DETAILED ACTION
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
Applicant’s claim to priority from International Application No. PCT/US2022/076923 filed 09/23/2022 and US Provisional Application No. 63/248,128 filed 09/24/2021 is hereby acknowledged.
Application Status
The instant Application is a National Stage entry application of PCT/US2022/076923 filed 09/23/2022 under 35 U.S.C.§ 371.
This Office Action is in response to amendments filed 03/01/2024.
Preliminary amendments to claims filed 03/01/2024 are hereby acknowledged. Claim 14 is currently amended and claim 15 is newly added. Therefore, claims 1-15 are pending and under consideration in this Office Action.
Information Disclosure Statement
The information disclosure statements (IDSs) submitted on 03/01/2024 and 07/31/2024 are hereby acknowledged. The submissions are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner.
Drawings
Drawings submitted on 03/01/2024 are hereby acknowledged and are acceptable.
Specification
The use of the terms “Bruker”, “Skyscan” (page 16, line 28, line 32; page 17, line 1), “Axio Observer” (page 18, line 17; page 19, line 10), “AlexaFluor 594” (page 19, line 9), “Criterion TGX” (page 19, line 20), “Odyssey” (page 19, lines 22, 24, 29), “Tween-20” (page 19, lines 24-25), “DyLight (page 19, line 27), “Abcam” (page 19, line 32),“miRNeasy”, “Qiagen” (page 21, lines 1-2), “Synergy H1”, “BioTek” (page 21, line 4), “Verso cDNA kit” (page 21, line 5), “Light Cycler 96”, “TaqMan” (page 21, line 6) which are trade names or marks used in commerce, has been noted in this application. The terms should be accompanied by the generic terminology; furthermore, the terms should be capitalized wherever they appear or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the terms.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Interpretation
Regarding claim 1, it recites “A method of treating cachexia in a subject, said method comprising administering a therapeutically effective amount of an inhibitor of IGFBP1”. Claim 9 also recite “an inhibitor of IGFBP1” without specifying at which level the inhibition should occur.
The claims 1 and 9 do not recite limitations as far as “IGFBP1 protein” or “IGFBP1 gene expression”. The claims do not specify the kind of inhibitor, direct or indirect inhibitor. A specific definition for the term is absent from the Specification.
Therefore, Examiner interprets that any substance inhibiting either the IGFPB1 protein or the IGFBP1 gene expression, directly or indirectly, is acceptable in the claimed method of treating cachexia.
Claim Rejections - 35 USC § 112(a)
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1, 7, 8 and 9 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
MPEP 2163.II.A.3.(a).i) states, “Whether the specification shows that applicant was in possession of the claimed invention is not a single, simple determination, but rather is a factual determination reached by considering a number of factors. Factors to be considered in determining whether there is sufficient evidence of possession include the level of skill and knowledge in the art, partial structure, physical and/or chemical properties, functional characteristics alone or coupled with a known or disclosed correlation between structure and function, and the method of making the claimed invention”.
For claims drawn to a genus, MPEP § 2163 states the written description requirement for a claimed genus may be satisfied through sufficient description of a representative number of species by actual reduction to practice, reduction to drawings, or by disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between function and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus. See Eli Lilly, 119 F.3d at 1568, 43 USPQ2d at 1406.
Nature of the invention:
Claim 1 recites “A method of treating cachexia in a subject, said method comprising administering a therapeutically effective amount of an inhibitor of IGFBP1”.
Claim 9 recites “A method of preventing or reducing the effects of cachexia in a
Cancer patient, said method comprising
measuring IGFBP1 blood levels in said cancer patients to detect cancer patients with elevated IGFBP1 levels relative to disease free patients;
administering an inhibitor of IGFBP1 to said cancer patients having elevated IGFPB1 levels, to reduce IGFBP1 blood levels and prevent or reduce the effects of cachexia in said patients identified as having elevated IGFPB 1 levels.”
It is therefore expected in the instant Application, a disclosure of a method using an agent capable of inhibiting IGFBP1 at the transcriptional, post-transcriptional, translational, or post-translational levels. It is expected in the disclosure an example of agent for each level, capable of being used for treating cachexia or reducing the effects of cachexia in any patient (claim 1), and in cancer patient specifically (claim 9).
It is expected a disclosure of at least one agent affecting IGFBP1 gene expression, one agent affecting translation, one agent affecting posttranslational modifications, inhibiting IGFBP and effective at treating cachexia.
The State of the Art:
Lin (Lin, Y.-W. et al. “IGFBP-1 in cancer: expression, molecular
mechanisms, and potential clinical implications”. American Journal of Translational Research, Vol. 13, No. 3 (March 2021), pp: 813-832) teaches that IGFBP-1 can be repressed with different molecules, and at multiple stages, at gene level, transcriptional and posttranscriptional level:
PNG
media_image1.png
272
678
media_image1.png
Greyscale
At the transcriptional level, any molecule with a response element within the promoter region of IGFBP1 gene can interfere with its expression, e.g., insulin (IRE, Insulin Response Element), cAMP (CRE, cAMP response element), glucocorticoid (GRE, Glucocorticoid response element), progesterone (PRE, progesterone response element) and C/EBPs (CAAT/enhancer-binding proteins).
According to Figure 2, IGFBP1 has at least 3 Serine that are primary sites for phosphorylation.
According to Figure 3, Growth Hormone, insulin, glucose are negative regulators (inhibitors) of IGFBP-1, while glucagon, glucocorticoid and Glucagon-like peptide-1 are activators.
Therefore, insulin analogs and growth hormone secretagogues are also to be considered as inhibitors of IGFBP1.
Coverly (Coverly, J.A. et al. “Phosphorylation of insulin-like growth factor
binding proteins”. Molecular and Cellular Endocrinology, Vol. 128 (1997), pp: 1-5) teaches IGFBPs and their regulation by phosphorylation (see title and abstract). Coverly teaches that IGFBP-1 can be phosphorylated by CKIP, PKA, PKC and MAP kinase (see Table 1). Therefore, it is conceivable that every protein kinase inhibitor targeting these specific kinases can be considered an indirect inhibitor for IGFBP1.
Lewitt (Lewitt, M.S. et al. “Lithium chloride inhibits the expression and
secretion of insulin-like growth factor-binding protein-1”. Journal of Endocrinology, Vol. 171 (2001), pp: R11-R15) teaches that compounds such as lithium chloride can be considered inhibitors of IGFBP1 (see title). Lewitt teaches that lithium chloride inhibits Glycogen synthase kinase (GSK)-3, therefore, the compound is an indirect inhibitor.
It is conceivable that other unknown small molecules can interact and/or inhibit IGFBP1.
What the Specification does and does not teach:
The Specification teaches effects of IGFBP1 on bone, muscle and liver in a
subject with colorectal cancer, compares circulating levels of IGFBP1 from patients and control, and presents survival probability according to these levels (page 3, lines 20-26).
The Specification teaches animal models of tumor induced changes in muscle and bones and knock-out mice bearing implanted metastatic colorectal cancer, quantified amount of serum IGFBP1 in these models (see page 3, lines 26-32, page 4, lines 1-13).
The Specification teaches diseased mice infected with AAV8-shIGFBP1 or administered with antibodies against IGFBP1 (see page 4 and 5).
However, there is no other examples of inhibitors such as small molecules against IGFBP1, in cell culture or in vivo.
There is no description of an indirect inhibitor, such as a transcription inhibitor (insulin, glucocorticoid or growth hormone, etc.) or post-transcriptional inhibitor (e.g., phosphorylation inhibitor, protein kinase inhibitor, etc. ).
Conclusion:
Taking into consideration the factors outlined above, including the nature of the
invention, the state of the art, the guidance provided by the applicant and the specific example, it is the conclusion that Applicant does not possess the entire scope of the invention as claimed in claims 1 and 9. There is no specific written example within the Specification that would lead one with ordinary skills in the art to a different conclusion.
Claims 7 and 8 depend on claim 1, but do not remedy claim 1’s deficiencies,
Therefore, they are rejected as well.
Claims 9-15 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention.
The Specification, while being enabling for treating and reducing the
effect of cachexia in a subject, does not reasonably provide enablement for preventing the effects of cachexia in a cancer patient. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the invention commensurate in scope with these claims.
Factors to be considered in determining whether a disclosure meets the enablement requirement of 35 U.S.C. 112, first paragraph, have been described by the court in In re Wands, 8 USPQ2d 1400 (Fed. Cir. 1988). Wands states, on page 1404:
Factors to be considered in determining whether a disclosure would require undue experimentation have been summarized by the board in fx part Forman. They include (1 the quantity of experimentation necessary, (2) the amount of direction or guidance presented, (3) the presence or absence of working examples, (4) the nature of the invention, (5) the state of the prior art, (6) the relative skill of these in the art, (7) the predictability or unpredictability of the art, and (8) the breadth of the claims.
The claims are broadly drawn to “A method of preventing or reducing the effects of cachexia in a cancer patient, said method comprising
measuring IGFBP1 blood levels in said cancer patients to detect cancer patients with elevated IGFBP1 levels relative to disease free patients;
administering an inhibitor of IGFBP1 to said cancer patients having elevated IGFPB1 levels, to reduce IGFBP1 blood levels and prevent or reduce the effects of cachexia in said patients identified as having elevated IGFPB 1 levels.”
The state of the art. the unpredictability of the art. and the relative skill
of the ordinary artisan:
It is well established in the art that administration of a wide therapeutics are able to treat a cancer and reduce the symptoms of that disease in a subject.
Disclosures such as Gaudreau ( Gaudreau, P. et al. WO 2009/009727 A2; published January 15, 2009), and McCaffery (McCaffery, I. et al. WO 2012/106556 A2; published August 9, 2012; cited on IDS filed 03/01/2024) are examples of researches and works in prior art, where subjects suffering of wasting syndrome and cachexia, some associated with cancer, are treated with different compositions, antibodies and/or synthetic peptides, in an effort to reduce the symptoms of cachexia associated with advanced disease.
Generally, a variety of cancer therapeutics can be prepared and administered to a subject to treat the cancer itself; by treating the disease, one can hope to reduce the effect of the disease progression when cachexia is the result of such progression (see. However, there are examples where cachexia is induced by the treatment of the disease, necessitating specific compounds (see Hain, B.A. et al. “Chemotherapy-induced loss of bone and muscle mass in a mouse model of breast cancer bone metastases and cachexia”. Journal of Cachexia, Sarcopenia and Muscle -Rapid Communication, Vol. 2, issue 1 (2018), p:e00075).
Therefore, prevention of cachexia by administration of a pharmaceutical composition comprising an inhibitor of one of the actor in complex signaling pathways is
unpredictable. Further, mere administration of such therapeutic agent at best ameliorates some of the symptoms of cachexia, but will not prevent the disease, since therapy for cancer depends on many individual traits inherent to the patient, such as the genetic background, the stage of the disease which also depends on time of diagnosis, socioeconomic and geographical factors of each subject, and the type of medication available to and required for that patient.
In addition, the skill of those in the relative art is high, but still, given the state and unpredictability of the art, undue experimentation would be required to determine if a symptom is prevented, or rather than just treated by administration of the claimed pharmaceutical composition.
Prevention of a symptom or effect of cachexia cannot be predictably accomplished, much less via the administration of a pharmaceutical composition comprising the claimed “random” inhibitor of IGFBP1.
Amount of experimentation required and the direction or guidance
presented:
In order to determine how to act, one of ordinary skill in the art would have to practice undue experimentation to determine if a symptom or effect of cachexia were prevented by a pharmaceutical composition comprising the claimed inhibitor of IGFBP1.
Since the treatment of the disease can be the cause of cachexia, reversing cachexia may not contribute to the health of the patient. And if the disease is the cause of cachexia, recurrence of the disease cannot necessarily be prevented, leading to further effects on cachexia and its symptoms.
Even if an effective therapeutic pharmaceutical composition comprising the claimed inhibitor was identified and administered to a subject, the result would be just that: reducing the symptoms of cachexia in a subject.
The ability to administer a composition to a subject having cachexia is not representative of the ability to predictably make and use the invention.
In addition, the specification, as filed, fails to provide any particular direction or guidance for prevention in a subject.
Nature of the invention, the presence or absence of working examples,
And the breadth of the claims:
While the specification does provide potential for the treatment of cachectic subjects, it fails to disclose how to prevent cachexia, as encompassed by the claims. Because claim 9 requires that cachexia be prevented by the administration of a pharmaceutical composition comprising the claimed inhibitor of IGFBP1, rather than
only treat so as to ameliorate and reduce symptoms, the specification does not provide any disclosure to enable the claims over their full scope.
In view of the lack of the predictability of the art to which the invention pertains, undue experimentation is required to make and use the claimed invention to prevent cachexia in a subject, or recurrence thereof, with a reasonable expectation of success. Because the specification does not contain a detailed description of how to make and use the method based on administration of pharmaceutical composition comprising the claimed inhibitor, absent of working examples that provide evidence that is reasonably predictive of the ability of preventing cachexia, with all its symptoms, the claims are not enabled commensurate in scope with the claimed invention.
Claims 10-15 depend on claim 9, however they do not remedy the specific deficiency of claim 9. Therefore, the claims 10-15 are rejected as well.
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claims 1, 7 and 8 are rejected under 35 U.S.C. §102(a)(1) as being
anticipated by Lundholm (Lundholm, K. et al. “Insulin treatment in cancer cachexia: effects on survival, metabolism, and physical functioning.” Clinical Cancer Research, Vol. 13, No. 9 (2007), pp: 2699-2706), as evidenced by Unterman (Unterman, T.G. et al. “Multihormonal regulation of Insulin-Like Growth Factor-Binding Protein-1 in rat H4IIE Hepatoma cells: the dominant role of insulin”. Endocrinology, Vol. 128, No. 6 (1991), pp: 2693-2701) and Lin (Lin, Y.-W. et al. “IGFBP-1 in cancer: expression, molecular mechanisms, and potential clinical implications”. American Journal of Translational Research, Vol. 13, No. 3 (March 2021), pp: 813-832).
Regarding claim 1, it recites “A method of treating cachexia in a subject, said method comprising administering a therapeutically effective amount of an inhibitor of IGFBP1”.
Lundholm teaches a method of treating cancer-induced cachexia using daily insulin treatment to attenuate the progression of weight loss and improve metabolism and physical functioning (see title and abstract).
As evidenced by Unterman, insulin is a repressor/inhibitor of IGFBP-1 gene expression; Unterman teaches that insulin rapidly lowers the abundance of IGFBP-1 mRNA and reduces production of IGFBP-1 by liver/hepatoma cells (see title, and abstract). Lin teaches that this effect is a direct effect, since there is an insulin response element (IRE) in the promoter region of IGFBP-1 gene (see Figure 1).
Regarding claim 7, Lundholm teaches selecting cachectic cancer patients with gastrointestinal cancers for the randomized controlled trial using insulin, i.e., inclusion criteria consisted of manifest weight loss due to malignant disease and solid tumor type (see page 2700, left column, first paragraph).
Regarding claim 8, Lundholm teaches subjects with advanced gastrointestinal malignancies (see page 2699, right column, “Study population” section). Lundholm teaches that the patients are at palliative care levels (Abstract), with comparable extents of generalized disease, i.e., frequency of liver and lung metastases (see page 2700, left column, first paragraph). Lundholm also teaches that among the patients, there are 15 that suffer from colorectal carcinoma (see page 2700, Table 1). Therefore, Lundholm teaches advanced colorectal carcinomas, which encompass metastatic colon cancers.
Therefore, Lundholm teaches the use of an inhibitor of IGFBP-1 as a therapeutic agent in the treatment of cachexia. Lundholm anticipates claims 1, 7, and 8.
Claims 1 and 7 are rejected under 35 U.S.C. §102(a)(1) as being anticipated by Lange (Lange, B.H. et al. WO 2005/097174 A2, published October 20, 2005), as evidenced by Ono (Ono, M. et al. “Signal Transducer and Activator of Transcription (Stat) 5b-mediated inhibition of Insulin-Like Growth Factor Binding Protein-1 gene transcription: a mechanism for repression of gene expression by Growth Hormone”. Molecular Endocrinology, Vol. 21, No. 6 (2007), pp: 1443-1457).
Regarding claim 1, it recites “A method of treating cachexia in a subject, said method comprising administering a therapeutically effective amount of an inhibitor of IGFBP1”.
Lange teaches a method of treating or preventing cachexia, stimulating appetite, food intake and/or weight gain in an individual in need thereof by administering a pharmaceutical composition comprising at least one secretagogue and at least one growth hormone (see abstract).
Ono teaches that growth hormone (GH) represses IGFBP1 gene expression (see title, and Figure 1A; see page 1444, left column, “Results” section, “GH inhibits IGFBP-1 gene transcription through Stat5b” section).
Therefore, GH is an indirect inhibitor of IGFBP-1 gene expression, as evidenced by Ono, and Lange teaches a method of treating cachexia using GH as part of a pharmaceutical composition.
Regarding claim 7, Lange teaches a method of treating or preventing cachexia (see abstract) and subjects having and diagnosed with cachexia (see page 2, lines 15-24).
Therefore, the elements of claims 1 and 7 are anticipated by Lange.
Claims 1 and 7 are rejected under 35 U.S.C. §102(a)(1) as being anticipated by Lee (Lee, J.-H. et al. “Lithium Chloride protects against sepsis-induced skeletal muscle atrophy and cancer cachexia”. Cells, Vol. 10 (April 2021), p: 1017 (1-17)) as evidenced by Lewitt (Lewitt, M.S. et al. “Lithium chloride inhibits the expression and secretion of insulin-like growth factor-binding protein-1”. Journal of Endocrinology, Vol. 171 (2001), pp: R11-R15).
Regarding claim 1, it recites “A method of treating cachexia in a subject, said method comprising administering a therapeutically effective amount of an inhibitor of IGFBP1”.
Lee teaches that Lithium chloride can be used at a therapeutically effective dose to treat inflammation-associated skeletal muscle wasting using in vitro and in vivo models of cancer cachexia and sepsis (see title and abstract; see pages 9 and 12, sections 3.5 and 3.7). Lee teaches that Lithium chloride treatment increases muscle mass and enhances muscle strength (see section 3.7, page 12).
As evidenced by Lewitt, Lithium chloride inhibits the expression and secretion of IGFBP-1 (see title and abstract). Therefore, Lewitt teaches that Lithium chloride is an indirect inhibitor of IGFBP-1. Lee anticipates claim 1.
Regarding claim 7, Lee teaches subjects that have cachexia (see page 5, section 2.13 “Animal Model of Cancer Cachexia”).
Therefore, the elements of claims 1 and 7 are anticipated by Lee.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claim 2 is rejected under 35 U.S.C. §103 as unpatentable over Lundholm (Lundholm, K. et al. “Insulin treatment in cancer cachexia: effects on survival, metabolism, and physical functioning.” Clinical Cancer Research, Vol. 13, No. 9 (2007), pp: 2699-2706), as evidenced by Unterman (Unterman, T.G. et al. “Multihormonal regulation of Insulin-Like Growth Factor-Binding Protein-1 in rat H4IIE Hepatoma cells: the dominant role of insulin”. Endocrinology, Vol. 128, No. 6 (1991), pp: 2693-2701) and Lin (Lin, Y.-W. et al. “IGFBP-1 in cancer: expression, molecular mechanisms, and potential clinical implications”. American Journal of Translational Research, Vol. 13, No. 3 (March 2021), pp: 813-832), as applied to claim 1 above and in further view of Ye (Ye, H. et al. “Subversion of systemic glucose metabolism as a mechanism to support the growth of Leukemia cells”. Cancer Cell, Vol. 34 (2018), pp: 659-673).
Regarding claim 1, it recites “A method of treating cachexia in a subject, said method comprising administering a therapeutically effective amount of an inhibitor of IGFBP1”.
Lundholm teaches a method of treating cancer-induced cachexia using daily insulin treatment to attenuate the progression of weight loss and improve metabolism and physical functioning (see title and abstract).
As evidenced by Unterman, insulin is a repressor/inhibitor of IGFBP-1 gene expression; Unterman teaches that insulin rapidly lowers the abundance of IGFBP-1 mRNA and reduces production of IGFBP-1 by liver/hepatoma cells (see title, and abstract). Lin teaches that this effect is a direct effect, since there is an insulin response element (IRE) in the promoter region of IGFBP-1 gene (see Figure 1). See below (arrow indicates position of IRE in promoter region):
PNG
media_image1.png
272
678
media_image1.png
Greyscale
Therefore, the combination of Lundholm, Unterman and Lin teaches the elements of claim 1.
Regarding claim 2, Lundholm, Unterman and Lin do not teach the use of an antibody specific to IGFBP1 to treat cachexia.
However, Ye teaches the role of IGFBP1 in the development of leukemia (see abstract). Ye also teaches that treating leukemia model mice (BN mice) with insulin decreases leukemia burden in bone marrow and gonadal adipose tissue (see Figure 1 (I)).
Ye teaches that BN mice present with lower serum insulin levels (see Figure 1G) and increased IGFBP1 serum level (see Figure 2B).
Ye teaches treating leukemic mice with a specific IGFBP1 antibody decreases leukemia burden in gonadal adipose tissue, reduces bone loss and overall body weight loss ( see page 663, right column, “Modulation of IGFBP1 mediates leukemia growth in vivo” section, first and second paragraphs; see Figure 3).
Ye teaches that leukemic tumors induce production of IGFBP1, which in turns facilitates disease progression by modulating host insulin sensitivity and peripheral insulin levels (see page 663, right column, “Modulation of IGFBP1 mediates leukemia growth in vivo” section, 5th paragraph).
Ye also teaches that the leukemic mice present with an insulin-resistant phenotype (see page 663, left column, last line).
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have substituted the insulin used for treating cachectic subjects as taught by Lundholm/Unterman/Lin, to anti-IGFBP1 antibodies as taught by Ye, to directly block IGFBP1 and its negative effect on cancer growth and disease progression. One with ordinary skills in the art motivated in improving on the treatment of cachectic cancer subjects with insulin-resistance phenotype, could have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention.
Claims 3-4 are rejected under 35 U.S.C. §103 as unpatentable over Lundholm (Lundholm, K. et al. “Insulin treatment in cancer cachexia: effects on survival, metabolism, and physical functioning.” Clinical Cancer Research, Vol. 13, No. 9 (2007), pp: 2699-2706), as evidenced by Unterman (Unterman, T.G. et al. “Multihormonal regulation of Insulin-Like Growth Factor-Binding Protein-1 in rat H4IIE Hepatoma cells: the dominant role of insulin”. Endocrinology, Vol. 128, No. 6 (1991), pp: 2693-2701) and Lin (Lin, Y.-W. et al. “IGFBP-1 in cancer: expression, molecular mechanisms, and potential clinical implications”. American Journal of Translational Research, Vol. 13, No. 3 (March 2021), pp: 813-832), as applied to claim 1 above and in further view of Ye (Ye, H. et al. “Subversion of systemic glucose metabolism as a mechanism to support the growth of Leukemia cells”. Cancer Cell, Vol. 34 (2018), pp: 659-673), Ammoun (Ammoun, S. et al. “Insulin-like growth factor protein-1 (IGFBP-1) regulates human schwannoma proliferation, adhesion and survival”. Oncogene, Vol. 31 (2012), pp: 1710-1722) and Luo (Luo, C. et al. “Insulin-like growth factor binding protein-1 (IGFBP-1) upregulated by Helicobacter pylori and is associated with gastric cancer cells migration”. Pathology - Research and Practice, Vol. 213 (2017), pp: 1029-1036).
Regarding claim 1, it recites “A method of treating cachexia in a subject, said method comprising administering a therapeutically effective amount of an inhibitor of IGFBP1”.
Lundholm teaches a method of treating cancer-induced cachexia using daily insulin treatment to attenuate the progression of weight loss and improve metabolism and physical functioning (see title and abstract).
As evidenced by Unterman, insulin is a repressor/inhibitor of IGFBP-1 gene expression; Unterman teaches that insulin rapidly lowers the abundance of IGFBP-1 mRNA and reduces production of IGFBP-1 by liver/hepatoma cells (see title, and abstract). Lin teaches that this effect is a direct effect, since there is an insulin response element (IRE) in the promoter region of IGFBP-1 gene (see Figure 1). See below (arrow indicates position of IRE in promoter region):
PNG
media_image1.png
272
678
media_image1.png
Greyscale
Therefore, the combination of Lundholm, Unterman and Lin teaches the elements of claim 1.
Regarding claims 3-4, Lundholm, Unterman and Lin do not teach targeting IGFBP1 directly.
However, Ye teaches the role of IGFBP1 in the development of leukemia (see abstract). Ye also teaches that treating leukemia model mice (BN mice) with insulin decreases leukemia burden in bone marrow and gonadal adipose tissue (see Figure 1 (I)).
Ye teaches that BN mice present with lower serum insulin levels (see Figure 1G) and increased IGFBP1 serum level (see Figure 2B).
Ye teaches treating leukemic mice with a specific IGFBP1 antibody decreases leukemia burden in gonadal adipose tissue, reduces bone loss and overall body weight loss ( see page 663, right column, “Modulation of IGFBP1 mediates leukemia growth in vivo” section, first and second paragraphs; see Figure 3).
Ye teaches that leukemic tumors induce production of IGFBP1, which in turns facilitates disease progression by modulating host insulin sensitivity and peripheral insulin levels (see page 663, right column, “Modulation of IGFBP1 mediates leukemia growth in vivo” section, 5th paragraph).
Ye also teaches that the leukemic mice present with an insulin-resistant phenotype (see page 663, left column, last line).
Therefore, it would have been obvious to one with ordinary skills in the art, before the effective filing date of the claimed invention, to have substituted the insulin used for treating cachectic subjects as taught by Lundholm/Unterman/Lin, to anti-IGFBP1 antibodies leading to direct blockade of IGFBP1 as taught by Ye, to block IGFBP1 and its negative effect on cancer growth and disease progression. One with ordinary skills in the art motivated in improving on the treatment of cachectic cancer subjects with insulin-resistance phenotype, could have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention.
The combination of Lundholm/Unterman/Lin and Ye does not teach an inhibitor that is an interference oligomer that has a nucleobase sequence, nor an siRNA or an miRNA; the combination of Lundholm/Unterman/Lin and Ye does not teach an inhibitor that “is an interference oligomer that binds to
i) a nucleobase sequence of SEQ ID NO: 2, or a complete complement thereof, or
ii) a contiguous 10, 15, 17, 20 or 25 bp or longer fragment sequence of SEQ ID NO: 2 or a corresponding complement thereof.”
However, Ammoun teaches that IGFBP-1 stimulates proliferation, adhesion and survival of schwannoma cells (see title). Ammoun teaches short hairpin RNA to knockdown IGFBP-1 gene expression, and that can bind and target IGFBP-1 mRNA for inhibition (see Abstract; see page 1720, left column, “Lentiviral shRNA knockdown” section). Ammoun also teaches that these shRNAs targeting IGFBP-1 are commercially available (V2LHS_236986 & V3HLS_390996 purchased from Open Biosystems Products (Huntsville, AL, USA); see page 1720, left column, “Lentiviral shRNA knockdown” section and right column, first paragraph).
Luo teaches the role of IGFBP1 in gastric cancer (see title). Luo teaches that IGFBP-1 is upregulated by Helicobacter pylori, which is responsible for gastric cancer formation (see title and abstract). Although the effects of IGFBP1 seem to be more complex and dependent on the presence of Helicobacter pylori, leading to different outcome on disease progression, Luo teaches silencing IGFBP1 using siRNAs (see abstract; see page 1030, Table 1 and section 2.4 “Knockdown of IGFBP-1 using siRNA”); see Table 1 below:
PNG
media_image2.png
250
398
media_image2.png
Greyscale
The result of an alignment of instant SEQ ID NO: 2 sequence (Qy =Query; 780 base pairs) to Luo’s IGFBP-1 siRNA-1 sense (see Table 1, page 1030) (Db = Database) is shown below:
Query Match 2.5%; Score 19.4; DB 1; Length 21;
Best Local Similarity 95.2%;
Matches 20; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 605 ACCTGCCAAACTGCAACAAGA 625
| |||||||||||||||||||
Db 21 AACTGCCAAACTGCAACAAGA 1
This alignment shows that Luo’s siRNA-1 sense strand is 95% identical locally to instant SEQ ID NO: 2 sequence from nucleotide 605 to nucleotide 625.
Therefore, the alignment shows that Luo teaches a double-stranded siRNA targeting IGFBP1 mRNA having 19 contiguous base pairs compared to the target sequence of instant SEQ ID NO: 2.
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have substituted the antibodies taught by Ye in the method of treating cancer cachexia taught by Lundholm, Unterman and Lin modified by Ye, with an antisense oligonucleotide targeting IGFBP1 mRNA as taught by Ammoun and Luo. It would be substituting one specific inhibitor for another using a method with sequences and designs known in the art. One with ordinary skills in the art motivated in blocking production of IGFBP1 at the transcriptional level, could have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention.
Claim 9 is rejected under 35 U.S.C. §103 as being unpatentable over Lundholm (Lundholm, K. et al. “Insulin treatment in cancer cachexia: effects on survival, metabolism, and physical functioning.” Clinical Cancer Research, Vol. 13, No. 9 (2007), pp: 2699-2706), as evidenced by Unterman (Unterman, T.G. et al. “Multihormonal regulation of Insulin-Like Growth Factor-Binding Protein-1 in rat H4IIE Hepatoma cells: the dominant role of insulin”. Endocrinology, Vol. 128, No. 6 (1991), pp: 2693-2701) and Lin (Lin, Y.-W. et al. “IGFBP-1 in cancer: expression, molecular mechanisms, and potential clinical implications”. American Journal of Translational Research, Vol. 13, No. 3 (March 2021), pp: 813-832), and in view of Thomas (Thomas, D.K. et al. US 2018/0355033 A1; published December 13, 2018).
Regarding claim 9, it recites “A method of preventing or reducing the effects of cachexia in a cancer patient, said method comprising
measuring IGFBP1 blood levels in said cancer patients to detect cancer patients with elevated IGFBP1 levels relative to disease free patients;
administering an inhibitor of IGFBP1 to said cancer patients having elevated IGFPB1 levels, to reduce IGFBP1 blood levels and prevent or reduce the effects of cachexia in said patients identified as having elevated IGFPB1 levels.”
Regarding claim 9, Lundholm teaches a method of treating cancer-induced cachexia using daily insulin treatment to attenuate the progression of weight loss and improve metabolism and physical functioning (see title and abstract).
As evidenced by Unterman, insulin is a repressor/inhibitor of IGFBP-1 gene expression; Unterman teaches that insulin rapidly lowers the abundance of IGFBP-1 mRNA and reduces production of IGFBP-1 by liver/hepatoma cells (see title, and abstract). Lin teaches that this effect is a direct effect, since there is an insulin response element (IRE) in the promoter region of IGFBP-1 gene (see Figure 1). See below (arrow indicates position of IRE in promoter region):
PNG
media_image1.png
272
678
media_image1.png
Greyscale
Therefore, the combination of Lundholm, Unterman and Lin teaches the treatment of cachexia elements of claim 9.
The combination of Lundholm, Unterman and Lin does not teach about measuring IGFBP1 blood levels in cancer patients, however, Thomas teaches compositions, antibodies and screening methods for identifying and treating cachexia or pre-cachexia (see title).
Thomas teaches identifying subjects with cachexia or pre-cachexia by measuring plasma levels of cachexia-inducing factors comprising IGFBP-1 (see [0295]-[0296]):
PNG
media_image3.png
208
354
media_image3.png
Greyscale
Therefore, Thomas teaches levels of blood IGFBP-1 as a cachexia marker for identifying subjects in need of treatment. Thomas also uses these markers to follow and monitor treatment outcome ( see [0291]-[0293], [0295], [0306]).
Therefore, it would have been obvious to one with ordinary skills before the effective filing date of the claimed invention to have modified the method of treating cachexia taught by Lundholm, as evidenced by Unterman and Lin, adding steps for screening and monitoring that comprise measuring blood levels of IGFBP-1 protein as taught by Thomas. One with ordinary skills in the art motivated in reducing IGFBP-1 blood levels using an inhibitor of IGFBP-1 and reducing the effects of cachexia in subjects in need thereof, could have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention.
Claims 10, 11, 12 and 14 are rejected under 35 U.S.C. §103 as being unpatentable over Lundholm (Lundholm, K. et al. “Insulin treatment in cancer cachexia: effects on survival, metabolism, and physical functioning.” Clinical Cancer Research, Vol. 13, No. 9 (2007), pp: 2699-2706), as evidenced by Unterman (Unterman, T.G. et al. “Multihormonal regulation of Insulin-Like Growth Factor-Binding Protein-1 in rat H4IIE Hepatoma cells: the dominant role of insulin”. Endocrinology, Vol. 128, No. 6 (1991), pp: 2693-2701) and Lin (Lin, Y.-W. et al. “IGFBP-1 in cancer: expression, molecular mechanisms, and potential clinical implications”. American Journal of Translational Research, Vol. 13, No. 3 (March 2021), pp: 813-832), in view of Thomas (Thomas, D.K. et al. US 2018/0355033 A1; published December 13, 2018), as applied to claim 9 above, and in further view of Ye (Ye, H. et al. “Subversion of systemic glucose metabolism as a mechanism to support the growth of Leukemia cells”. Cancer Cell, Vol. 34 (2018), pp: 659-673), Ammoun (Ammoun, S. et al. “Insulin-like growth factor protein-1 (IGFBP-1) regulates human schwannoma proliferation, adhesion and survival”. Oncogene, Vol. 31 (2012), pp: 1710-1722) and Luo (Luo, C. et al. “Insulin-like growth factor binding protein-1 (IGFBP-1) upregulated by Helicobacter pylori and is associated with gastric cancer cells migration”. Pathology - Research and Practice, Vol. 213 (2017), pp: 1029-1036).
The rejection of claim 9 is described above. Therefore, the combination of references Lundholm, Unterman, Lin and Thomas renders elements of claim 9 obvious.
Regarding claim 10, the combination of references Lundholm, Unterman, Lin and Thomas does not render elements of claim 10 obvious, i.e., wherein the inhibitor is an antibody specific to IGFBP1.
However, Ye teaches the role of IGFBP1 in the development of leukemia (see abstract). Ye also teaches that treating leukemia model mice (BN mice) with insulin decreases leukemia burden in bone marrow and gonadal adipose tissue (see Figure 1 (I)).
Ye teaches that BN mice present with lower serum insulin levels (see Figure 1G) and increased IGFBP1 serum level (see Figure 2B).
Ye teaches treating leukemic mice with a specific IGFBP1 antibody decreases leukemia burden in gonadal adipose tissue, reduces bone loss and overall body weight loss ( see page 663, right column, “Modulation of IGFBP1 mediates leukemia growth in vivo” section, first and second paragraphs; see Figure 3).
Ye teaches that leukemic tumors induce production of IGFBP1, which in turns facilitates disease progression by modulating host insulin sensitivity and peripheral insulin levels (see page 663, right column, “Modulation of IGFBP1 mediates leukemia growth in vivo” section, 5th paragraph).
Ye also teaches that the leukemic mice present with an insulin-resistant phenotype (see page 663, left column, last line).
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have substituted the insulin used for treating cachectic subjects as taught by Lundholm/Unterman/Lin modified by Thomas, to anti-IGFBP1 antibodies leading to direct blockade of IGFBP1 as taught by Ye, to block IGFBP1 and its negative effect on cancer growth and disease progression. One with ordinary skills in the art motivated in improving on the treatment of cachectic cancer subjects with insulin-resistance phenotype, could have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention.
Regarding claims 11 and 12, the combination of Lundholm, Unterman, Lin, Thomas and Ye does not teach an inhibitor that is an interference oligomer that has a nucleobase sequence, nor an siRNA or an miRNA; the combination of Lundholm/Unterman/Lin and Ye does not teach an inhibitor that “is an interference oligomer that binds to
i) a nucleobase sequence of SEQ ID NO: 2, or a complete complement thereof, or
ii) a contiguous 10, 15, 17, 20 or 25 bp or longer fragment sequence of SEQ ID NO: 2 or a corresponding complement thereof.”
However, Ammoun teaches that IGFBP-1 stimulates proliferation, adhesion and survival of schwannoma cells (see title). Ammoun teaches short hairpin RNA to knockdown IGFBP-1 gene expression, and that can bind and target IGFBP-1 mRNA for inhibition (see Abstract; see page 1720, left column, “Lentiviral shRNA knockdown” section). Ammoun also teaches that these shRNAs targeting IGFBP-1 are commercially available (V2LHS_236986 & V3HLS_390996 purchased from Open Biosystems Products (Huntsville, AL, USA); see page 1720, left column, “Lentiviral shRNA knockdown” section and right column, first paragraph).
Luo teaches the role of IGFBP1 in gastric cancer (see title). Luo teaches that IGFBP-1 is upregulated by Helicobacter pylori, which is responsible for gastric cancer formation (see title and abstract). Although the effects of IGFBP1 seem to be more complex and dependent on the presence of Helicobacter pylori, leading to different outcome on disease progression, Luo teaches silencing IGFBP1 using siRNAs (see abstract; see page 1030, Table 1 and section 2.4 “Knockdown of IGFBP-1 using siRNA”); see Table 1 below:
PNG
media_image2.png
250
398
media_image2.png
Greyscale
The result of an alignment of instant SEQ ID NO: 2 sequence (Qy =Query; 780 base pairs) to Luo’s IGFBP-1 siRNA-1 sense (see Table 1, page 1030) (Db = Database) is shown below:
Query Match 2.5%; Score 19.4; DB 1; Length 21;
Best Local Similarity 95.2%;
Matches 20; Conservative 0; Mismatches 1; Indels 0; Gaps 0;
Qy 605 ACCTGCCAAACTGCAACAAGA 625
| |||||||||||||||||||
Db 21 AACTGCCAAACTGCAACAAGA 1
This alignment shows that Luo’s siRNA-1 sense strand is 95% identical locally to instant SEQ ID NO: 2 sequence from nucleotide 605 to nucleotide 625.
Therefore, the alignment shows that Luo teaches a double-stranded siRNA targeting IGFBP1 mRNA having 19 contiguous base pairs compared to the target sequence of instant SEQ ID NO: 2.
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention to have substituted the antibodies taught by Ye in the method of treating cancer cachexia taught by Lundholm, Unterman, Lin and Thomas modified by Ye, with an antisense oligonucleotide targeting IGFBP1 mRNA as taught by Ammoun or Luo. It would be substituting one specific inhibitor for another using a method with sequences and designs known in the art. One with ordinary skills in the art motivated in blocking production of IGFBP1 at the transcriptional level, could have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention.
Regarding claim 14, Thomas teaches embodiments that provides a therapeutic agent to treat cachexia with a viral vector system, e.g., AAV, retroviral, lentiviral (see [0030]-[0031]).
Ammoun teaches a lentiviral system to knockdown IGFBP1 using a shRNA and to infect schwannoma cells (see page 1720, left column, last paragraph ‘Lentiviral shRNA knockdown” section, right column first paragraph).
Therefore, it would have been obvious to one with ordinary skills in the art before the effective filing date of the claimed invention, to have used a viral vector, AAV or a lentiviral vector as taught by Thomas and Ammoun, to deliver the shRNA or siRNA targeting IGFBP1 mRNA as taught by Ammoun and Luo. One with ordinary skills in the art motivated in delivering an effective amount of the antisense oligonucleotide via viral particle infection could have performed this modification with a reasonable expectation of success and would have arrived at the claimed invention.
Allowable Subject Matter
Claims 5 and 6 are objected to as being dependent upon a rejected base claim but would be allowable if rewritten in independent form including all of the limitations of the base claim and any intervening claims.
Conclusion
Claims 5 and 6 are objected to. Claims 1-4 and 7-15 are rejected.
No Claim is allowed.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALEXANDRA G DACE DENITO whose telephone number is (703)756-4752. The examiner can normally be reached Monday-Friday, 8:30-5:00EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/A.D./Examiner, Art Unit 1636
/NANCY J LEITH/Primary Examiner, Art Unit 1636