Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
DETAILED ACTION
Status of the Application
Claims 1-19 are pending and are currently under examination.
Information Disclosure Statement
The submission of the Information Disclosure Statement on12/16/2024 is in compliance with 37 CFR 1.97. The information disclosure statement has been considered by the examiner and signed copies have been placed in the file.
The information disclosure statement filed on 03/12/2024 fails to comply with the provisions of 37 CFR 1.97, 1.98 and MPEP § 609 because of the following reasons:
The NPL CA on IDS 03/12/2024 is not translated in English and has not been considered. The remainer of the documents have been considered by the examiner and signed copies have been placed in the file.
Priority
Receipt is acknowledged of papers submitted under 35 U.S.C. 119(a)-(d), which papers have been placed of record in the file. However, applicant cannot rely on the foreign priority document to overcome any prior art rejections because translation of the foreign priority document has not been made of record in accordance to 37 CFR 1.55. As such, for prior art purposes, the priority date is 03/12/2024.
Specification
The use of the term GENBANK, which is a trade name or mark used in commerce, has been noted in this application in [0053]. Each term should be accompanied by the generic terminology; furthermore each term should be capitalized wherever it appears or, where appropriate, include a proper symbol indicating use in commerce such as ™, SM , or ® following the term.
Although the use of trade names and marks used in commerce (i.e., trademarks, service marks, certification marks, and collective marks) are permissible in patent applications, the proprietary nature of the marks should be respected and every effort made to prevent their use in any manner which might adversely affect their validity as commercial marks.
Claim Rejections – Improper Markush
Claims 12-14 are rejected on the judicially-created basis that it contains an improper Markush grouping of alternatives. See In re Harnisch, 631 F.2d 716, 721-22 (CCPA 1980) and Ex parte Hozumi, 3 USPQ2d 1059, 1060 (Bd. Pat. App. & Int. 1984). The improper Markush grouping includes species of the claimed invention that do not share both a substantial structural feature and a common use that flows from the substantial structural feature. The members of the improper Markush grouping do not share a substantial feature and/or a common use that flows from the substantial structural feature for the following reasons:
Claims 12-14 are directed to a large multitude of sequences targeting cancer genes and regions of cancer genes that have no common searchable structure. Although the sequences are made up of the same four bases, they do not share any significant similarity in the order in which those bases are arranged. Thus, the structures of the sequences are different.
When the Markush grouping is for alternatives of chemical compounds, they shall be regarded as being of a similar nature where the following criteria are fulfilled:
(A) All alternatives have a common property or activity; and
(B) (1) A common structure is present, i.e., a significant structural element is shared by all of the alternatives; or
(B) (2) In cases where the common structure cannot be the unifying criteria, all alternatives belong to a recognized class of chemical compounds in the art to which the invention pertains.
In paragraph (B)(1), above, the words “significant structural element is shared by all of the alternatives” refer to cases where the compounds share a common chemical structure which occupies a large portion of their structures, or in case the compounds have in common only a small portion of their structures, the commonly shared structure constitutes a structurally distinctive portion in view of existing prior art, and the common structure is essential to the common property or activity. The structural element may be a single component or a combination of individual components linked together.
In paragraph (B)(2), above, the words “recognized class of chemical compounds” mean that there is an expectation from the knowledge in the art that members of the class will behave in the same way in the context of the claimed invention. In other words, each member could be substituted one for the other, with the expectation that the same intended result would be achieved.
In order for the members of the Markush group to belong to “recognized class of chemical compounds” there must be an expectation that the members of the class will behave in the same way in the context of the claimed invention. In other words, each member of the class could be substituted one for the other with the expectation that the same intended result would be achieved. In the instant case, activity of any specific nucleic acid molecule is dependent upon the specific sequence of nucleotides. Each of the sequences target different regions of a target cancer gene and have different levels of inhibition with some sequences not have any % inhibition (see Table 7). Therefore there is no expectation that any one of the nucleotide sequences as claimed can be substituted for any of the other with a completely different sequence with the expectation of the same activity such as inhibition of expression in a cancer gene.
In response to this rejection, Applicant should either amend the claim(s) to recite only individual species or grouping of species that share a substantial structural feature as well as a common use that flows from the substantial structural feature, or present a sufficient showing that the species recited in the alternative of the claims(s) in fact share a substantial structural feature as well as a common use that flows from the substantial structural feature. This is a rejection on the merits and may be appealed to the Board of Patent Appeals and Interferences in accordance with 35 U.S.C. 134 and 37 CFR 41.31(a)(1).
Claim Objections
Claim 2 is objected to because of the following informalities: The acronym WFDC2 appears to be misspelled as “WFDC” at the end of the claim. Appropriate correction is required
Claim Rejections - 35 USC § 102
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 1-3 and 17-19 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Moore et al. (US Patent No. 9,980,982).
Regarding claims 1-3, Moore et al. teach an antisense oligonucleotide 21 nucleotides in length that comprises phosphorothioate modification (col. 2) and is targeted to human epididymal secretion protein E4 (HE4) which is also known as WAP four-disulfide core domain 2 (WFDC2) as evidenced by Moore et al. (cited on IDS filed 12/16/2025).
Patent No. 9980982
APPLICANT: Moore, Richard G
SEQ ID NO 2
Query Match 3.7%; Score 21; Length 21;
Score over Length 100.0%;
Best Local Similarity 100.0%;
Matches 21; Conservative 0; Mismatches 0; Indels 0; Gaps 0;
SEQ ID No. 2 (target gene) 362 CAATGGCTGTGGGAAGGTGTC 382
SEQ 2 (antisense) 21 CAATGGCTGTGGGAAGGTGTC 1
Regarding claims 17-19, Moore et al. teach a pharmaceutical composition comprising the antisense in composition for administration to ovarian cancer cells (see page 4 col. 1 para 3).
With respect to the preamble of claims 17 and 19, a preamble is generally not accorded any patentable weight where it merely recites the purpose of a process or the intended use of a structure, and where the body of the claim does not depend on the preamble for completeness but, instead, the process steps or structural limitations are able to stand alone. See In re Hirao, 535 F.2d 67, 190 USPQ 15 (CCPA 1976) and Kropa v. Robie, 187 F.2d 150, 152, 88 USPQ 478, 481 (CCPA 1951).
Thus Moore et al. anticipates the instant claims.
Claim(s) 13 is rejected under 35 U.S.C. 102(a)(1) as being anticipated by Ren et al. (US Application 20200360439).
Ren et al. teach an oligonucleotide sequence having at least 18 nucleotides of instant SEQ ID No. 7.
Publication No. US20200360439A1
SEQ ID NO 59
LENGTH: 23
SEQ ID 59 3 GACAAGCAGGCATGGTGC 20
SEQ 7 6 GAGAAGCAGGCAGGGTGC 2
Thus Ren et al. anticipates the instant claim.
Claim Rejections - 35 USC § 103
In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status.
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
Claims 4-11 and 15-17 is/are rejected under 35 U.S.C. 103 as being unpatentable over Moore et al. (US Patent No. 9,980,982) in view of Manoharan et al. (US Application No. 20130130378).
Moore et al. is relied upon as above. Moore et al. do not teach the antisense oligonucleotide is modified as in claims 4-11.
Regarding claims 4-11 and 15-17, Manoharan et al. teach antisense oligonucleotide modifications such as sugar modifications, phosphorothioate linkages, LNA (0143-0151). Manoharan et al. teach the antisense oligonucleotide can be in a gapmer configuration with wings comprising 1-5 nucleosides (see 0259-0261). Manoharan et al. teach pseudouridine modifications (0046) and teach the antisense oligonucleotide can have a n acyclic monomer (0037-0042). Manoharan et al. teach conjugates that can be ligated to an antisense oligonucleotide to increase targeting (0060-0062) and teach pharmaceutical compositions comprising the antisense oligonucleotide (0365-0366).
With respect to the preamble of claim 17, a preamble is generally not accorded any patentable weight where it merely recites the purpose of a process or the intended use of a structure, and where the body of the claim does not depend on the preamble for completeness but, instead, the process steps or structural limitations are able to stand alone. See In re Hirao, 535 F.2d 67, 190 USPQ 15 (CCPA 1976) and Kropa v. Robie, 187 F.2d 150, 152, 88 USPQ 478, 481 (CCPA 1951).
Manoharan et al. teach these modifications are known to enhance stability and increase target specificity (0066) and it would have been obvious to one skilled in the art to try any of the above modifications to enhance the stability and specificity of the antisense taught by Moore et al. in efforts of finding a therapeutic for treatment of cancer.
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Claims 12-14 is/are rejected under 35 U.S.C. 103 as being unpatentable over Moore et al. (US Patent No. 9,980,982), Bennet et al. (US 2003/0054354 of record cited on 892 08/25/2025) and Zhang et al. ("Antisense technology." Cancer Gene Therapy. Totowa, NJ: Humana Press, 2005. 35-49).
Moore et al. teach human epididymal secretion protein E4 (HE4), which is also known as WAP four-disulfide core domain 2 (WFDC2), expression levels correlate with lower survival and chemoresistance in human ovarian cancer patients (page 1 3rd para and results page 2). Moore et al. found that inhibition of HE4 would suppress ovarian cancer cell and tumor growth and found that an antisense oligonucleotide, 19 nucleotides in length, was capable of decreasing expression and tumor growth in vitro. Moore et al. suggests HE4 is a potential target for treatment of ovarian cancer and thus it would have been obvious for one of ordinary skill in the art to make antisense oligonucleotides targeted to HE4 to elucidate a therapeutic capable of treatment of ovarian cancer.
Zhang et al teach that antisense technology has rapidly developed and been widely applied for investigating gene function and regulation, modulation of gene expression and validation of new drugs (see page 35). Zhang et al. teach there are well known reliable approaches to select an optimal antisense sequence, such as sequence-walking, from a known gene which has yielded good results or computer aided target selection which allows antisense to be designed to target regions of mRNA (see page 40).
Bennett et al. teach antisense oligonucleotides are preferably 12-30 nucleotides in length (0063), which encompasses the lengths of the claimed oligonucleotides, to inhibit a target gene function involved in various diseases. Bennett et al. teach the antisense oligonucleotide has a preferred modified backbone to include phosphonothioates (0066) and teach the antisense also includes 5-methylcytosine (0075) and bicyclic sugar moieties (see 0073). Bennett et al. teach gapmers (0081). Bennett et al. teach the antisense oligonucleotide can be in a pharmaceutical compositions for treatment (0098-0100) and teach using functional moieties to affect the efficient delivery of the antisense oligonucleotides to a cell or subject (0144).
The Genbank ® accession number of HE4/WFDC2 is NC_000020.11 and because Moore et al. demonstrates HE4/WFDC2 can be targeted with an antisense oligonucleotide and there is a need to find a treatment for ovarian cancer, it would have been obvious to one of ordinary skill in the art to use the methods as discussed in Zhang et al, to make antisense oligonucleotides targeted to HE4/WFDC2. Zhang et al. teach making antisense oligonucleotide by gene walking and thus the claimed specific claimed oligonucleotides would have been identified and given Zhang et al. teach it was routine to make and test these sequences for optimal activity, one of skill would have been capable of identifying antisense oligonucleotides to HE4/WFDC2.
In KSR International Co. v. Teleflex Inc., 550 U.S. 398 (2007), the Supreme Court held that "obvious to try" was a valid rationale for an obviousness finding, for example, when there is a "design need" or "market demand" and there are a "finite number" of solutions. 550 U.S. at 421 ("The same constricted analysis led the Court of Appeals to conclude, in error, that a patent claim cannot be proved obvious merely by showing that the combination of elements was ‘[o]bvious to try.’ ... When there is a design need or market pressure to solve a problem and there are a finite number of identified, predictable solutions, a person of ordinary skill has good reason to pursue the known options within his or her technical grasp. If this leads to the anticipated success, it is likely the product not of innovation but of ordinary skill and common sense. In that instance the fact that a combination was obvious to try might show that it was obvious under §103."). Thus, after KSR, the presence of a known result-effective variable would be one, but not the only, motivation for a person of ordinary skill in the art to experiment to reach another workable product or process.
Thus in the absence of evidence to the contrary, the invention as a whole would have been prima facie obvious to one of ordinary skill in the art at the time the invention was filed.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 12 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention.
Claim 12 recites "a modified oligonucleotide complementary to SEQ ID No. 1 or SEQ ID No. 2," but then recites the oligonucleotide is targeted to specific regions of SEQ ID No. 1. It is unclear how the modified oligonucleotide can be complementary to SEQ ID No. 2 and also be complementary to SEQ ID No. 1 at start site 11633 when SEQ ID No. 2 is only 567 nucleotides in length. The claims are interpreted for examination purposes as the modified oligonucleotide can be complementary to SEQ ID No. 2 or SEQ ID No. 1 at any of the specific start/stop sites.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(a):
(a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), first paragraph:
The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention.
Written Description
Claims 17-19 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention.
The MPEP states that the purpose of the written description requirement is to ensure that the inventor had possession, as of the filing date of the application, of the specific subject matter later claimed by him. The courts have stated:
To fulfill the written description requirement, a patent specification must describe an invention and do so in sufficient detail that one skilled in the art can clearly conclude that "the inventor invented the claimed invention." Lockwood v. American Airlines, Inc., 107 F.3d 1565, 1572, 41 USPQ2d 1961, 1966 (Fed. Cir. 1997); In re Gostelli, 872 F.2d 1008, 1012, 10 USPQ2d 1614, 1618 (Fed. Cir. 1989) ("[T]he description must clearly allow persons of ordinary skill in the art to recognize that [the inventor] invented what is claimed."). Thus an applicant complies with the written description requirement "by describing the invention, with all its claimed limitations, not that which makes it obvious" and by using "such descriptive means as words, structures, figures, diagrams, formulas, etc., that set forth the claimed invention." Lockwood, 107 F.3d at 1572, 41 USPQ2d at 1966; Regents of the University of California v. Eli Lilly & Co., 43 USPQ2d 1398.
The fundamental factual inquiry is whether the specification conveys with reasonable clarity to those skilled in the art that, as of the filing date sought, applicant was in possession of the invention as now claimed. See, e.g., Vas-Cath, Inc., 935 F.2d at 1563-64, 19 USPQ2d at 1117.
The MPEP lists factors that can be used to determine if sufficient evidence of possession has been furnished in the disclosure of the application. These include: (1) Actual reduction to practice, (2) Disclosure of drawings or structural chemical formulas, (3) Sufficient relevant identifying characteristics (such as: i. Complete structure, ii. Partial Structure, iii. Physical and/or chemical properties, iv. Functional characteristics when coupled with a known or disclosed structure, and v. Correlation between function and structure), (4) Method of making the claimed invention, (5) Level of skill and knowledge in the art, and (6) Predictability in the art.
Moreover, the written description requirement for a genus may be satisfied through sufficient description of a representative number of species by “…disclosure of relevant, identifying characteristics, i.e., structure or other physical and/or chemical properties, by functional characteristics coupled with a known or disclosed correlation between functional and structure, or by a combination of such identifying characteristics, sufficient to show the applicant was in possession of the claimed genus.” Thus when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus.
The claims are drawn to a modified oligonucleotide of 10-30 nucleotides in length targeted to a gene encoding WFDC2 in any cancer cell with the function of treating any type of cancer.
When determining whether the written description requirement is met for genus claims, it is first determined whether a representative number of species have been described by their complete structure. In the instant case, the specification describes antisense oligonucleotides targeted to WFDC2 having 20 nucleotides in length with the function of reducing expression in a glioblastoma cell line, a gastric cancer cell line and a pancreatic cancer cell line. These examples do not encompass the vast number of different modified antisense nucleotides having 10-30 nucleotides in length with the function of targeting WFDC2 in any type of cancer cell.
It is then determined whether a representative number of species have been sufficiently described by other relevant identifying characteristics (i.e. other than nucleotide sequence), specific features and functional attributes that would distinguish different members of the claimed genera. In the instant case, the specification describes antisense oligonucleotides 20 nucleotides in length targeted to WFDC2 with the function of reducing expression in a glioblastoma cell line, a gastric cancer cell line and a pancreatic cancer cell line. The specification demonstrate some of the antisense oligonucleotides were not capable of reducing expression in these cells types as indicated by 0% inhibition (Table 6). Such functional limitations cannot be the only identifying characteristics for the vast number of expression constructs claimed. The disclosure has not described an antisense oligonucleotide that represents the entire genus with the function of reducing the expression of WFDC2 in every cell cancer cell type. A review of the specification shows that it provides no description or guidance that would allow one of skill to distinguish the functional species of the recited structural genus from the non-functional members without empirical determination.
Since the disclosure and the prior art fail to describe the common attributes and characteristics concisely identifying members of the proposed genus, and because the claimed genus is highly variant a vast number of sequences of promoters and functional fragments of a Connexin 26 protein with the function of expression in any type of inner ear support cell, one of skill in the art would reasonably conclude that the disclosure fails to provide a representative number of species to describe the genus claimed.
"A sufficient description of a genus . . . requires the disclosure of either a representative number of species falling within the scope of the genus or structural features common to the members of the genus so that one of skill in the art can "visualize or recognize" the members of the genus" (AbbVie, 759 F.3d at 1297, reiterating Eli Lilly, 119 F.3d at 1568-69) (emphasis added).
Further, “Possession may not be shown by merely describing how to obtain possession of members of the claimed genus or how to identify their common structural features.” Ex parte Kubin, 83 USPQ2d 1410, 1417 (Bd. Pat. App. & Int. 2007) citing University of Rochester, 358 F.3d at 927, 69 USPQ2d at 1895. Vas-Cath Inc. v. Mahurkar, 19USPQ2d 1111, clearly states that “applicant must convey with reasonable clarity to those skilled in the art that, as of the filing date sought, he or she was in possession of the invention. The invention is, for purposes of the ‘written description’ inquiry, whatever is now claimed.” (See page 1117.) The specification does not “clearly allow persons of ordinary skill in the art to recognize that [he or she] invented what is claimed.” (See Vas-Cath at page 1116).
The MPEP further states that if a biomolecule is described only by a functional characteristic, without any disclosed correlation between function and structure of the sequence, it is “not sufficient characteristic for written description purposes, even when accompanied by a method of obtaining the claimed sequence.” MPEP 2163. The MPEP does state that for generic claim the genus can be adequately described if the disclosure presents a sufficient number of representative species that encompass the genus. MPEP 2163. If the genus has a substantial variance, the disclosure must describe a sufficient variety of species to reflect the variation within that genus. See MPEP 2163. Although the MPEP does not define what constitute a sufficient number of representative, the Courts have indicated what do not constitute a representative number species to adequately describe a broad generic. In Gosteli, the Court determined that the disclosure of two chemical compounds within a subgenus did not describe that subgenus. In re Gosteli, 872 F.2d at 1012, 10 USPQ2d at 1618.
Thus the specification and claims lack written description because it is clear that Applicant did not have possession of every variation of a modified antisense oligonucleotide of 10-30 nucleotides in length that can target WFDC2 in any cancer cell. The description requirement of the patent statute requires a description of an invention, not an indication of a result that one might achieve if one made that invention. See In re Wilder, 736 F.2d 1516, 1521,222 USPQ 369,372-372 (Fed. Cir. 1984) (affirming rejection because the specification does "little more than outlin[e] goals appellants hope the claimed invention achieves and the problems the invention will hopefully ameliorate."). Accordingly, it is deemed that the specification fails to provide adequate written description for the genus of the claims and does not reasonably convey to one skilled in the relevant art that the inventors, at the time the application was filed, had possession of the entire scope of the claimed invention.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the "right to exclude" granted by a patent and to prevent possible harassment by multiple assignees. See In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970);and, In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on a nonstatutory double patenting ground provided the reference application or patent either is shown to be commonly owned with this application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP §§ 706.02(l)(1) - 706.02(l)(3) for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/forms/. The filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to http://www.uspto.gov/patents/process/file/efs/guidance/eTD-info-I.jsp.
Claims 1-19 are provisionally rejected under the judicially created doctrine of double patenting over claims 1-21 of co-pending Application No. 19,472,399 (APP’399). This is a provisional double patenting rejection since the conflicting claims have not yet been patented. Although the conflicting claims are not identical, they are not patentably distinct from each other because the instant claims and the claims of the patent are drawn to patently indistinguishable subject matter.
The claims of co-pending APP’399 are drawn to a siRNA targeted to a gene encoding WFDC2 and methods of treating cancer. It would have been obvious to use the antisense oligonucleotide of the instant claims in the methods of APP’399. The prior art of Miyagishi et al. (Antisense and Nucleic Acid Drug Development, 2003, 13:1-7), Vickers et al. (The Journal of Biological Chemistry, 2003, 278:7108-7118, citation of record) and Dean et al. (Oncogene, 2003, 22:9087-9096) teach ASO and siRNA are functionally equivalent and that ASO and siRNAs can be designed to be targeted to the same target sites with a reasonable expectation to observe reduced target expression levels with both molecules.
It would have been obvious to one of ordinary skill in the art at the time the invention was made to substitute the siRNA of APP’399 with the instant antisense oligonucleotide because making both ASO compounds and siRNAs targeted to the same target sites of a gene was a known methodology in the art as taught by Miyagishi et al., Vickers et al., and Dean et al. above and because substituting art-recognized equivalents known for the same purpose is a well-established rationale in support of an obviousness rejection. See MPEP 2144.06.
This is a provisional obviousness-type double patenting rejection.
Conclusion
Any inquiry concerning this communication or earlier communications from the examiner should be directed to Kimberly Chong at (571)272-3111. The examiner can normally be reached Monday thru Friday between M-F 8:00am-4:30pm.
If attempts to reach the examiner by telephone are unsuccessful please contact the SPE for 1636 Neil Hammell at 571-272-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Patent applicants with problems or questions regarding electronic images that can be viewed in the Patent Application Information Retrieval system (PAIR) can now contact the USPTO’s Patent Electronic Business Center (Patent EBC) for assistance. Representatives are available to answer your questions daily from 6 am to midnight (EST). The toll free number is (866) 217-9197. When calling please have your application serial or patent number, the type of document you are having an image problem with, the number of pages and the specific nature of the problem. The Patent Electronic Business Center will notify applicants of the resolution of the problem within 5-7 business days. Applicants can also check PAIR to confirm that the problem has been corrected. The USPTO’s Patent Electronic Business Center is a complete service center supporting all patent business on the Internet. The USPTO’s PAIR system provides Internet-based access to patent application status and history information. It also enables applicants to view the scanned images of their own application file folder(s) as well as general patent information available to the public. For more information about the PAIR system, see http://pair-direct.uspto.gov.
For all other customer support, please call the USPTO Call Center (UCC) at 800-786-9199.
/KIMBERLY CHONG/
Primary Examiner Art Unit 1636
Prosecution Insights