DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55.
Information Disclosure Statement
The listing of references in the specification is not a proper information disclosure statement: see “Jung U et al” on page 2 and “Busk PK” on page 3. 37 CFR 1.98(b) requires a list of all patents, publications, or other information submitted for consideration by the Office, and MPEP § 609.04(a) states, "the list may not be incorporated into the specification but must be submitted in a separate paper." Therefore, unless the references have been cited by the examiner on form PTO-892, they have not been considered.
Nucleotide and/or Amino Acid Sequence Disclosures
Summary of Requirements for Patent Applications Filed On Or After July 1, 2022, That Have Sequence Disclosures
37 CFR 1.831(a) requires that patent applications which contain disclosures of nucleotide and/or amino acid sequences that fall within the definitions of 37 CFR 1.831(b) must contain a “Sequence Listing XML”, as a separate part of the disclosure, which presents the nucleotide and/or amino acid sequences and associated information using the symbols and format in accordance with the requirements of 37 CFR 1.831-1.835. This “Sequence Listing XML” part of the disclosure may be submitted:
1. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 via the USPTO patent electronic filing system (see Section I.1 of the Legal Framework for Patent Electronic System (https://www.uspto.gov/PatentLegalFramework), hereinafter “Legal Framework”) in XML format, together with an incorporation by reference statement of the material in the XML file in a separate paragraph of the specification (an incorporation by reference paragraph) as required by 37 CFR 1.835(a)(2) or 1.835(b)(2) identifying:
a. the name of the XML file
b. the date of creation; and
c. the size of the XML file in bytes; or
2. In accordance with 37 CFR 1.831(a) using the symbols and format requirements of 37 CFR 1.832 through 1.834 on read-only optical disc(s) as permitted by 37 CFR 1.52(e)(1)(ii), labeled according to 37 CFR 1.52(e)(5), with an incorporation by reference statement of the material in the XML format according to 37 CFR 1.52(e)(8) and 37 CFR 1.835(a)(2) or 1.835(b)(2) in a separate paragraph of the specification identifying:
a. the name of the XML file;
b. the date of creation; and
c. the size of the XML file in bytes.
SPECIFIC DEFICIENCIES AND THE REQUIRED RESPONSE TO THIS NOTICE ARE AS FOLLOWS:
Specific deficiency - Sequences appearing in the specification are not identified by sequence identifiers (i.e., “SEQ ID NO:X” or the like) in accordance with 37 CFR 1.831(c).
Specific deficiency - The incorporation by reference paragraph required by 37 CFR 1.834(c)(1), 1.835(a)(2), or 1.835(b)(2) is missing, defective or incomplete.
Required response – Applicant must provide:
A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation by reference paragraph and the required sequence identifiers, consisting of:
• A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
• A copy of the amended specification without markings (clean version); and
• A statement that the substitute specification contains no new matter.
This application contains sequence disclosures in accordance with the definitions for nucleotide and/or amino acid sequences set forth in 37 CFR 1.831(a) and 1.831(b). However, this application fails to comply with the requirements of 37 CFR 1.831-1.834. The examiner has noted that multiple sequence present on pages 24-26 and 29 are included in the specification without identification by a sequence identifier.
Applicant must provide:
• A replacement “Sequence Listing XML” part of the disclosure, as described above in item 1. or 2., as well as
• A statement that identifies the location of all additions, deletions, or replacements of sequence information in the “Sequence Listing XML” as required by 1.835(b)(3);
• A statement that indicates support for the amendment in the application, as filed, as required by 37 CFR 1.835(b)(4);
• A statement that the “Sequence Listing XML” includes no new matter in accordance with 1.835(b)(5); and
• A substitute specification in compliance with 37 CFR 1.52, 1.121(b)(3), and 1.125 inserting the required incorporation by reference paragraph as required by 37 CFR 1.835(b)(2), consisting of:
o A copy of the previously-submitted specification, with deletions shown with strikethrough or brackets and insertions shown with underlining (marked-up version);
o A copy of the amended specification without markings (clean version); and
• A statement that the substitute specification contains no new matter.
Specification
The use of multiple trade names or marks used in commerce, such as SYBR, has been noted in this application on pages 3, 14-16, 20, 22-24, 27, and 28. The terms should be accompanied by the generic terminology; furthermore the term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
The lengthy specification has not been checked to the extent necessary to determine the presence of all possible minor errors. Applicant’s cooperation is requested in correcting any errors of which applicant may become aware in the specification.
Claim Objections
Claims 1-3, 5, 7-10, 12, and 13 are objected to because of the following informalities:
It is suggested that Claim 1, Step 1 reads as :“Step 1: adding the following reaction systems at the same time to the test sample containing microRNA: (a) a polyadenylic acid[[s]] tailing reaction system for obtaining microRNA molecules with a polyadenylic acid[[s]] tail at the 3' end of the microRNA molecule, wherein the polyadenylic acid[[s]] tailing reaction system contains: an enzyme for catalyzing a polyadenylic acid[[s]] tailing reaction, and a substrate for the tailing reaction;
Claim 1, L9: “…cDNA product[[;]], wherein the reverse transcription”
In claim 2 L2, it is suggested that “10-15 oligonucleotides” be changed to “10-15 bases” to remain consistent with the rest of the claim set.
In claim 2 L2 and claim 13 L3, “tag sequences” [Wingdings font/0xE0] “tag sequence”; [[s]].
In claim 3 L1, the first appearance of an abbreviation should be accompanied by the full term. Therefore, “Tm” [Wingdings font/0xE0] “melting temperature (Tm)”.
In claim 5 L2, “…a polyadenylic acids tailing reaction…” [Wingdings font/0xE0] “…a polyadenylic acid tailing reaction…”; [[s]].
In claim 9, recitations of dNTP should be corrected to the relevant “N” as dNTPs refer to the “free floating” nucleotides found in solution and used for PCR, rather than nucleotides bound within an oligonucleotide.
In claim 13 L2, “…about 15 polyadenylic acids…” [Wingdings font/0xE0] “…about 15 adenylic acids…”
In claims 1 (L11 and 13), 7 (L1), and 12 (L4), “poly-T oligonucleotide(s)” and “poly T oligonucleotide(s)” are used interchangeably. Either “poly-T” or “poly T” should be selected and used throughout for consistency. Additionally, “oligonucleotides” should be corrected to “nucleotide.”
In claims 1 (L12 and 14), 2 (L3), 8 (L1), 10 (L2), 12 (L5), and 13 (L3), “extend tag sequence” and “extended tag sequence” are used interchangeably. One should be selected and used throughout for consistency.
Appropriate correction is required.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claims 1-15 and 21 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
The language used to specify binding targets of the primers and universal probes in claims 1, 2, 10, 11, 12, and 13 is unclear. Statements such as “the specific forward primer specifically recognizes the target microRNA” implies that the forward primer is complementary to the sequence of the target microRNA, an interpretation that is supported by the use of “…recognizes and bind with…” in claim 12. However, were this to be the case, the reaction as claimed would not be able to proceed. For the purposes of prior art, the Examiner will interpret binding specific in whatever way is required to allow the reaction to proceed. Care should be taken by the Applicant to clarify these issues by specifically pointing out and claiming the binding specificity of the primers and probes.
The term “about” in claims 1, 2, 3, 7, 8, and 13 is a relative term which renders the claim indefinite. The term “about” is not defined by the claim, the specification does not provide a standard for ascertaining the requisite degree, and one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. In absence of a provided definition, “about” will be interpreted as plus or minus 10% of the recited number rounded to the next whole number. For example, “about 15” will be interpreted as 15 plus or minus 2.
Claims 1, 14, and 15 recite the following limitations for which there is insufficient antecedent basis:
“the test sample” (claim 1, L2)
“the signal”, “the reporter group” (claim 1, L21)
“the cyclic amplification step” (claim 1, L22)
“the detection result” (claim 1, L22-23)
“the 3` labeled quencher group” , “the 5` terminal labeled reporter group” (claim 14)
“said sample” (claim 15 L1)
Claim 1 is further rendered indefinite for the following reasons:
Line 21 references “adding a universal fluorescent probe to the reaction system.” However, there are three reaction systems described by claim 1. Therefore, it is unclear to which reaction system the probe is being added. For the purposes of prior art, it will be assumed that the probe is added to the DNA amplification and fluorescence detection system.
Line 22 refers to “…detecting the signal of the reporter group in the cyclic amplification step…” It is unclear from this description if the signal should be detected at the end of every PCR cycle (i.e. real-time PCR) or once per reaction (i.e. end point PCR). For the purposes of prior art, it will be assumed that the signal is detected at the end of every PCR cycle.
Line 28 states “…which is about 19-24 bases in length” It is unclear from the structure of this limitation whether the recited length is referring to the length of the probe or the length of the amplification product.
Claim 4 is indefinite due to the repeated recitation of “the specific forward primer.” It is unclear if this is meant to refer to two different specific forward primers or if this was a typographical mistake and the claim is meant to refer to both the specific forward primer and the universal reverse primer. The latter interpretation will be used for the purposes of prior art.
Claim 5 is indefinite due to the recitation of “a polyadenylic acids tailing reaction.” It is unclear if this is referring to the tailing reaction that occurs in claim 1 or if it is referring to an additional tailing reaction. The former interpretation will be used for the purposes of prior art.
Claim 11 is indefinite as the claim does not specify what is being referred to by “the specific forward primer in has a sequence.” This could be referring to a specific step or a specific composition. For the purposes of prior art, it will be assumed that Applicant meant to refer back to Step 2 in claim 1.
Claim 14 is further rendered indefinite as the structural relationship between the quencher group, the reporter group, and the universal fluorescent probe is unclear. For instance, “5` terminal labeled reporter group” could be interpreted as the reporter group being labeled on the reporter group’s 5` terminus. This would add an additional layer of indefiniteness as it would be unclear as to what is meant by “the 5` terminus of the reporter group.” For the purposes of prior art, the Examiner will assume Applicant meant claim 14 to read as “wherein the universal fluorescent probe is labeled at its 3` terminus a quencher group and at its 5` terminus with a reporter group.”
Any claim not explicitly rejected within this section depends from a rejected claim and inherits the indefiniteness of its parent(s).
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
Claims 1, 6, 9-11, 14, 15, and 21 are rejected under 35 U.S.C. 103 as being unpatentable over Gilad (WO 2010103522 A1) in view of Niu (Niu Y, et al. Scientific reports. 2015 Oct 13;5(1):15100).
Gilad teaches a method for detecting a target RNA, such as a microRNA. Example 1 (beginning on page 27 of Gilad) exemplifies this process through the detection of two miRNAs simultaneously: hsa-miR-296-3p (SEQ ID NO: 11) and has-miR-181a (SEQ ID NO: 7). Total RNA was isolated from cultured cell lines and polyadenylated using the poly A polymerase from Takara. After incubation, a reverse transcription primer (RT1) and a reverse transcriptase, as well as other necessary components, were added to the sample resulting in the generation of cDNA. Finally, real-time PCR was performed using miR-specific forward primers, a universal reverse primer, and a universal probe. Furthermore, the universal probe may be a TaqMan probe comprising a 5` fluorescent reporter group and a 3` quencher, or vice versa (Gilad, p4¶1, p27-28).
The sequences and corresponding SEQ IDs of RT1, the target specific forward primers, the universal reverse primer and the universal probe of Example 1 are included in Table 1 below (Gilad, Table 1).
Table 1. Gilad Example 1 Primers/Probes
Primer/Probe
Sequence (5` [Wingdings font/0xE0] 3`)
SEQ ID
hsa-miR-296-3p forward primer
GAGGGTTGGGTGGAGGCTCTCC
12
hsa-miR-181a forward primer
AACATTCAACGCTGTCGGTGAGT
8
RT1
GCCAGCACAGAATTAATACGACTCCTGGGCAATTTTTTTTTTTTVN
26
Universal reverse primer
GCGAGCACAGAATTAATACGAC
28
Universal probe
TTGCCCAG
50
With regards to the RT1 sequence, the underlined portion is considered equivalent to the Applicant’s extend tag sequence. The limitation requiring the extend tag sequence to be “about 20-30 bases” is being interpreted as 18-33 bases per examiner’s interpretation of “about” as discussed in the prior 112b rejection. Therefore, as the underlined portion of RT1 is 32 bases, Gilad meets this limitation.
The bolded portion of RT1 (aka the adapter sequence) represents the sequence which would be recognized by the universal reverse primer. Additionally, while the exemplified probe is 8 nucleotides in length, Gilad teaches the length of the probe may range from 8 nucleotides to 500 nucleotides (Gilad, p24¶4) (p2¶5; p3¶4; p4¶1; p25¶6).
Gilad does not teach a one-pot set up for the polyadenylation and reverse transcription reactions.
However, Niu describes a similar method of detecting circulating miRNAs in which polyadenylation and reverse transcription are combined into one step. Niu found that this reduced reaction time and utilized more of the available sample which lead to an increase in assay sensitivity when compared to an assay in which the steps were performed separately. Therefore, one of ordinary skill in the art prior to the effective filling date of the claimed invention would have been motivated to combine the polyadenylation and reverse transcription steps of Gilad as this represents a low effort method for increasing assay sensitivity and reducing analysis time.
Regarding claim 6, Niu discloses use of the MMLV High Performance Reverse Transcriptase (Niu, p9¶1).
Regarding claim 9, the 3` end of RT1 terminates with the sequence “VN,” wherein V=A, G, or C and N=A, T, G, or C (Gilad, Table 1).
Regarding claim 10, the universal reverse primer comprises a sequence complementary to the adaptor sequence portion of the reverse transcriptase primer. This is apparent when the sequences of the universal reverse primer and the bolded region of the RT1 primer in Table 1 above are compared.
Regarding claim 11, the forward primers used in Example 1 correspond to the full length of their target miRNA as shown in Table 2 below.
Table 2. Forward Primers and their Targets
Target/Primer
Sequence (5` [Wingdings font/0xE0] 3`)
SEQ ID
hsa-miR-296-3p
GAGGGUUGGGUGGAGGCUCU
11
hsa-miR-296-3p forward primer
GAGGGTTGGGTGGAGGCTCTCC
12
hsa-miR-181a
AACAUUCAACGCUCUCGGUGAGU
7
hsa-miR-181a forward primer
AACATTCAACGCTGTCGGTGAGT
8
Regarding claim 14, as previously mentioned, the universal probe may comprise a 5` fluorescent reporter and a 3` quencher, or vice versa (Gilad, p4¶1).
Regarding claims 15 and 21, the biological sample to be tested by Gilad’s method is selected from the group consisting of a body fluid, a cell line, a tissue sample, and a biopsy sample (among others) (Gilad p4¶2).
Claims 3 and 4 are rejected under 35 U.S.C. 103 as being unpatentable over Gilad and Niu, as applied to claim 1 above, as evidenced by DNA.gov (DNA Amplification for Forensic Analysts. Presidents DNA Initiative. Updated October 8, 2008.).
Regarding claims 3 and 4, the melting temperature of one of the forward primers and the universal reverse primer of Niu were calculated using the formula described by Butler and reported in Table 3 below. Formula (DNA.gov, p3-4): Tm = [2 x (#A + #T)] + [4 x (#G + #C)]
Table 3. Tm of Niu primers
Primer
Sequence (5` [Wingdings font/0xE0] 3`)
Tm (oC)
miRNA specific forward primer (has-miR-16 MIMAT0000069)
TTCGGTAGCAGCACGTAAATA
60
Universal Reverse Primer
CAGTGCAGGGTCCGAGGT
60
Claim 5 is rejected under 35 U.S.C. 103 as being unpatentable over Gilad and Niu, as applied to claim 1 above, as evidenced by Takara (Poly(A) Polymerase Data Sheet. Code No. 2180A. v202107Da. Takara Bio Inc.).
Regarding claim 5, Gilad discloses the use of a Takara poly A polymerase which is derived from E. coli per the manufacturer’s datasheet (Gilad, p28¶1).
Claims 2, 7, 8, 12, and 13 are rejected under 35 U.S.C. 103 as being unpatentable over Gilad and Niu, as applied to claim 1 above, and further in view of Gou (US 20140045188 A1).
Regarding claims 2, 12, and 13, neither Gilad or Niu explicitly disclose a universal fluorescent probe with the following features: (1) about 10-15 (i.e., 9-17) oligonucleotides on the 5` end (specifically a poly(A) region about 15 (i.e., 13-17) nucleotides long); and (2) a 3` end comprising a plurality of bases complementary to the extend tag sequence of the universal reverse transcription primer.
Regarding claim 7, neither Gilad or Niu disclose the universal reverse transcription primer having a 3` poly(T) segment of about 15 (i.e., 13-17) nucleotides long.
Regarding claim 8, neither Gilad or Niu disclose the 5` extend tag sequence of the universal reverse transcription primer being about 27 (i.e., 24-30) nucleotides long; or.
However, Niu’s work is an effort to improve their previously developed S-Poly(T) method originally described in Gou. Gou describes a S-Oligo(dT) primer used to reverse transcribe miRNA, as well as a universal probe used for detecting the resultant cDNA in a real-time PCR assay (Gou, abstract).
The S-Oligo(dT) primer is composed of four segments (in the 5` to 3` direction): (1) 14-20 nucleotides of a universal reverse primer sequence, (2) 14-20 nucleotides of a universal probe binding sequence, (3) 8-30 nucleotides of an oligo(dT) sequence, and (4) 3-8 specific nucleotides that are complementary to the 3` end of a target miRNA (Gou, ¶0028-29).
The combination of segments (1) and (2) are considered equivalent to the Applicant’s extend tag sequence as together they exhibit the same functionality; specifically, serving as targets for the universal reverse primer and the universal probe. By combining these segments, the region of the S-Oligo(dT) primer which is considered equivalent to the Applicant’s extend tag sequence is 28-40 nucleotide long.
Gou’s universal probe is described as having 14 to 20 nucleotides derived from the sequence of the S-Oligo(dT) primer. Gou does not specify which primer-derived nucleotides are required to be included in the universal probe. However, by naming segment (2) of the S-Oligo(dT) primer the “universal probe binding sequence,” a skilled artisan would recognize the implication that the probe’s sequence should be complementary to at least a portion of this segment (Gou, ¶0016)
Therefore, using the teachings of Gou, a skilled artisan could conceive of the S-Oligo(dT) primer and universal probe sequences in Table 4 below.
Table 4. Theoretical S-Oligo(dT) Primer and Universal Probe Sequences
Sequences (5` [Wingdings font/0xE0] 3`)
S-Oligo(dT) Primer
[N14][N14][T15][N3]*
Universal Probe
A15N4, wherein the N4 are complementary to the 3` end of segment 2
*brackets are used to denote the segments taught by Kang.
As previously mentioned, Niu’s work is an effort to improve their previously developed S-Poly(T) method (Gou and Kang both coauthored Niu’s work). Niu’s improvements were limited to combining the polyadenylation and reverse transcription steps, optimizing the reaction buffer and reaction temperature for this combination of steps, and optimizing RNA isolation through the use of glycogen during precipitation. No changes to the various primers and probes developed for the S-Poly(T) method were disclosed. Therefore, the skilled artisan would recognize that the primers/probes described by Niu would have been developed by following the same guidelines as those described by Gou.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kara N Kovach whose telephone number is (571)272-8134. The examiner can normally be reached Monday - Friday, 9am - 3pm.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Gary Benzion can be reached at (571) 272-0782. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/K.N.K./Examiner, Art Unit 1681
/SAMUEL C WOOLWINE/Primary Examiner, Art Unit 1681
Prosecution Insights