Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Election/Restrictions
Applicant’s election of the species of SEQ ID NO: 661 and methyl 2-[2-[2-bromo-4-fluoro-5-[3-methyl-2,6-dioxo 4-(trifluoromethy)pyrimidin-1-yl]phenoxy]phenoxy]-²-methoxy-acetatein the reply filed on 06/29/2026 is acknowledged. Because applicant did not distinctly and specifically point out the supposed errors in the restriction requirement, the election has been treated as an election without traverse (MPEP § 818.01(a)).
Claims 1-7 are pending.
Claims 2-3 and 5 are withdrawn from consideration as being directed to the non-elected invention.
Claims 1, 4 and 6-7, with a nucleic acid encoding the PPO polypeptide of SEQ ID NO: 661 and methyl 2-[2-[2-bromo-4-fluoro-5-[3-methyl-2,6-dioxo 4-(trifluoromethy)pyrimidin-1-yl]phenoxy]phenoxy]-²-methoxy-acetatein, are examined in this office action.
Claim Rejections - 35 USC § 112
The following is a quotation of the first paragraph of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Claims 1-7 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention.
The claims are drawn to a method of controlling undesired vegetation at a plant cultivation site by providing a plant that that comprises at least one nucleic acid comprising a nucleotide sequence encoding a protoporphyrinogen oxidase (PPO) polypeptide which is resistant or tolerant to a PPO inhibiting herbicide and applying to said site an effective amount of the PPO inhibiting herbicide is any phenyl-uracil herbicide of formula (I); wherein the PPO polypeptide comprises SEQ ID NO: 661; said method, wherein said plant comprises at least one additional heterologous nucleic acid encoding a herbicide tolerant enzyme, and wherein the phenyl-uracil of formula one is applied with one or more additional herbicides.
The specification, however, describes a method of controlling undesired vegetation by transforming soybean plants with constructs comprising codon optimized nucleic acid sequence encoding SEQ ID NO: 661 that is tolerant to the phenyl-uracil herbicide of methyl 2-[2-[2-bromo-4-fluoro-5-[3-methyl-2,6-dioxo 4-(trifluoromethy)pyrimidin-1-yl]phenoxy]phenoxy]-²-methoxy-acetatein. The specification also describes nucleic acid sequences from difference sources encoding PPO polypeptides.
The specification fails to describe a representative species of the genus of PPO polypeptides that is tolerant to the genus of phenyluracil herbicides of formula (I) encompassed by the claims. Neither the specification nor the prior art provides structure-function correlation of the nucleic acid sequence encoding a PPO polypeptide and the tolerance to a phenyluracil. It is true that functionally defined claims can meet the written description requirement if a reasonable structure-function correlation is established, whether by the inventor as described in the specification or known in the art at the time of the filing date” (AbbVie, 759 F.3d at 1298, reiterating Enzo Biochem, Inc., 323 F.3d at 964)(emphasis added). However, in the instant application, there is insufficient evidence of such an established structure-function correlation.
The purpose of the written description is to ensure that the inventor had possession at the time the invention was made, of the specific subject claimed. For a broad generic claim, the specification must provide adequate written description to identify the genus of the claim.
“The test for sufficiency is whether the disclosure of the application relied upon reasonably conveys to skilled in the art that the inventor had possession of the claimed subject matter as of the filing date.” Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1351 (Fed. Cir. 2010). To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Lockwood v. Amer. Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997). “An applicant shows possession of the claimed invention by describing the claimed invention with all of its limitations. Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966”. While the written description requirement does not demand either examples or an actual reduction, actual “possession” or reduction to practice outside of the specification is not enough. Ariad Pharm., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1352 (Fed. Cir. 2010). Rather, it is the specification itself that must demonstrate possession. Id.
Therefore, the specification has not met either of the two elements of the written description requirement as set forth in the court's decision in Eli Lilly and has not shown her/his possession of the claimed genus at the time of the application.
Consequently, Therefore, the specification fails to sufficiently describe the claimed invention in such full, clear, concise, and exact terms that a skilled artisan would recognize that Applicant was in possession of the invention as broadly claimed at the time of filing.
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 1-7 are rejected under 35 U.S.C. 103 as being unpatentable over Evdokimov et al (US 10, 370, 677 B2) in view of each of Witchell et al (WO 2019/101551) and Tohyama et al (US 6, 451, 740).
The claims are drawn to a method of controlling undesired vegetation at a plant cultivation site by providing a plant that that comprises at least one nucleic acid comprising a nucleotide sequence encoding a protoporphyrinogen oxidase (PPO) polypeptide which is resistant or tolerant to a PPO inhibiting herbicide and applying to said site an effective amount of the PPO inhibiting herbicide is any phenyl-uracil herbicide of formula (I); wherein the PPO polypeptide comprises SEQ ID NO: 661; said method, wherein said plant comprises at least one additional heterologous nucleic acid encoding a herbicide tolerant enzyme, and wherein the phenyl-uracil of formula one is applied with one or more additional herbicides.
Evdokimov et al teach a method of controlling unwanted vegetation by providing a plant comprising a nucleotide sequence encoding a PPO polypeptide that confers tolerance to phenyl herbicides and to at least one other herbicide; cultivating said plants in a growing site; and applying the herbicide to said site; wherein said PPO polypeptide is 100% identical to Applicant’s SEQ ID NO: 661 ( at least claim 17) and attached alignment of sequences.
Evdokimov et al do not explicitly teach the phenyluracil herbicide of formula (I). However, given the broad scope of the phenyluracil of formula (I) as recited in claim 1, the phenyluracils of the prior art as evidenced by Witchell et al.
Witchell et al teach the compound of Formula (I) of claim 1 (page 43) and a method of controlling growth of undesired vegetation or weeds by applying said phenyluracil in combination with other herbicides on the site of crop growth. The saflufenacil (B.94) on Table B of page 53 is an example of phenyluracil.
Tohyama et al teach compound formula (I) and methods for controlling weeds by applying effective amount of said compound to the weeds or its growing site with crops such as soybean, corn or wheat. Compound S-27 on Table 5 at column 94 reads the claimed compound of formula I (see claim 1).
Therefore, it would have been obvious to one of skill in the art before the effective filing date of the instantly claimed invention to use the method of controlling unwanted vegetation such as weeds by cultivating a plant comprising a nucleotide sequence encoding the PPO polypeptide of SEQ ID NO: 661 that confers tolerance to phenyl herbicides and to at least one other herbicide at the growing site as taught by Evdokimov et al , and to modify that method by incorporating the phenyl uracil taught by Witchell et al or Tohyama et al, given its availability and given that phenyluracil herbicides are important agricultural tools that function as potent PPO inhibitors as taught by Witchell et al. Therefore, the claimed invention as whole is a prima facie obvious, absent evidence to the contrary.
RESULT 1
US-15-224-276-49
(NOTE: this sequence has 7 duplicates in the database searched)
Sequence 49, US/15224276
Patent No. 10370677
GENERAL INFORMATION
APPLICANT: Monsanto Technology LLC
TITLE OF INVENTION: Methods and Compositions for Herbicide Tolerance in Plants
FILE REFERENCE: MONS:383US
CURRENT APPLICATION NUMBER: US/15/224,276
CURRENT FILING DATE: 2016-07-29
PRIOR APPLICATION NUMBER: US 62/200,428
PRIOR FILING DATE: 2015-08-03
NUMBER OF SEQ ID NOS: 63
SEQ ID NO 49
LENGTH: 537
TYPE: DNA
ORGANISM: Artificial Sequence
FEATURE:
OTHER INFORMATION: Recombinant
Length: 537
Score: 942.00 Matches: 178
Percent Similarity: 100.0% Conservative: 0
Best Local Similarity: 100.0% Mismatches: 0
Query Match: 100.0% Indels: 0
Gaps: 0
US-18-689-022-661 (1-178) x US-15-224-276-49 (1-537)
Qy 1 LysAlaLeuValLeuTyrSerThrArgAspGlyGlnThrHisAlaIleAlaSerTyrIle 20
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 1 AAGGCCTTGGTACTGTACTCGACGCGGGACGGCCAGACCCACGCAATTGCTTCATACATC 60
Qy 21 AlaSerCysMetLysGluLysAlaGluCysAspValIleAspLeuThrHisGlyGluHis 40
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 61 GCCTCCTGCATGAAGGAGAAGGCCGAATGCGACGTGATCGACCTCACCCACGGGGAGCAC 120
Qy 41 ValAsnLeuThrGlnTyrAspGlnValLeuIleGlyAlaSerIleArgTyrGlyHisPhe 60
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 121 GTGAACCTCACCCAATACGATCAGGTGCTAATCGGTGCGAGTATTCGTTACGGCCACTTC 180
Qy 61 AsnAlaValLeuAspLysPheIleLysArgAsnValAspGlnLeuAsnAsnMetProSer 80
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 181 AACGCCGTGCTTGACAAGTTCATCAAGAGAAACGTGGATCAGCTGAACAACATGCCAAGC 240
Qy 81 AlaPhePheCysValAsnLeuThrAlaArgLysProGluLysArgThrProGlnThrAsn 100
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 241 GCGTTCTTCTGCGTAAACCTCACGGCAAGGAAGCCCGAGAAGCGTACTCCCCAGACAAAC 300
Qy 101 ProTyrValArgLysPheLeuLeuAlaThrProTrpGlnProAlaLeuCysGlyValPhe 120
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 301 CCTTATGTCCGAAAATTCTTGCTTGCTACCCCCTGGCAGCCCGCGTTGTGCGGAGTGTTC 360
Qy 121 AlaGlyAlaLeuArgTyrProArgTyrArgTrpIleAspLysValMetIleGlnLeuIle 140
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 361 GCAGGGGCCCTTCGGTACCCGCGATACCGGTGGATCGACAAGGTGATGATCCAGCTAATA 420
Qy 141 MetArgMetThrGlyGlyGluThrAspThrSerLysGluValGluTyrThrAspTrpGlu 160
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 421 ATGCGGATGACTGGGGGAGAGACAGACACGAGCAAGGAGGTCGAGTACACGGATTGGGAG 480
Qy 161 GlnValLysLysPheAlaGluAspPheAlaLysLeuSerTyrLysLysAlaLeu 178
||||||||||||||||||||||||||||||||||||||||||||||||||||||
Db 481 CAGGTTAAGAAGTTCGCGGAGGATTTTGCAAAGCTATCGTACAAGAAGGCCCTC 534
Conclusion
No claim is allowed.
Contact Information
Any inquiry concerning this communication or earlier communications from the examiner should be directed to MEDINA AHMED IBRAHIM whose telephone number is (571)272-0797. The examiner can normally be reached Monday-Friday, 9:00 - 6:00.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, BRATISLAV STANKOVIC can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
MEDINA AHMED. IBRAHIM
Primary Examiner
Art Unit 1662
/MEDINA A IBRAHIM/ Primary Examiner, Art Unit 1662
Prosecution Insights