Prosecution Insights
Last updated: October 01, 2026
Application No. 18/696,014

TREATMENT OF POLYCYTHEMIA VERA VIA CRISPR/AAV6 GENOME EDITING

Non-Final OA §103§112
Filed
Mar 27, 2024
Priority
Oct 05, 2021 — provisional 63/252,540 +1 more
Examiner
ZHU, JIANJIAN
Art Unit
1631
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Board of Trustees of the Leland Stanford Junior University
OA Round
1 (Non-Final)
59%
Grant Probability
Moderate
1-2
OA Rounds
1y 2m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 59% of resolved cases
59%
Career Allowance Rate
50 granted / 85 resolved
-1.2% vs TC avg
Strong +82% interview lift
Without
With
+82.4%
Interview Lift
resolved cases with interview
Typical timeline
3y 8m
Avg Prosecution
78 currently pending
Career history
160
Total Applications
across all art units

Statute-Specific Performance

§101
2.8%
-37.2% vs TC avg
§103
38.8%
-1.2% vs TC avg
§102
12.7%
-27.3% vs TC avg
§112
24.7%
-15.3% vs TC avg
Black line = Tech Center average estimate • Based on career data from 85 resolved cases

Office Action

§103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Election/Restriction Applicant’s election, without traverse, of Group I, claims 1, 3, 6-10, 12-13, 15, 17-26 and 36-37, drawn to a method of genetically modifying a HSPC comprising JAK2V617F mutation from a subject, in the reply filed on 05/14/2026 is acknowledged. Claims 27-28, 30 and 35 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to a nonelected invention, there being no allowable generic or linking claim. Claim Status Claims 1, 3, 6-10, 12-13, 15, 17-28, 30 and 35-37 are pending. Claims 27-28, 30 and 35 are withdrawn. Claims 1, 3, 6-10, 12-13, 15, 17-26 and 36-37 are considered on the merits. Priority This application is a 371 of PCT/US2022/077505 (filed on 10/04/2022), which claims benefit from provisional application 63/252,540 (filed on 10/05/2021). The priority claim of the instant application has been granted and the earliest benefit date is 10/05/2021 from the application 63/252,540. Information Disclosure Statement The information disclosure statement (IDS) submitted on 05/14/2026 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner. The corresponding signed and initialed PTO form 1449 has been mailed with this action. Specification Objections The disclosure is objected to because it contains an embedded hyperlink and/or other form of browser-executable code (e.g., page 22). Applicant is required to amend or delete the embedded hyperlink and/or other form of browser-executable code. For example, “www” can be replaced with “world wide web” and “http” can be replaced with “hypertext transfer protocol” as the URL code. See MPEP § 608.01. Objection to Drawings Sequence Compliance Figure 1 (nucleotide sequence around exon 12) of the Specification do not conform to sequence rules, requiring the use of “SEQ ID NO:” (37 CFR 1.821-1.825). Where the description or claims of a patent application discuss a sequence that is set forth in the “Sequence Listing” in accordance with paragraph (c) of this section, reference must be made to the sequence by use of the sequence identifier, preceded by “SEQ ID NO:” in the text of the description or claims, even if the sequence is also embedded in the text of the description (e.g., in figures) or claims of the patent application. 37 CFR 1.821 (d). The applicant is reminded that the specification must be amended in order to comply with regulations cited above. All references to sequences in claims and specification should be referred to as “SEQ ID NO:1”, for example. To avoid all doubts of the examiner and to ensure correct interpretation of the claims and specification, the identification of sequences with proper sequence identifiers is required. Any amended replacement drawing sheet should include all of the figures appearing on the immediate prior version of the sheet, even if only one figure is being amended. Each drawing sheet submitted after the filing date of an application must be labeled in the top margin as either “Replacement Sheet” or “New Sheet” pursuant to 37 CFR 1.121(d). If the changes are not accepted by the examiner, the applicant will be notified and informed of any required corrective action in the next Office action. The objection to the drawings will not be held in abeyance. Claim Objections Claims 1 and 15 are objected to because of the following informalities: Claim 1 recites both the terms “JAK2V617F” and “JAKV617F”. It is recommended to change the term “JAKV617F” (e.g., in lines 5, 6 and 8) to “JAK2V617F”. Furthermore, Claim 1 recites both the italic form (e.g., “JAK2V617F”) and regular form (e.g., “JAKV617F” in line 5). Since they all refer to the gene or polynucleotide, it is recommended to change the regular form to the italic form. Claim 15 recites the phrase “the mutation-specific RNA” in lines 1-2. It is recommended to change to “the mutation-specific guide RNA”. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claim 18 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 18 recites the phrase “High Fidelity Cas9”. A claim may be rendered indefinite by reference to term of an object that is variable (see MPEP 2173.05(b), II; see, e.g., Ex parte Miyazaki, 89 USPQ2d 1207 (Bd. Pat. App. & Inter. 2008) (precedential) and Ex parte Brummer, 12 USPQ2d 1653 (Bd. Pat. App. & Inter. 1989). In instant case, the recited “High Fidelity” is a relative term which renders the claim indefinite, because neither the claim nor the specification provides a special definition for this term. The specification only provides an example, that “the Cas9 is a high fidelity Cas9 (e.g., a high-fidelity SpCas9 variant as described in Vakulskas, et al., Nature Medicine (2018)), but does not specify the relationship between the structure and function of the Cas9. Thus, one of ordinary skill in the art would not be reasonably apprised of the scope of the invention. The phrase is being examined as a high-fidelity SpCas9 variant. Claim Rejections - 35 USC § 112(a) (Written Description) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 8-9 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. Under the written description guidelines (see MPEP 2163) the Examiner is directed to determine whether one skilled in the art would recognize that the Applicant was in possession of the claimed invention as a whole at the time of filing. The following considerations are critical to this determination. To satisfy the written description requirement, a patent specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. See, e.g., Moba, B.V. v. Diamond Automation, Inc., 325 F.3d 1306, 1319, 66 USPQ2d 1429, 1438 (Fed. Cir. 2003); Vas-Cath, Inc. v. Mahurkar, 935 F.2d at 1563, 19 USPQ2d at 1116. An original claim may lack written description support when (1) the claim defines the invention in functional language specifying a desired result but the disclosure fails to sufficiently identify how the function is performed or the result is achieved or (2) a broad genus claim is presented but the disclosure only describes a narrow species with no evidence that the genus is contemplated. See Ariad Pharms., Inc. v. Eli Lilly & Co., 598 F.3d 1336, 1349-50 (Fed. Cir. 2010) (en banc). The written description requirement is not necessarily met when the claim language appears in ipsis verbis in the specification. Enzo Biochem, Inc. v. Gen-Probe, Inc., 323 F.3d 956, 968, 63 USPQ2d 1609, 1616 (Fed. Cir. 2002). Accordingly, to satisfy the written description requirement, the specification must describe the claimed invention in sufficient detail that one skilled in the art can reasonably conclude that the inventor had possession of the claimed invention. Vas-Cath, Inc. v. Mahurkar, 935 F.2d 1555, 1562-63, 19 USPQ2d 1111 (Fed. Cir. 1991). See also MPEP 2163. SCOPE OF THE INVENTION Dependent claim 8 encompasses a genus of corrective JAK2 nucleotide sequence comprising a portion of exon 12 downstream of the site corresponding to the JAK2V617F mutation, and all of exons 13-23 of the wild-type JAK2 gene, of any species. In other words, the JAK2V617F mutation (G>T missense mutation, see Fig 1), from any species, is located in exon 12 (see Fig 1). However, prior art Smith et al., (Mol Ther. 2014;23(3):570-577. Cited in IDS 05/14/2026) evidences that the JAK2V617F mutation (G>T) in human is located in exon 14 (see Smith, Fig 1a). Thus, one of ordinary skill in the art would have immediately expected that the cited JAK2V617F G>T missense mutation would not be located in exon 12 in all species. Applicant is invited to provide limitation on a specific species or a genus of species in which the JAK2V617F G>T missense mutation is located in exon 12. Dependent claim 9 encompasses a genus of donor template (comprising the corrective JAK2 nucleotide sequence) comprising at least about 70% identity to SEQ ID NO: 4. However, the instant specification only provides a single species of this genus, i.e., the sequence of SEQ ID NO: 4, and only provides a prophetic example of using this template (see [0129], “We can generate clinical correction vectors that either: 1) directly correct the V617F mutation; 2) introduce the remaining JAK2 cDNA following the mutation; or 3) the remaining JAK2 cDNA followed by a constitutive PGK-tNGFR selection cassette (FIG. 6).” Emphasis added. It is noted that the vector 2 and vector 3 comprise the cited donor template comprising the sequence of SEQ ID NO: 4). Thus, the specification only provides a single species and lacks a working example. ACTUAL REDUCTION TO PRACTICE AND DISCLOSURE OF STRUCTURE As stated supra, claims 8 and 9 have a much broader scope compared to that is disclosed in the specification, and the specification does not provide a working example using the claimed genus of donor template. Thus, Applicant fails to show actual reduction to practice the broad scope as being claimed. Furthermore, neither the specification nor the art indicate a relationship between the structure of the claimed genus of donor template and the ability to correct the JAK2V617F mutation. SUFFICIENT RELEVANT IDENTIFYING CHARACTERISTICS If the skilled artisan sought to generate the claimed genus of donor template, they would first need to know which sequences in the donor template could be chosen to modify and still be able to predictably correct the JAK2V617F mutation and the polycythemia vera disease. The present specification provides no guidance nor description to any rational in choosing the sequences that could be modified; therefore the skilled artisan would not know what rational approach to take to make modifications with any predictable outcome on correcting the mutation and the disease. Therefore, it is incumbent on the applicant to provide this nexus between structure and function, in order to be given credit for possession of a larger genus of donor template. Otherwise, the Written Description guidelines suggest that the applicant is entitled to only the species specifically recited as having this activity. Moreover, even when several species are disclosed, these are not necessarily representative of the entire genus. AbbVie Deutschland GMBH v. Janssen Biotech, 111 USPQ2d 1780, 1790 (Fed. Cir. 2014). Thus, when there is substantial variation within the genus, one must describe a sufficient variety of species to reflect the variation within the genus to provide a "representative number” of species. An applicant may show that an invention is complete by disclosure of sufficiently detailed, relevant identifying characteristics which provide evidence that applicant was in possession of the claimed invention, i.e., complete or partial structure, other physical and/or chemical properties, functional characteristics when coupled with a known or disclosed correlation between function and structure, or some combination of such characteristics. Enzo Biochem, 323 F.3d at 964, 63 USPQ2d at 1613. STATE OF THE ART & QUANTITY OF EXPERIMENTATION The method of using the claimed invention is not well established. Although making a donor template with mutated nucleotide sequences is known, one of skill in the art would neither expect nor predict the ability to correct the JAK2V617F G>T missense mutation using any donor template according to the claimed genus of method as broadly as is claimed. As a first matter regarding claim 8, as stated supra, prior art Smith et al., (Mol Ther. 2014;23(3):570-577. Cited in IDS 05/14/2026) evidences that the JAK2V617F mutation (G>T) in human is located in exon 14 (see Smith, Fig 1a), thus makes it clear that not all JAK2V617F G>T missense mutations would have been located in exon 12. Applicant is invited to provide a specific species or a genus of species in which the JAK2V617F G>T missense mutation is located in exon 12 to obviate this rejection. Additionally, regarding claim 9, the specification discloses that JAK2 kinase associates with the erythropoietin (EPO) receptor and STAT transcription factors, and the JAK2V617F mutation (a single G>T missense mutation) leads to constitutive JAK2 activation wherein the kinase is active even in the absence of EPO binding, resulting in accelerated proliferation and differentiation of erythroid cells ([0004]). Thus, even a single nucleotide mutation in JAK2 causes polycythemia vera. The instant SEQ ID NO: 4 contains 1548 nucleotides, so 70% identity thereof would allow 464 nucleotides to be mutated to any nucleotide at any position in any combination, encompassing an astronomical amount of species. Thus, using any species of donor template to correct the JAK2V617F mutation is highly unpredictable. Applicant has claimed a genus of species that have the JAK2V617F mutation being located in exon 12, and a genus of donor template comprising at least about 70% identity to SEQ ID NO: 4, yet the specification has only disclosed one species having the sequence of exon 12 in instant Fig 1, and a single species of SEQ ID NO: 4 as the donor template. Independent of how these specific species were arrived upon by Applicant, any donor template that are introduced cannot predicably correct the JAK2V617F mutation. Because Applicant has no manner a priori to predict what modification can be done to correct the JAK2V617F mutation, the genus of donor template claimed by Applicant cannot be predictably made or used by the ordinary artisan. CONCLUSION The Examiner concludes that there is insufficient written description of the instantly claimed genus of corrective JAK2 nucleotide sequence comprising a portion of exon 12 from any species in which the JAK2V617F mutation is located in exon 12, and the claimed genus of donor template comprising at least about 70% identity to SEQ ID NO: 4. Specifically, Applicant has only provided one single species in which the JAK2V617F mutation is located in exon 12 in Fig 1, and one single species of the sequence of SEQ ID NO: 4. Thus, Applicant does not provide sufficient number of species to represent the entire scope of the claimed extremely broad genus, especially the genus of donor template. Therefore, the Examiner concludes that there is insufficient written description to show that Applicant was in possession of the claimed genus of corrective JAK2 nucleotide sequence or the claimed genus of donor template. Claim Rejections - 35 USC § 103 The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 1, 10, 12, 15, 17-26 and 36-37 are rejected under 35 U.S.C. 103 as being unpatentable over Smith et al., (Mol Ther. 2014;23(3):570-577. Cited in IDS 05/14/2026) in view of Kroger et al., (Blood. 2007;109:1316-1321) and Goodwin et al., (Sci Adv. 2020 May 6;6(19):eaaz0571, p. 1-17). With respect to claim 1, Smith teaches a method of genetically modifying a human induced pluripotent stem cell (iPSC) derived from a myeloproliferative neoplasm (i.e., polycythemia vera (PV)) patient that carries an acquired JAK2V617F point mutation by CRISPR-based gene editing (see e.g., abstract and Table 1). Smith acknowledges the therapeutic potential for cell therapy by human iPSCs realized by efficient and precise genome editing (e.g., abstract and p. 573, last para). However, Smith is silent on a hematopoietic stem and progenitor cell (HSPC). Kroger teaches a method of treating JAK2-V617F mutation-positive patients with myelofibrosis (a myeloproliferative disease, see abstract and p. 1316, “Introduction”, para 1) by transplantation of allogeneic CD34+ peripheral blood stem cells obtained from healthy donors (p. 1317, right col, last para. It is noted that the CD34+ peripheral blood stem cell is equivalent to the instantly claimed hematopoietic stem and progenitor cell (HSPC)). Kroger teaches 15 patients become JAK2-V617F negative after allogeneic stem cell transplantation (see p. 1319, left col, para 2 and Fig 3). Thus, Kroger teaches a cell therapy of treating JAK2-V617F mutation-positive disease by transplanting allogeneic wild-type HSPC comprising wild-type JAK2 gene. Goodwin teaches a therapeutic approach in which autologous hematopoietic stem and progenitor cells (HSPC) are gene edited by CRISPR-based gene editing ex vivo and reinfused (e.g., abstract). Goodwin teaches the method demonstrates the feasibility of gene correction, which will be instrumental for the development of therapeutic approaches for other genetic autoimmune diseases (e.g., abstract). Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have modified the method of genetically modifying a human iPSC comprising a JAK2V617F mutation from a myeloproliferative subject for cell therapy disclosed by Smith, by substituting the iPSC with an autologous hematopoietic stem and progenitor cell (HSPC) and combining a method of gene correction so as to generate an HSPC comprising wild-type JAK2 gene for cell therapy as suggested by Kroger and Goodwin with a reasonable expectation of success. Since Smith aims to develop an efficient and precise genome editing on a mutant iPSC to perform cell therapy on a myeloproliferative neoplasm with JAK2V617F mutation (e.g., abstract and p. 573, last para), since Kroger teaches transplanting allogeneic wild-type HSPC comprising wild-type JAK2 gene provides a cell therapy of treating JAK2-V617F mutation-positive myeloproliferative disease (see above), and since Goodwin teaches gene correction of autologous mutant HSPCs and reinfusion provide a therapeutic approach for genetic diseases (e.g., abstract), one of ordinary skill in the art would have had a reason to substitute an autologous mutant HSPC for the mutant iPSC and to combine a gene correction in order to generate an autologous HSPC comprising corrected wild-type JAK2 gene for treating JAK2-V617F mutation-positive myeloproliferative disease. Regarding the introducing step, Smith teaches “we cotransfected iPV183 with a homology donor template and either Cas9/gRNA-JAK2-F or Cas9/gRNA-JAK2-V” and “in all 49 clones with targeted integration at JAK2 locus, the integration events occurred only at the JAK2 allele specified by the gRNAs (Table 3)” (e.g., p. 573, last para.), thus teaches introducing into the iPSC an RNA-guided nuclease (i.e., Cas9), a donor template (i.e., a homology donor template), and a mutation-specific guide RNA (i.e., gRNA-JAK2-F, see Fig 4a) that specifically hybridizes to a mutant JAK2 polynucleotide comprising a JAK2V617F mutation, but does not hybridize to a wild-type JAK2 polynucleotide lacking the JAK2V617F mutation (i.e., the integration events occurred only at the JAK2 allele specified by the gRNAs). Regarding the donor template, Smith teaches “the donor vector used in homology recombination (HR)-based JAK2 targeting (Tables 2 and 3) is shown. The vertical arrow indicates the G>T point mutation in JAK2-V617F. …The vectors contain JAK2 homology arms flanking the putative Cas9-gRNA and TALEN cutting sites” (e.g., see Fig 1a attached below and its legend), thus teaches the donor template comprises a JAK2 nucleotide sequence (see the solid black bars in the “HR donor” below, corresponding to exon 14), flanked by a first homology arm corresponding to a JAK2 genomic sequence located upstream of the JAK2V617F mutation (i.e., the “HA-L” below, the left homology arm) and a second homology arm corresponding to a JAK2 genomic sequence located downstream of the JAK2V617F mutation (i.e., the “HA-R” below, the right homology arm). PNG media_image1.png 290 1123 media_image1.png Greyscale Although Smith does not specifically teach the donor template comprises a corrective JAK2 nucleotide sequence that comprises a wild-type sequence at the position of JAK2V617F mutation to correct the mutation, as stated supra, Smith aims to develop an efficient and precise genome editing on a mutant iPSC to perform cell therapy on a myeloproliferative neoplasm with JAK2V617F mutation (e.g., abstract and p. 573, last para), Kroger teaches a cell therapy of treating JAK2-V617F mutation-positive disease by transplanting allogeneic wild-type HSPC comprising wild-type JAK2 gene (above) and Goodwin reduces to practice a method of gene correction of autologous mutant HSPCs and reinfusion as a therapeutic approach and teaches this can be used for other genetic diseases (e.g., abstract). Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have combined the teachings of Kroger and Goodwin so as to use a donor template comprising a corrective JAK2 nucleotide sequence that comprises a wild-type sequence at the position of JAK2V617F mutation so as to obtain gene correction of an autologous HSPC comprising wild-type JAK2 gene with a reasonable expectation of success. One of ordinary skill in the art would have had a reason to do so in order to obtain a genetically corrected autologous HSPC comprising wild-type JAK2 gene for treating JAK2-V617F mutation-positive diseases. Regarding specific cleavage, Smith teaches “in all 49 clones with targeted integration at JAK2 locus, the integration events occurred only at the JAK2 allele specified by the gRNAs (Table 3)” (e.g., p. 573, last para.) and teaches guide RNA-JAK2-F directs Cas9 mediated integration only at mutant allele (see Table 3, row 1, 24/24 mutant allele integration), thus teaches the RNA-guided nuclease (i.e., Cas9) cleaves a mutant JAK2V617F gene in the genome of the cell but does not cleave a wild-type JAK2 gene in the genome of the cell (see Table 3, row 1, 0/24 wild-type allele integration). Regarding homology directed repair, as stated supra, Smith teaches a homologous donor-based precise genome editing (see e.g., p. 573, last para. and see Fig 1 for the HR donor) and aims to develop an efficient and precise genome editing on a mutant iPSC to perform cell therapy on a myeloproliferative neoplasm with JAK2V617F mutation (e.g., abstract and p. 573, last para). Goodwin reduces to practice a gene correction approach using homology directed repair (see e.g., Fig 1A). Accordingly, Smith in view of Kroger and Goodwin make obvious the cleaved mutant JAK2V617F gene is modified by integrating the corrective JAK2 nucleotide sequence into the genome by homology directed repair (HDR), thereby eliminating the JAK2V617F mutation from the genome and generating a genetically modified HSPC with wild-type JAK2 gene. With respect to claim 10 directed to the corrective JAK2 nucleotide sequence comprising a JAK2 3' UTR, Goodwin teaches a method of gene correction of autologous HSPC having FOXP3 mutation by integrating a corrective FOXP3 cDNA sequence (see e.g., Fig 1A). Goodwin teaches “To further improve FOXP3 expression and optimize the construct, several avenues may be explored. … It is also possible that expression from the endogenous FOXP3 gene and translation of FOXP3 protein are normally enhanced by endogenous intron-exon splice sites and 3′ untranslated region (3′UTR) elements…. Thus, additional future modifications to the construct aimed at improving expression could include incorporation of short exogenous intronic sequences or 3′UTRs from genes highly expressed in Tregs” (p. 10, right col, para 3). Thus, Goodwin suggests a 3’ UTR may be incorporated in the corrective donor template to improve expression of the corrected gene. Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have combined a JAK2 3' UTR to the corrective JAK2 nucleotide sequence as suggested by Goodwin with a reasonable expectation of success. One of ordinary skill in the art would have had a reason to do so in order to improve expression of the corrected gene as suggested by Goodwin. With respect to claim 12 directed to the mutation-specific guide RNA, as stated supra, Smith teaches the mutation-specific guide RNA (i.e., guide RNA-JAK2-F) directs Cas9 mediated integration only at mutant allele (see Table 3, row 1, 24/24 mutant allele integration), but does not cleave a wild-type JAK2 gene in the genome of the cell (see Table 3, row 1, 0/24 wild-type allele integration). Smith teaches the mutation-specific guide RNA (i.e., gR-JAK2-F) has 20-bp target-specific sequence (p. 576, left col, last full para) of AATTATGGAGTATGTTTCTG (see Fig 1a the sequence in the box and Fig 4a), which is 100% identical to the sequence of SEQ ID NO: 9 (see below, left). Smith teaches the wild-type corresponding sequence is AATTATGGAGTATGTGTCTG (see Fig 4a), which is 100% identical to the sequence of SEQ ID NO: 8 (see below, right), that is not recognized by the mutant-specific guide RNA. PNG media_image2.png 112 310 media_image2.png Greyscale PNG media_image3.png 113 319 media_image3.png Greyscale With respect to claim 15 directed to the RNA modification, Goodwin teaches the sgRNA was synthesized with 2′-O-methyl 3′phosphorothioate (MS) chemical modifications at the three terminal nucleotides on the 5′ and 3′ ends (p. 12, right col, last para). Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have combined 2'-O-methyl-3'-phosphorothioate (MS) modifications in the mutation-specific guide RNA as suggested by Goodwin with a reasonable expectation of success. One of ordinary skill in the art would have had a reason to do so since one of ordinary skill in the art would have immediately expected that the MS modification would have increased stability of the guide RNA and since Goodwin has reduced to practice such modification. With respect to claim 17 directed to the RNA-guided nuclease being Cas9, as stated supra, Smith teaches “we cotransfected iPV183 with a homology donor template and either Cas9/gRNA-JAK2-F or Cas9/gRNA-JAK2-V” (e.g., p. 573, last para.), thus teaches the RNA-guided nuclease is Cas9. With respect to claim 18 directed to the Cas9 being a High Fidelity Cas9, as stated supra, this limitation is examined as a high-fidelity SpCas9 variant. Goodwin compares editing rates with standard Sp Cas9 and high-fidelity (HiFi) Cas9 (Fig 2B legend) and teaches the high-fidelity Cas9 variant obtains higher gene editing rates (see Fig 2B comparing darker red dots to lighter gray dots). Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted a high-fidelity SpCas9 variant for the standard Cas9 as suggested by Goodwin with a reasonable expectation of success. One of ordinary skill in the art would have had a reason to do so in order to obtain higher gene editing rate as suggested by Goodwin. With respect to claim 19 directed to an RNP complex and electroporation, Smith uses Cas9 and gRNA plasmids and nucleofection (i.e., electroporation, see p. 576, last para). Goodwin uses an ribonucleoprotein (RNP) system comprising synthetic sgRNA complexed to SpCas9 protein and nucleofection (i.e., electroporation, see p. 12, last para “Gene editing by nucleofection and rAAV transduction”). Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted the ribonucleoprotein (RNP) complex for the plasmids as suggested by Goodwin with a reasonable expectation of success. One of ordinary skill in the art would have had a reason to do so since one of ordinary skill in the art would have immediately expected that the ribonucleoprotein (RNP) system would have had a shorter half-life to reduce off-target effect and since Goodwin has reduced to practice such modification. With respect to claim 20 directed to the donor template being introduced using a recombinant AAV vector and claim 21 directed to an AAV6 vector, Smith teaches a HR donor vector and a AAV-CAGGS-EGFP donor vector (p. 576, last para). Goodwin teaches transducing HSPCs with a FOXP3 DNA repair donor delivered as a recombinant adeno-associated virus of serotype 6 (rAAV6) (p. 2, last para and p. 13, para 1). Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have chosen a recombinant AAV vector and further an AAV6 vector as the donor template vector as suggested by Smith and Goodwin with a reasonable expectation of success. One of ordinary skill in the art would have had a reason to do so since both Smith and Goodwin have reduced to practice such a vector and Goodwin has specifically taught an AAV6 vector. With respect to claim 22, it must be noted that this wherein clause does not recite an active step in the claimed method, but only the results of the genetic modifying HSPC as suggested by Smith in view of Kroger and Goodwin. MPEP 2111.04 I states a whereby clause (or a wherein clause) “in a method claim is not given weight when it simply expresses the intended result of a process step positively recited.” Therefore, this wherein clause does not provide any patentable weight in determining patentability of the claimed method. With respect to claim 23 directed to the subject having polycythemia vera (PV), as stated supra, Smith teaches the cells are derived from patients with polycythemia vera (PV) having JAK2-V617F allele (see p. 571, Table 1). With respect to claim 24 directed to the modified HSPC being reintroduced into the subject, Smith aims to develop an efficient and precise genome editing on a mutant iPSC to perform cell therapy on a myeloproliferative neoplasm such as polycythemia vera (PV) with JAK2V617F mutation (e.g., abstract and p. 573, last para), Kroger teaches transplanting allogeneic wild-type HSPC comprising wild-type JAK2 gene provides a cell therapy of treating JAK2-V617F mutation-positive myeloproliferative disease (see above), and Goodwin teaches gene correction of autologous mutant HSPCs and reinfusion provide a therapeutic approach for genetic diseases (e.g., abstract). Thus, Smith in view of Kroger and Goodwin make obvious the genetically modified (i.e., corrected) HSPC is reintroduced into the subject to treat the genetic disease. With respect to claim 25, it must be noted that this wherein clause does not recite an active step in the claimed method, but only the results of reintroduction of the genetically modified HSPC into the subject as suggested by Smith in view of Kroger and Goodwin. Therefore, this wherein clause does not provide any patentable weight in determining patentability of the claimed method. See MPEP 2111.04 I. With respect to claim 26 directed to the subject being a human, as stated supra, Smith teaches the cells are derived from human patients with polycythemia vera (PV) (see p. 571, Table 1) and Kroger teaches HSPC transplantation into human patients (p. 1317, right col, para “Patients’ characteristics”). With respect to claim 36 directed to the donor template further comprising a selection cassette, Smith teaches “the donor vector used in homology recombination (HR)-based JAK2 targeting (Tables 2 and 3) is shown. …The PGK-puroΔtk dual selection cassette was flanked by piggyBac (PB) 5′ and 3′ inverted terminal repeats to facilitate potential footprint-free genome editing after PB-transposase-mediated excision” (e.g., Fig 1a attached above and its legend), thus teaches the donor template further comprises a selection cassette comprising a marker gene (i.e., puro resistance gene and a Δtk gene) operably linked to a promoter (i.e., a PGK promoter). With respect to claim 37 directed to the selection cassette comprising a PGK-tNGFR selection cassette, Goodwin teaches “the gene replacement donor template was also designed to knock-in a marker gene, the truncated nerve growth factor receptor (tNGFR), which is used clinically as a surface marker for selection and tracking of genetically engineered cells. We placed tNGFR under the control of a constitutive promoter” (p. 2, right col, para 1). Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have substituted a PGK-tNGFR selection cassette for the PGK-puroΔtk dual selection cassette as suggested by Goodwin with a reasonable expectation of success. One of ordinary skill in the art would have had a reason to do so in order to take advantage of the clinically-used surface marker for selection and tracking of the genetically modified HSPCs as suggested by Goodwin. Hence, the claimed invention as a whole was prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention in the absence of evidence to the contrary. Claims 3 and 13 are rejected under 35 U.S.C. 103 as being unpatentable over Smith et al., (Mol Ther. 2014;23(3):570-577. Cited in IDS 05/14/2026) in view of Kroger et al., (Blood. 2007;109:1316-1321) and Goodwin et al., (Sci Adv. 2020 May 6;6(19):eaaz0571, p. 1-17), as applied to claim 1 above, and further in view of Joberty et al., (CRISPR J. 2020 Apr;3(2):123-134) and Buerckstuemmer (US 2017/0009256A1. Cited in IDS 05/14/2026). Claim 3 is directed to the method further comprising introducing into the HSPC a second guide RNA comprising a target site located within an intron in the JAK2 gene. Claim 13 is directed to the target sequence of the second guide RNA comprising the sequence of SEQ ID NO: 11. However, although Goodwin tries paired sgRNAs (see Fig 1B, sg5/6 and sg7/8), Smith, Kroger and Goodwin are silent on introducing a second guide RNA in claim 3. Joberty teaches a tandem guide RNA-based strategy based on the synergistic combination of two guide RNAs mapping at close (40-300 bp) genomic proximity for efficient CRISPR gene editing that results in better predictable indel generation with a low allelic heterogeneity, concomitant with low or undetectable residual target protein expression (e.g., abstract). Joberty teaches examples of guide RNA locations in the pattern of exon-intron (see e.g., p. 129, Table 1, referring to one guide RNA located in an exon and a second guide RNA located in the adjacent intron), related to claim 3. Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have combined a second guide RNA comprising a target site located within an adjacent intron in the JAK2 gene for introducing into the HSPC together with the mutation-specific guide RNA targeting an exon comprising the mutation as suggested by Joberty with a reasonable expectation of success. Since Joberty teaches the synergistic combination of two guide RNAs achieves efficient CRISPR gene editing that results in better predictable indel generation with a low allelic heterogeneity, concomitant with low or undetectable residual target protein expression (e.g., abstract), one of ordinary skill in the art would have had a reason to combine a second guide RNA targeting an adjacent intron in order to take advantage of the synergistic combination to achieve low allelic heterogeneity and low or undetectable residual target protein expression. Regarding the target sequence of the second guide RNA in claim 13, Buerckstuemmer teaches modeling point mutation of JAK2 V617F by CRISPR/Cas9 mediated homologous recombination (see Example 4 in p. 23). Buerckstuemmer teaches the sequence of guide RNA 2 being AAAAACAGATGCTCTGAGAA (reference SEQ ID NO: 142, which targets the adjacent intron next to the exon comprising the V617F mutation). That sequence is 100% identical to the instant SEQ ID NO: 11 in claim 13 (see ABSS search 06/25/2026, -11.rni, result #1). Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have chosen the second guide RNA sequence that is identical to instant SEQ ID NO: 11 as suggested by Buerckstuemmer with a reasonable expectation of success. Since Buerckstuemmer has reduced to practice this second guide RNA sequence, one of ordinary skill in the art would have had a reason to choose the taught sequence that targets the adjacent intron next to the exon comprising the V617F mutation in order to use as a synergistic combination with the mutation-specific guide RNA as suggested by Joberty. Hence, the claimed invention as a whole was prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention in the absence of evidence to the contrary. Claims 6-7 are rejected under 35 U.S.C. 103 as being unpatentable over Smith et al., (Mol Ther. 2014;23(3):570-577. Cited in IDS 05/14/2026) in view of Kroger et al., (Blood. 2007;109:1316-1321) and Goodwin et al., (Sci Adv. 2020 May 6;6(19):eaaz0571, p. 1-17), as applied to claim 1 above, and evidenced by NCBI (NCBI Reference Sequence: NG_009904.1 for human JAK2 genomic sequence. Downloaded from https://www.ncbi.nlm.nih.gov/nuccore/NG_009904.1/, downloaded on 6/30/2026, p. 1-40. Attached as NPL) and further in view of Li et al., (bioRxiv preprint doi: https://doi.org/10.1101/178905; posted August 21, 2017, p. 1-24). Claims 6 and 7 are directed to the sequence and the length of the first and second homology arms. As started supra and from the attached Fig 1a above, Smith teaches the first homology arm (HA-L) having the sequence corresponding to a big portion of intron 13 and a portion of exon 14 upstream of the G>T mutation, and the second homology arm (HA-R) corresponding to a portion of exon 14 downstream of the G>T mutation and about half of intron 14. As evidenced by NCBI (NCBI Reference Sequence: NG_009904.1 for human JAK2 genomic sequence), the V617F G>T mutation is at position 93526 (see p. 28 of NCBI). The instant SEQ ID NO: 1 is 100% identical to the positions 92626-93525 (see below, thus being upstream of the G>T mutation) and the instant SEQ ID NO: 2 is 100% identical to the positions 93528-94584 (see below, thus being downstream of the G>T mutation). Thus, Smith, as evidenced by NCBI, suggests the sequences of the first and second homology arms being in the regions that have the sequences 100% identical to instant SEQ ID NOs: 1 and 2 in claims 6 and 7. Regarding the length of the homology arms, Goodwin teaches the homology arms were centered on the cut site of the sgRNA 2. The 3′ arm (right arm) started at the cut site and reached approximately 650 base pairs (bp) downstream of the cut site, whereas the 5′ arm (left arm) included a region approximately 600 bp upstream of the cut site (p. 12, left col, last para “FOXP3 homology donor design”), thus teaches the first homology arm (i.e., the left arm) being about 600 bp and the second homology arm (i.e., the right arm) being about 650 bp, within the claimed range in claims 6 and 7. Li evaluates the length of homology arms in donor template for CRISPR-based knock-in to maximize the efficiency (e.g., abstract) and teaches that donor templates containing long (~400-700 nt) homology arms are optimal donors (p. 4, para 2). Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have chosen the first homology arm having a subsequence of SEQ ID NO: 1 being 500-600 bp in length and the second homology arm having a subsequence of SEQ ID NO: 2 being 550-650 bp in length as suggested by Smith evidenced by NCBI and further suggested by Goodwin and Li with a reasonable expectation of success. Since Smith, as evidenced by NCBI, suggests the sequences of the first and second homology arms being in the regions that have the sequences 100% identical to instant SEQ ID NOs: 1 and 2, and since Li teaches donor templates containing long (~400-700 nt) homology arms are optimal donors (p. 4, para 2), and since Goodwin reduces to practice the first homology arm being about 600 bp and the second homology arm being about 650 bp centered on the cut site of the sgRNA (p. 12, left col, last para “FOXP3 homology donor design”), one of ordinary skill in the art would have had a reason to choose the region as suggested by Smith evidenced by NCBI and the length of the homology arms as suggested by Goodwin and Li in order to generate optimal donors to enable homologous recombination centered on the cut site of the mutation-specific guide RNA. Hence, the claimed invention as a whole was prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention in the absence of evidence to the contrary. PNG media_image4.png 962 643 media_image4.png Greyscale PNG media_image5.png 1053 620 media_image5.png Greyscale Claims 8-9 are rejected under 35 U.S.C. 103 as being unpatentable over Smith et al., (Mol Ther. 2014;23(3):570-577. Cited in IDS 05/14/2026) in view of Kroger et al., (Blood. 2007;109:1316-1321) and Goodwin et al., (Sci Adv. 2020 May 6; 6(19): eaaz0571, p. 1-17), as applied to claim 1 above, and further in view of Fotin-Mleczek et al., (US 11,078,247 B2). Claims 8 is directed to the corrective JAK2 nucleotide sequence comprises a portion of exon 12 downstream of the site corresponding to the JAK2V617F mutation, and all of exons 13-23 of the wild-type JAK2 gene. Claim 9, being dependent from claim 8, is directed to the donor template comprising at least 70% identity to SEQ ID NO: 4. Since claim 9 is dependent from claim 8 thus includes all the limitations thereof, satisfying claim 9 would be considered to satisfy claim 8 as well. As states supra, Smith in view of Kroger and Goodwin suggest a corrective JAK2 nucleotide sequence to correct JAK2V617F mutation to prepare genetically corrected HSPC comprising wild-type JAK2 gene for cell therapy. Regarding the corrective sequence, Goodwin teaches using the FOXP3 cDNA encoding for WT FOXP3 protein in the donor template (p. 12, left col, last para “FOXP3 homology donor design”). However, Smith, Kroger and Goodwin are silent on the corrective JAK2 nucleotide sequence in the donor template comprising at least 70% identity to SEQ ID NO: 4 in claims 8 and 9. Fotin-Mleczek teaches an mRNA sequence encoding a therapeutic protein (e.g., abstract) and in all these gene therapy approaches mRNA functions as messenger for the sequence information of the encoded protein, irrespectively of whether DNA, viral RNA or mRNA is used (col. 1, lines 53-55). Fotin-Mleczek teaches JAK2 gene (Col. 368, line 34, “C1 (JAK2)” having the RNA Sequence ID NO: 18720 (see Col. 368, line 35, “C4” which represents RNA sequence), that is usable in disease “pF” (see Col. 368, line 35, “C5” which represents related diseases, and line 43 “pF” which represents polycythemia vera, see Col. 757, line 60). It is noted that Fotin-Mleczek teaches the formula in Table 1 in Col. 111, lines 4-6, “Formula: #c1(Peptide or protein or gene) c2(NCBI RefSeq ID) c3(Protein SEQ ID NO) c4(RNA SEQ ID NOs) c5(Related disease, disorder or condition)”. Thus, Fotin-Mleczek suggests an mRNA sequence (reference SEQ ID NO: 18720) that encodes JAK2 and is usable in treating polycythemia vera. Fotin-Mleczek’s SEQ ID NO: 18720 is 81.8% identical to the instant SEQ ID NO: 4 in claim 9 (see ABSS search 06/25/2026, -4.rni, result #3), thus satisfy claims 9 and 8. Therefore, it would have been obvious for one of ordinary skill in the art before the effective filing date of the claimed invention to have chosen the sequence encoding a therapeutic JAK2 protein that is at least about 70% identical to instant SEQ ID NO: 4 in the donor template as suggested by Fotin-Mleczek with a reasonable expectation of success. Since Fotin-Mleczek reduces to practice an mRNA sequence (reference SEQ ID NO: 18720) that encodes JAK2 and is usable in treating polycythemia vera (see above), one of ordinary skill in the art would have had a reason to choose the sequence of Fotin-Mleczek in order to prepare a donor template comprising a sequence encoding a therapeutic JAK2 protein to correct HSPC to treat polycythemia vera. Furthermore, the successful cloning and sequencing of the cDNA encoding a known protein (JAK2) is obvious, and thus unpatentable, if (1) there was some suggestion or motivation in the prior art to clone the cDNA, and (2) there was a “reasonable expectation of success,” based on "detailed enabling methodology" in the prior art. Ex parte Kubin, 83 U.S.P.Q.2d (BNA) 1410 (B.P.A.I. 2007), aff'd, 561 F.3d 1351 (Fed. Cir. 2009). Hence, the claimed invention as a whole was prima facie obvious to a person of ordinary skill before the effective filing date of the claimed invention in the absence of evidence to the contrary. Conclusion No claims are allowed. Examiner Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to Jianjian Zhu whose telephone number is (571)272-0956. The examiner can normally be reached M - F 8:30AM - 4PM (EST). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, James Douglas (Doug) Schultz can be reached on (571) 272-0763. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /JIANJIAN ZHU/Examiner, Art Unit 1631
Read full office action

Prosecution Timeline

Mar 27, 2024
Application Filed
Jul 02, 2026
Non-Final Rejection mailed — §103, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12577534
TRANSDUCTION AND EXPANSION OF CELLS
5y 6m to grant Granted Mar 17, 2026
Patent 12553039
Targeting Nrip1 to Alleviate Metabolic Disease
1y 9m to grant Granted Feb 17, 2026
Patent 12539317
GENE EXPRESSION SYSTEM FOR PROBIOTIC MICROORGANISMS
1y 10m to grant Granted Feb 03, 2026
Patent 12522645
BCMA-TARGETED CAR-T CELL THERAPY OF MULTIPLE MYELOMA
5y 2m to grant Granted Jan 13, 2026
Patent 12497592
SCAFFOLDS WITH STABILIZED MHC MOLECULES FOR IMMUNE-CELL MANIPULATION
5y 1m to grant Granted Dec 16, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
59%
Grant Probability
99%
With Interview (+82.4%)
3y 8m (~1y 2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 85 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month