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892 or listed on a submitted IDS, they have not been considered. Drawings Examiner noticed that the Drawings filed 02/22/2024 in the Supplemental file are in color. Color photographs and color drawings are not accepted in utility applications unless a petition filed under 37 CFR 1.84(a)(2) is granted. Any such petition must be accompanied by the appropriate fee set forth in 37 CFR 1.17(h), one set of color drawings or color photographs, as appropriate, if submitted via the USPTO patent electronic filing system or three sets of color drawings or color photographs, as appropriate, if not submitted via the via USPTO patent electronic filing system, and, unless already present, an amendment to include the following language as the first paragraph of the brief description of the drawings section of the specification: The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee. Color photographs will be accepted if the conditions for accepting color drawings and black and white photographs have been satisfied. See 37 CFR 1.84(b)(2). Specification The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code ( see [0079]). Applicant is required to delete the embedded hyperlink and/or other form of browser-executable code; references to websites should be limited to the top-level domain name without any prefix such as http:// or other browser-executable code. See MPEP § 608.01. The use of the terms “Gibson Assembly”, “AAVPro” ([0125]), “4D Nucleofector” ([0127]), “Ghost Dye”, “FlowJo” ([0128]), which are trade names or marks used in commerce, has been noted in this application. The terms should be accompanied by the generic terminology; furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term. Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks. Claim Rejections - 35 USC § 112(d) The following is a quotation of 35 U.S.C. §112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. §112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 33 is rejected under 35 U.S.C. §112(d) or pre-AIA 35 U.S.C. §112, 4th paragraph, as being of improper dependent form for failing to further limit the subject matter of the claim upon which it depends, or for failing to include all the limitations of the claim upon which it depends. Regarding claim 33, it depends on claim 1, however, it does not add a subsequent step to the method of claim 1. Claim 33 is drawn to an end-result; the language of the claim does not make clear the presence of an active step that further limits the method. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1, 7, 9, 13, 15, 17, 19-20, 22, 24, 26 and 33-34 are rejected under 35 U.S.C. § 103 as being unpatentable over Amendola (Amendola, M. et al. US 2020/0377857 A1; published December 3, 2020) in view of Al-Hasani (Al-Hasani, K. et al. “Complementation of α-thalassaemia in α-globin knockout mice with a 191 kb transgene containing the human α-globin locus”. Transgenic Research, Vol. 13 (2004), pp: 235-243), Hanscombe (Hanscombe, O. et al. “High-level, erythroid-specific expression of the human α-globin gene in transgenic mice and the production of human hemoglobin in murine erythrocytes”. Genes & Development, Vol. 3 (1989), pp: 1572-1581), Bak (Bak, R.O. et al. “CRISPR-mediated integration of large gene cassettes using AAV donor vectors”. Cell Reports, Vol. 20 (2017), pp: 750-756) and Miliotou (Miliotou, A.N. et al. “PTD-mediated delivery of α-globin chain into K-562 erythroleukemia cells and α-thalassemic (HBH) patients’ RBCs ex vivo in the frame of Protein Replacement Therapy”. Journal of Biological Research-Thessaloniki, Vol. 28 (July 2021), p: 16(1-13)). Regarding claim 1, Amendola teaches genetically modifying hematopoietic stem cells in one globin gene at the genomic level by placing a therapeutic transgene under the control of the endogenous promoter of said globin gene (see title and abstract). Amendola teaches using the genetically modified cells in a pharmaceutical composition as a medicament in the treatment of a disease caused by the lack of a protein or by the presence of an aberrant non-functional one in an individual in need thereof (see [0045]-[0048]). Amendola teaches that the stem cells and progenitor cells may be mobilized from the bone marrow into the peripheral blood, isolated from the subject, purified using techniques known in the art, then modified genetically in a globin gene ( [0133]-[0136]). Therefore, Amendola teaches modifying genetically primary cells in culture (see [0071], [0356], [0377]). Amendola teaches that the globin gene can be HBB gene and using plasmid expressing a guide RNA (gRNA) specific for targeting HBB gene (see [0055], [0087]-[0089]). Amendola teaches the use of a CRISPR/Cas9 system (see [0043]). Amendola teaches the targeting intron of the globin gene; Amendola teaches that the intron targeted can be the first or the second intron ( [0019]). Amendola teaches donor template that comprise the transgene for targeted integration in said globin gene ( [0064]). Amendola teaches that adding homology arms to the donor DNA trap dramatically increases its target integration efficiency ([0070]-[0071], [0354], [0360]). Amendola teaches that the homology arms for the 5’UTR gRNA target site are about 250 bp on each side of the transgene, i.e. in 5’ and 3’ of the transgene ([0356]). Amendola teaches using AAV vectors for delivery of constructs to the cells ( [0007]-[0008], [0357], [0360]). Amendola does not teach using an α-globin encoding transgene. However, Al-Hasani teaches that in models for α-thalassemia, i.e., α-globin gene knockout mice, complementation using a 191 kb transgene containing the human α-globin locus restores α-globin gene expression and hemoglobin levels to normal levels (see title and abstract). Therefore, Al-Hasani teaches treating a subject with α-thalassemia using a transgene comprising α-globin gene. Al-Hasani teaches using the whole locus comprising the α-globin gene together with about 100 kb of sequence upstream of DNase I hypersensitive site HS-40 and 30 kb downstream of α1-globin gene using a BAC clone and microinjection in fertilized oocytes (see abstract; Figure 1). Therefore, Al-Hasani teaches that using α-globin gene can revert α-thalassemia, therefore gene therapy is possible. However, a large 191 kb transgene encompassing the whole α-globin locus might be difficult to handle. Indeed, Hanscombe teaches that gene expression is difficult in transgenic mice using fragments of human α-globin gene (see page 1573, left column, first paragraph, lines 7-10). Hanscombe also teaches that targeting an erythroid-specific site is possible when targeting the DNase I hypersensitive sites that border the human β-globin (page 1572, right column, last paragraph). Hanscombe teaches that using both the human α- and human β-globin dominant control region (DCR) can give rise to a transgenic mouse expressing more human hemoglobin, when using a shorter construct with a 7-kb fragment encompassing the human α1-globin gene (page 1573, left column, first paragraph, last 7 lines; Figure 1). Therefore, this suggests that targeting an endogenous β-globin gene locus for insertion is feasible and convenient to obtain a high and an erythroid lineage-specific expression of a α-globin transgene in the absence of endogenous functional α-globin alleles. Bak also teaches that there are limitations to the size of a transgene specifically to modify the genome of primary cells in culture (see abstract). Bak teaches adeno-associated viral vectors are used for gene therapy because they can transduce both dividing and non-dividing cells effectively as donor vectors for homologous recombination both in vitro and in vivo (see page 750, left column, “Introduction” section, second paragraph). Bak teaches that the maximum payload/transgene size for packaging in AAV vectors is about 4.5 kb, which limits gene therapy for genes that can be as long as 11kb, e.g. DMD, dystrophin gene (page 750, left column, first paragraph). Bak teaches that, using primary T cells, i.e., cells isolated directly from subjects, it is possible to use the CRISPR/Cas9 system, AAV vectors and a transgene of a total of 6.5kb using sequential homologous recombination (figure 1). Although 6.5 kb is still limiting, Hanscombe’s and Bak’s teachings suggest using targeted insertion within an endogenous β-globin locus to benefit from the dominant control region of the β-globin locus and using shorter constructs comprising a 7-kb fragment of the α-globin gene. Miliotou teaches that using other means of therapy such as the Protein Transduction Domain (PTD)- mediated delivery of α-globin chain into cells in culture or subject’s cells ex vivo for protein replacement therapy may be effective (see title and abstract). Miliotou teaches that thalassemia intermedia Hemoglobin H (HbH) disease is caused by an absence or diminished synthesis of the α-globin chain of the hemoglobin molecule leading to β-globin proteins in excess, forming aggregates (see page 1 of 13, Abstract). Miliotou teaches the potential dissociation of harmful β4-globin tetramers aggregates and reduction of their harmful effect is a therapeutic perspective, leading to a smoother disease phenotype, preventing hemolysis and ineffective erythropoiesis (see page 11 of 13, right column, second and third paragraphs). Miliotou teaches using α-globin gene coding sequence in plasmids used to transform bacteria for protein expression (see figure 1) and expression/purification of recombinant α-globin proteins from bacteria (see page 4 of 13, “Results” section, “Cloning strategy and production of recombinant fusion proteins” subsection). Miliotou teaches that bone marrow or peripheral RBCs derived from four individual thalassemia intermedia Hemoglobin H (HbH) patients were successfully incubated with the bacterial extract comprising the recombinant α-globin proteins (see page 8 of 13, right column, second paragraph). Lysing the transduced cells, Miliotou shows that α-globin dimers can be detected (see page 8 of 13, right column, last paragraph). Miliotou teaches a reduction of the harmful HbH-IBs (thalassemia intermedia Hemoglobin H-inclusion bodies, i.e., β4- globin chain tetramers aggregates), when using the obtained recombinant α-globin proteins to transduce red blood cells (RBCs) from α-thalassemic patients (see page 9 of 13, left column; page 1, Abstract’s “Results” section). However, Miliotou teaches that there are limitations to this strategy: the reduction of harmful HbH-IBs varies among patients from 7.65% in Patient 1 to 23.77% in Patient 2 (the highest reduction) (see page 9 of 13, right column, first paragraph). Miliotou teaches that due to the heterogeneity of the molecular basis of α-thalassemia (deletions or point mutations in the α-globin genes), there is a remarkable clinical variation among α-thalassemic patients (page 11 of 13, right column, first paragraph). Miliotou suggests a more pharmacogenomic approach to treating α-thalassemia (see page 11 of 13, right column, second paragraph). Examiner interprets this suggestion as an invitation to try a personalized medicine approach tailoring pharmaceutical composition to the genetic profile of a patient. Therefore, it would be obvious to one of ordinary skills in the art to try adopting a more personalized medicine approach such as gene therapy. It would have been obvious to one with ordinary skills before the effective filing date of the claimed invention to have considered and modified the method of treating a disease of interest taught by Amendola, using HBB gene as a locus for targeting and an α-globin coding sequence as a therapeutic nucleic acid/transgene as taught by Al-Hasani, Hanscombe and Miliotou. One with ordinary skills in the art could have tried and cloned the α-globin coding sequence in a transgene capable of targeting the HBB gene for homologous recombination so that the α-globin gene would be located downstream of dominant control region of the HBB gene after integration, as taught by Hanscombe. One with ordinary skills in the art motivated in using gene editing approaches using CRISPR/Cas9 system and an AAV vector, as taught by Amendola and Bak, for genetically modifying primary hematopoietic stem cells isolated from patients as taught by Amendola, could have cloned a short α-globin gene sequence flanked between homology arms targeting the HBB gene intronic sequences, with a reasonable expectation of success, and would have arrived at the claimed invention. Regarding claims 7 and 9, Amendola teaches intronic sequence of the HBB gene in intron 1 or in intron 2 ( see [0019]). Therefore, the combination of references teaches the elements of claims 7 and 9. The obviousness of combining the references Amendola, Al-Hasani, Hanscombe, Bak and Miliotou is described above. Regarding claim 13, Amendola teaches the use of a CRISPR/Cas9 system for globin gene editing ( see [0043]). Therefore, the combination of references teaches the element of claim 13. The obviousness of combining the references Amendola, Al-Hasani, Hanscombe, Bak and Miliotou is described above. Regarding claims 15 and 17, Amendola teaches the insertion of a therapeutic nucleic acid of interest in a globin gene to genetically modify hematopoietic stem cells (see [0100]) and administering the cells to an individual in need thereof for the long-term correction of disease of interest ([0103]). Al-Hasani teaches using a 191 kb transgene encompassing α1 and α2 genes (see Figure 1). Hanscombe teaches a shorter fragment of the locus that seems to contain all α-globin genes (see Figure 1). Miliotou reminds that α-thalassemia is caused by mainly deletions among the four α-globin genes, and/or point mutations of α-globin genes (HBA1 and HBA2) (see page 2 of 13, left column, last paragraph). Miliotou also teaches using the coding sequence (CDS) of human hemoglobin, alpha 1 (HBA1) mRNA (see page 2, right column, “Construction of recombinant vectors” section). Therefore, the combination of references Amendola, Al-Hasani, Hanscombe, Bak and Miliotou teaches the sequence of the gene HBA1. The obviousness of combining the references is described above. Regarding claim 17, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have substituted the HBA1 gene sequence taught by Miliotou in the method of genetically modifying hematopoietic stem cells for treating a disease of interest taught by Amendola modified with Al-Hasani, Hanscombe, Bak and Miliotou, with a HBA2 sequence. One with ordinary skills in the art motivated in treating a subject presenting with specific deletions/mutations within the HBA2 gene sequence specifically, would have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention. Regarding claims 19, 20 and 24, Amendola teaches that in a cell as described, the transgene of interest comprised in the globin gene of a cell, can be comprised in the 5’ region, in an exon, in an intron, and/or in the 3’UTR of the said globin gene, in the proximal promoter region, in the 5’UTR in an exon and/or in an intron of said globin gene (see [0019], [0035], [0044], [0146]-[0152]; claims 1-3). Therefore, the combination of references Amendola, Al-Hasani, Hanscombe, Bak and Miliotou teaches the elements of claims 19-20 and 24. The obviousness of combining the references is described above. Regarding claims 22 and 26, Al-Hasani teaches using a 191 kb transgene encompassing α1 and α2 genes, which comprises 30 Kb downstream of the human α-globin locus, i.e. cis-acting regulatory elements very likely included, 5’ and 3’ UTRs (see Figure 1; page 238, right column, “Results” section, “Generation of transgenic mice” subsection). Hanscombe teaches a shorter fragment of the locus that seems to contain all α-globin genes, as well as their 5’ and 3’UTRs (see Figure 1). It would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have substituted the HBA1 gene sequence taught by Miliotou in the method of genetically modifying hematopoietic stem cells for treating a disease of interest taught by Amendola modified with Al-Hasani, Hanscombe, Bak and Miliotou, with a transgene as taught by Hanscombe comprising untranslated regions of HBA1 and HBA2 genes. One with ordinary skills in the art motivated in treating subjects presenting with specific deletions/mutations within the untranslated regions within HBA1 and/or HBA2 gene, would have performed these modifications with a reasonable expectation of success and would have arrived at the claimed invention. Regarding claim 33, Al-Hasani teaches treating a subject with α-thalassemia using an α-globin gene comprising transgene and restoring normal hemoglobin levels and other hematologic parameters in the subject (see Abstract). Al-Hasani also teaches evidence of formation of chimeric heterotetramers between human α-globin and mouse β-globin, muβ2/huα2 , i.e., two chains of α-globin and two chains of β-globin (see page 240, left column, “Production of human α-globin in transgenic mice” paragraph; Figure 3B). Hanscombe teaches that both human α- and β-globin genes under the control of β-globin gene DCR are expressed at high levels in adult red cells to give human hemoglobin HbA in amounts equal to or greater than endogenous mouse hemoglobin (see Abstract). Hanscombe reminds that Adult hemoglobin A (HbA) consists of two α- and two β-globin chains (see page 1572, left column, first paragraph). Therefore, the combination of references Amendola, Al-Hasani, Hanscombe, Bak and Miliotou teaches the elements of claim 33. The obviousness of combining the references is described above. Regarding claim 34, Amendola teaches genetically modifying hematopoietic stem cells in one globin gene at the genomic level by placing a therapeutic transgene under the control of the endogenous promoter of said globin gene (see title and abstract). Amendola teaches using the genetically modified cells in a pharmaceutical composition as a medicament in the treatment of a disease caused by the lack of a protein or by the presence of an aberrant non-functional one in an individual in need thereof (see [0045]-[0048]). Amendola teaches autologous transplantation, i.e., harvesting and reinfusion or transplant of a subject’s own cells or organs. Amendola teaches that using autologous cells can eliminate or reduce many adverse effects of administration of the cells back to the host, particular graft versus host reaction. Amendola teaches harvesting hematopoietic stem cells from an individual, genetically modifying ex vivo said cells, and administering them to the same individual (see [0124]-[0126]). Al-Hasani teaches treating a subject with α-thalassemia using an α-globin gene comprising transgene and restoring normal hemoglobin levels and other hematologic parameters in the subject (see Abstract). Therefore, the combination of references Amendola, Al-Hasani, Hanscombe, Bak and Miliotou renders the elements of claim 34 obvious. The obviousness of combining the references is described above. Claims 4, 6 and 11 are rejected under 35 U.S.C. § 103 as being unpatentable over Amendola (Amendola, M. et al. US 2020/0377857 A1; published December 3, 2020) in view of Al-Hasani (Al-Hasani, K. et al. “Complementation of α-thalassaemia in α-globin knockout mice with a 191 kb transgene containing the human α-globin locus”. Transgenic Research, Vol. 13 (2004), pp: 235-243), Hanscombe (Hanscombe, O. et al. “High-level, erythroid-specific expression of the human α-globin gene in transgenic mice and the production of human hemoglobin in murine erythrocytes”. Genes & Development, Vol. 3 (1989), pp: 1572-1581), Bak (Bak, R.O. et al. “CRISPR-mediated integration of large gene cassettes using AAV donor vectors”. Cell Reports, Vol. 20 (2017), pp: 750-756) and Miliotou (Miliotou, A.N. et al. “PTD-mediated delivery of α-globin chain into K-562 erythroleukemia cells and α-thalassemic (HBH) patients’ RBCs ex vivo in the frame of Protein Replacement Therapy”. Journal of Biological Research-Thessaloniki, Vol. 28 (July 2021), p: 16(1-13)), as applied to claim 1 above, and in further view of Dever ( Dever, D. P. et al. US 11, 193,141 B2; published December 7, 2021; with priority from prior publication US 2019/0032091 A1, published January 31, 2019). The rejection of claim 1 is described above. The combination of references Amendola, Al-Hasani, Hanscombe, Bak and Miliotou renders the elements of claim 1 obvious. Amendola teaches that the globin gene can be HBB gene and using plasmid expressing a guide RNA (gRNA) specific for targeting HBB gene (see [0055], [0087]-[0089]). Amendola teaches the use of a CRISPR/Cas9 system (see [0043]). Amendola teaches the targeting intron of the globin gene; Amendola teaches that the intron targeted can be the first or the second intron ( [0019]). Amendola teaches donor template that comprise the transgene for targeted integration in said globin gene ( [0064]). Amendola teaches that adding homology arms to the donor DNA trap dramatically increases its target integration efficiency ([0070]-[0071], [0354], [0360]). Amendola teaches that the homology arms for the 5’UTR gRNA target site are about 250 bp on each side of the transgene, i.e. in 5’ and 3’ of the transgene ([0356]). However, regarding claims 4 and 6, the combination of references does not teach SEQ ID Nos: 1 and 2 as sequences comprised within the first and second homology arms. Dever teaches nuclease-mediated genome editing of primary cells and enrichment thereof (see title). Dever specifically teaches methods for inducing a stable gene modification of a target nucleic acid via homologous recombination in a primary cells and enriching the population of genetically modified primary cells having targeted integration at a target nucleic acid. Dever teaches using a CRISPR/Cas system, and a homologous donor adeno-associated viral (AAV) vector (see abstract). Dever teaches a HBB locus being the target of a rAAV6 vector donor to targeted integration via homologous recombination (see Figure 1A). A search for SEQ ID NO: 1 (claim 4) identifies Dever as a source for the use of the sequence, see alignment below (Qy (Query) = instant SEQ ID NO: 1; Db (Database) = Dever’s SEQ ID NO: 36) RESULT 3 US-15-927-750-36 (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) Sequence 36, US/15927750 Patent No. 11193141 GENERAL INFORMATION APPLICANT: The Board of Trustees of the Leland Stanford Junior APPLICANT: University TITLE OF INVENTION: NUCLEASE-MEDIATED GENOME EDITING OF PRIMARY CELLS AND ENRICHMENT TITLE OF INVENTION: THEREOF FILE REFERENCE: 079445-000730US-1021687 CURRENT APPLICATION NUMBER: US/15/927,750 CURRENT FILING DATE: 2018-03-21 PRIOR APPLICATION NUMBER: PCT/US2016/053344 PRIOR FILING DATE: 2016-09-23 PRIOR APPLICATION NUMBER: US 62/232,713 PRIOR FILING DATE: 2015-09-25 PRIOR APPLICATION NUMBER: US 62/332,431 PRIOR FILING DATE: 2016-05-05 PRIOR APPLICATION NUMBER: US 62/357,832 PRIOR FILING DATE: 2016-07-01 NUMBER OF SEQ ID NOS: 74 SEQ ID NO 36 LENGTH: 2402 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sickle cell disease nucleotide correction donor sequence Query Match 100.0%; Score 900; Length 2402; Best Local Similarity 100.0%; Matches 900; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 ATTAGTCCAGGCAGAAACAGTTAGATGTCCCCAGTTAACCTCCTATTTGACACCACTGAT 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 275 ATTAGTCCAGGCAGAAACAGTTAGATGTCCCCAGTTAACCTCCTATTTGACACCACTGAT 334 Qy 61 TACCCCATTGATAGTCACACTTTGGGTTGTAAGTGACTTTTTATTTATTTGTATTTTTGA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 335 TACCCCATTGATAGTCACACTTTGGGTTGTAAGTGACTTTTTATTTATTTGTATTTTTGA 394 Qy 121 CTGCATTAAGAGGTCTCTAGTTTTTTATCTCTTGTTTCCCAAAACCTAATAAGTAACTAA 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 395 CTGCATTAAGAGGTCTCTAGTTTTTTATCTCTTGTTTCCCAAAACCTAATAAGTAACTAA 454 Qy 181 TGCACAGAGCACATTGATTTGTATTTATTCTATTTTTAGACATAATTTATTAGCATGCAT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 455 TGCACAGAGCACATTGATTTGTATTTATTCTATTTTTAGACATAATTTATTAGCATGCAT 514 Qy 241 GAGCAAATTAAGAAAAACAACAACAAATGAATGCATATATATGTATATGTATGTGTGTAT 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 515 GAGCAAATTAAGAAAAACAACAACAAATGAATGCATATATATGTATATGTATGTGTGTAT 574 Qy 301 ATATACACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 575 ATATACACACATATATATATATATTTTTTCTTTTCTTACCAGAAGGTTTTAATCCAAATA 634 Qy 361 AGGAGAAGATATGCTTAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 635 AGGAGAAGATATGCTTAGAACCGAGGTAGAGTTTTCATCCATTCTGTCCTGTAAGTATTT 694 Qy 421 TGCATATTCTGGAGACGCAGGAAGAGATCCATCTACATATCCCAAAGCTGAATTATGGTA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 695 TGCATATTCTGGAGACGCAGGAAGAGATCCATCTACATATCCCAAAGCTGAATTATGGTA 754 Qy 481 GACAAAACTCTTCCACTTTTAGTGCATCAACTTCTTATTTGTGTAATAAGAAAATTGGGA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 755 GACAAAACTCTTCCACTTTTAGTGCATCAACTTCTTATTTGTGTAATAAGAAAATTGGGA 814 Qy 541 AAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTACGTAAATACACTTGCA 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 815 AAACGATCTTCAATATGCTTACCAAGCTGTGATTCCAAATATTACGTAAATACACTTGCA 874 Qy 601 AAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATATCTTA 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 875 AAGGAGGATGTTTTTAGTAGCAATTTGTACTGATGGTATGGGGCCAAGAGATATATCTTA 934 Qy 661 GAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 935 GAGGGAGGGCTGAGGGTTTGAAGTCCAACTCCTAAGCCAGTGCCAGAAGAGCCAAGGACA 994 Qy 721 GGTACGGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATC 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 995 GGTACGGCTGTCATCACTTAGACCTCACCCTGTGGAGCCACACCCTAGGGTTGGCCAATC 1054 Qy 781 TACTCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCA 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1055 TACTCCCAGGAGCAGGGAGGGCAGGAGCCAGGGCTGGGCATAAAAGTCAGGGCAGAGCCA 1114 Qy 841 TCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1115 TCTATTGCTTACATTTGCTTCTGACACAACTGTGTTCACTAGCAACCTCAAACAGACACC 1174 A search for instant SEQ ID NO: 2 (claim 6) also identifies Dever as a source for the use of the sequence, see alignment below (Qy (Query) = instant SEQ ID NO: 2; Db (Database) = Dever’s SEQ ID NO: 36) RESULT 8 US-15-927-750-36 (NOTE: this sequence has 2 duplicates in the database searched. See complete list at the end of this report) Sequence 36, US/15927750 Patent No. 11193141 GENERAL INFORMATION APPLICANT: The Board of Trustees of the Leland Stanford Junior APPLICANT: University TITLE OF INVENTION: NUCLEASE-MEDIATED GENOME EDITING OF PRIMARY CELLS AND ENRICHMENT TITLE OF INVENTION: THEREOF FILE REFERENCE: 079445-000730US-1021687 CURRENT APPLICATION NUMBER: US/15/927,750 CURRENT FILING DATE: 2018-03-21 PRIOR APPLICATION NUMBER: PCT/US2016/053344 PRIOR FILING DATE: 2016-09-23 PRIOR APPLICATION NUMBER: US 62/232,713 PRIOR FILING DATE: 2015-09-25 PRIOR APPLICATION NUMBER: US 62/332,431 PRIOR FILING DATE: 2016-05-05 PRIOR APPLICATION NUMBER: US 62/357,832 PRIOR FILING DATE: 2016-07-01 NUMBER OF SEQ ID NOS: 74 SEQ ID NO 36 LENGTH: 2402 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Synthetic Sickle cell disease nucleotide correction donor sequence Query Match 100.0%; Score 900; Length 2402; Best Local Similarity 100.0%; Matches 900; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1376 GGTCTATTTTCCCACCCTTAGGCTGCTGGTGGTCTACCCTTGGACCCAGAGGTTCTTTGA 1435 Qy 61 GTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1436 GTCCTTTGGGGATCTGTCCACTCCTGATGCTGTTATGGGCAACCCTAAGGTGAAGGCTCA 1495 Qy 121 TGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1496 TGGCAAGAAAGTGCTCGGTGCCTTTAGTGATGGCCTGGCTCACCTGGACAACCTCAAGGG 1555 Qy 181 CACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1556 CACCTTTGCCACACTGAGTGAGCTGCACTGTGACAAGCTGCACGTGGATCCTGAGAACTT 1615 Qy 241 CAGGGTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1616 CAGGGTGAGTCTATGGGACGCTTGATGTTTTCTTTCCCCTTCTTTTCTATGGTTAAGTTC 1675 Qy 301 ATGTCATAGGAAGGGGATAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGAT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1676 ATGTCATAGGAAGGGGATAAGTAACAGGGTACAGTTTAGAATGGGAAACAGACGAATGAT 1735 Qy 361 TGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAAT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1736 TGCATCAGTGTGGAAGTCTCAGGATCGTTTTAGTTTCTTTTATTTGCTGTTCATAACAAT 1795 Qy 421 TGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTA 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1796 TGTTTTCTTTTGTTTAATTCTTGCTTTCTTTTTTTTTCTTCTCCGCAATTTTTACTATTA 1855 Qy 481 TACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAGTAA 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1856 TACTTAATGCCTTAACATTGTGTATAACAAAAGGAAATATCTCTGAGATACATTAAGTAA 1915 Qy 541 CTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCT 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1916 CTTAAAAAAAAACTTTACACAGTCTGCCTAGTACATTACTATTTGGAATATATGTGTGCT 1975 Qy 601 TATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATC 660 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1976 TATTTGCATATTCATAATCTCCCTACTTTATTTTCTTTTATTTTTAATTGATACATAATC 2035 Qy 661 ATTATACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAA 720 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2036 ATTATACATATTTATGGGTTAAAGTGTAATGTTTTAATATGTGTACACATATTGACCAAA 2095 Qy 721 TCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTT 780 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2096 TCAGGGTAATTTTGCATTTGTAATTTTAAAAAATGCTTTCTTCTTTTAATATACTTTTTT 2155 Qy 781 GTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAAT 840 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2156 GTTTATCTTATTTCTAATACTTTCCCTAATCTCTTTCTTTCAGGGCAATAATGATACAAT 2215 Qy 841 GTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAA 900 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 2216 GTATCATGCCTCTTTGCACCATTCTAAAGAATAACAGTGATAATTTCTGGGTTAAGGCAA 2275 This means that the sequence targeted are known sequences, part of the HBB gene as donor template, described as SEQ ID NO: 36 by Dever (see column 24, lines 52-53; column 76, lines 5-24). Dever teaches using fragment of this sequence, one comprising a fragment/subsequence of 540 bp of 5’ UTR and part of exon 1 of HBB gene as first homology arm (left homology arm), and a 420 bp fragment/subsequence comprising 3’UTR of exon 1 and a 5’UTR portion as well as a 3’UTR portion of exon 2 (right homology arm) (see Figure 1A) and below: PNG media_image1.png 506 688 media_image1.png Greyscale Therefore, it would have been obvious to one with ordinary skills before the effective filing date of the claimed invention to have used the method of genetically modifying hematopoietic stem cells as taught by Amendola, modified by Al-Hasani, Hanscombe, Bak and Miliotou, and constructed a donor vector comprising homology arms for targeting HBB gene as taught by Dever. Amendola teaches using about 250 bp for each arm, thereby restricting the targeted sequence to intronic sequence of HBB gene. One with ordinary skills in the art motivated in using DCR from HBB gene present in untranslated region for directing the expression of α-globin gene and treat subject presenting with α-thalassemia, could have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention. Regarding claim 11, the combination of references Amendola, Al-Hasani, Hanscombe, Bak and Miliotou does not render the elements of claim 11 obvious, i.e., a guide RNA comprising one or more 2’-O-methyl-3’-phosphorothioate (MS) modifications. However, Dever teaches modified guide RNA (sgRNA), and specifically modified nucleotides with 2’-O-methyl 3’-phosphorothioate (MS) nucleotides (see column 25, line 1; column 31, lines 40-67; column 91, embodiment 24; claims 1 and 12, columns 151-152). Dever teaches that sgRNAs containing one or more chemical modifications can increase the activity, stability and specificity and/or decrease the toxicity of the modified sgRNA compared to the corresponding unmodified sgRNA when used for CRISPR-based genome editing. Dever teaches a greater ease of delivery into target cells as well (see column 44, lines 52-65). Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have modified the guide RNA in the CRISPR/Cas9 system taught by Amendola modified by Al-Hasani, Hanscombe, Bak and Miliotou, with nucleotides having 2’-O-methyl 3’ phosphorothioate modifications, among other suggested modifications. One with ordinary skills in the art motivated in increasing the stability, specificity and delivery of the guide RNA would have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention. Claim 8 is rejected under 35 U.S.C. § 103 as being unpatentable over Amendola (Amendola, M. et al. US 2020/0377857 A1; published December 3, 2020) in view of Al-Hasani (Al-Hasani, K. et al. “Complementation of α-thalassaemia in α-globin knockout mice with a 191 kb transgene containing the human α-globin locus”. Transgenic Research, Vol. 13 (2004), pp: 235-243), Hanscombe (Hanscombe, O. et al. “High-level, erythroid-specific expression of the human α-globin gene in transgenic mice and the production of human hemoglobin in murine erythrocytes”. Genes & Development, Vol. 3 (1989), pp: 1572-1581), Bak (Bak, R.O. et al. “CRISPR-mediated integration of large gene cassettes using AAV donor vectors”. Cell Reports, Vol. 20 (2017), pp: 750-756) and Miliotou (Miliotou, A.N. et al. “PTD-mediated delivery of α-globin chain into K-562 erythroleukemia cells and α-thalassemic (HBH) patients’ RBCs ex vivo in the frame of Protein Replacement Therapy”. Journal of Biological Research-Thessaloniki, Vol. 28 (July 2021), p: 16(1-13)), as applied to claims 1 and 7 above, and in further view of Porteus (Porteus, M. H. US 10, 738,305 B2; published August 11, 2020, with priority from prior publication of US 2018/0021413 A1, on January 25, 2018). The rejections of claims 1 and 7 are described above. The combination of references Amendola, Al-Hasani, Hanscombe, Bak and Miliotou renders the elements of claims 1 and 7 obvious. However, regarding claim 8, the combination of references does not render obvious instant SEQ ID NO: 14 as the guide RNA’s nucleotide sequence. A search for instant SEQ ID NO: 14 leads to the following result (Qy (Query) = instant SEQ ID NO: 14; Db (Database) = Porteus’s SEQ ID NO: 43): RESULT 1 US-15-550-943-43 (NOTE: this sequence has 4 duplicates in the database searched. See complete list at the end of this report) Sequence 43, US/15550943 Patent No. 10738305 GENERAL INFORMATION APPLICANT: CRISPR THERAPEUTICS AG TITLE OF INVENTION: MATERIALS AND METHODS FOR TREATMENT OF HEMOGLOBINOPATHIES FILE REFERENCE: 32265/49064PCT1 CURRENT APPLICATION NUMBER: US/15/550,943 CURRENT FILING DATE: 2017-08-14 PRIOR APPLICATION NUMBER: 62/119,754 PRIOR FILING DATE: 2015-02-23 NUMBER OF SEQ ID NOS: 192 SEQ ID NO 43 LENGTH: 20 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic oligonucleotide Query Match 100.0%; Score 20; Length 20; Best Local Similarity 100.0%; Matches 20; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GGGTGGGAAAATAGACCAAT 20 |||||||||||||||||||| Db 1 GGGTGGGAAAATAGACCAAT 20 Therefore, Porteus teaches instant SEQ ID NO: 14 in the form of SEQ ID NO: 43, which correspond to a guide RNA used to induce specific deletion to remove all or part of the β-globin gene (HBB) . Porteus teaches that deleting or disrupting the β-globin gene can effectively reduce or eliminate the expression of sickle cell hemoglobin (HbS), which in addition to increasing the levels of fetal hemoglobin (HbF) can be of significant additional benefit to patients with Sickle Cell Disease (see column 7, lines 10-19). Porteus teaches methods of ameliorating hemoglobinopathies by administration of cells that have been modified by the genome editing method to increase their levels of HbF (column 7, lines 41-51). Porteus teaches creating double strand breaks (DSB) using DNA endonuclease such as Cas9 endonuclease and a guide RNA in the β-globin region of human chromosome 11 (see columns 5 (lines 56-67) and 6 (lines 1-23)). Porteus teaches sites for CRISPR targeting for deletion in Figure 1B, specifically 5’ and 3’ target sites for a 12.9 Kb deletion starting 3 Kb at 5’ to the δ gene and ends 1.7 Kb 3’ to the end of the β gene (690 bp downstream from the β poly A signal) (Figure 1B). Porteus teaches SEQ ID NO: 43 in Figure 1C, as one of the guides used to create a deletion in the human β-globin locus (see columns 7, lines 55-67; column 8, lines 1-3). In the table shown in Figure 1C, there is only a choice among 10 guide RNAs. Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have substituted the guide RNA in the method taught by Amendola modified by Al-Hasani, Hanscombe, Bak and Miliotou with the guide RNAs taught by Porteus to create a double strand break (DSB) in HBB locus. One with ordinary skills in the art, motivated in an efficient guide RNA for making DSB in the HBB in the context of CRISPR/Cas system mediated genome editing, could have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention. Allowable Subject Matter Claims 10, 16 and 18 are objected to as being dependent upon a rejected base claim but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims. Conclusion Claims 10, 16 and 18 are objected to. Claims 1, 4, 6-9, 11, 13, 15, 17, 19-20, 22, 24, 26 and 33-34 are rejected. No claim is allowed. Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /A.D./Examiner, Art Unit 1636 /NANCY J LEITH/Primary Examiner, Art Unit 1636
Read full office action

Prosecution Timeline

Feb 22, 2024
Application Filed
Sep 08, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735465
METHOD OF PREPARING CIRCULAR PERMUTATION-BASED FUNCTIONAL RECOMBINANT HUMAN-DERIVED FIBROBLAST GROWTH FACTOR 7 AND USE THEREOF
3y 9m to grant Granted Sep 15, 2026
Patent 12680098
Modified antisense oligonucleotide for inhibition of FoxP3 expression
4y 0m to grant Granted Jul 14, 2026
Patent 12655421
NOVEL CRISPR DNA TARGETING ENZYMES AND SYSTEMS
5y 9m to grant Granted Jun 16, 2026
Patent 12570996
Circular RNA For Translation In Eukaryotic Cells
1y 12m to grant Granted Mar 10, 2026
Patent 12529048
DOUBLE KNOCK-OUT CHO CELL LINE METHOD OF ITS GENERATION AND PRODUCING THERAPEUTIC PROTEINS THEREFROM
5y 0m to grant Granted Jan 20, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
57%
Grant Probability
96%
With Interview (+39.1%)
3y 7m (~1y 0m remaining)
Median Time to Grant
Low
PTA Risk
Based on 63 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month