Prosecution Insights
Last updated: August 18, 2026
Application No. 18/696,468

ADVANCED RECOMBINANT VECTOR BASED ON CUCUMBER MOSAIC VIRUS

Final Rejection §103§112
Filed
Dec 26, 2024
Priority
Nov 11, 2022 — RE 10-2022-0150990 +2 more
Examiner
JOHNSON, EMILY KATHARINE
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Seoul National University R&DB Foundation
OA Round
2 (Final)
83%
Grant Probability
Favorable
3-4
OA Rounds
7m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 83% — above average
83%
Career Allowance Rate
5 granted / 6 resolved
+23.3% vs TC avg
Strong +28% interview lift
Without
With
+27.8%
Interview Lift
resolved cases with interview
Typical timeline
2y 3m
Avg Prosecution
34 currently pending
Career history
32
Total Applications
across all art units

Statute-Specific Performance

§101
9.8%
-30.2% vs TC avg
§103
32.4%
-7.6% vs TC avg
§102
18.6%
-21.4% vs TC avg
§112
34.3%
-5.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 6 resolved cases

Office Action

§103 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority Applicant has filed a certified copy of the foreign priority application and thus, acknowledgment is made of applicant's claim for foreign priority based on application no. KR 10-2022-0150990 filed 11/11/2022 and application no. KR 10-2023-0038110 filed 03/23/2023. Information Disclosure Statement The information disclosure statement (IDS) submitted on 02/25/2026 was considered, initialed, and attached hereto. A signed copy of the list of references cited is included with this Office Action. Status of Claims The amendments submitted on May 26th, 2026, have been entered. New claims 9 and 10 have been added. Claims 1-10 are pending and examined in this Office action. The text of those sections of Title 35 U.S. Code, not included in this action, can be found in a prior Office action. Withdrawn Objections and Rejections The objection to claim 7 is withdrawn in light of Applicant’s amendments to the claim. The rejection of claim 7 under 35 USC § 112(b) for indefiniteness is withdrawn in light of Applicant’s amendments to the claim. The rejections of claims 6-8 under 35 USC § 112(a) written description are withdrawn in light of Applicant’s amendments to the claims. The rejections of claims 1-8 under 35 USC § 103 are withdrawn in light of Applicant’s amendments to the claims to recite a recombinant vector comprising three separate vectors. Claim Interpretation The recitation of “a recombinant vector” in claim 1 is interpreted by the definition as filed in the instant specification. The term "recombinant vector" refers to a vector capable of expressing a targeted foreign gene in a host cell, including an essential regulatory element operably linked to cause expression of the gene insert [pg. 2, last paragraph-pg. 3 first two paragraphs]. A suitable vector includes an expression regulatory sequence such as a promoter, operator, initiation codon, termination codon, polyadenylation signal, and an enhancer, as well as a signal sequence or leader sequence for membrane targeting or secretion, and may be prepared in various ways depending on the purpose. The term "operably linked" refers to a gene requiring expression and a regulatory sequence thereof are linked together in a manner that enables gene expression. Although the Applicant Arguments/Remarks Made in an Amendment filed May 26th, 2026 states that the claimed recombinant vector is not a single vector, but an integrated three-segment system, this is not persuasive, as it not reflected in the language of claim 1 or in the definition of a recombinant vector provided in the instant specification. Claim Rejections - 35 USC § 112(d) The following is a quotation of 35 U.S.C. 112(d): (d) REFERENCE IN DEPENDENT FORMS.—Subject to subsection (e), a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. The following is a quotation of pre-AIA 35 U.S.C. 112, fourth paragraph: Subject to the following paragraph [i.e., the fifth paragraph of pre-AIA 35 U.S.C. 112], a claim in dependent form shall contain a reference to a claim previously set forth and then specify a further limitation of the subject matter claimed. A claim in dependent form shall be construed to incorporate by reference all the limitations of the claim to which it refers. Claim 2 is rejected under 35 U.S.C. 112(d) or pre-AIA 35 U.S.C. 112, 4th paragraph, as being of improper dependent form. This is a new rejection necessitated by amendments to the claims. As stated in the MPEP, one or more claims may be presented in dependent form, referring back to and further limiting another claim or claims in the same application. MPEP § 608.01(n). Claim 2 recites the recombinant vector of claim 9, improperly referring forward to a claim. Applicant may cancel the claim(s), amend the claim(s) to place the claim(s) in proper dependent form, rewrite the claim(s) in independent form, or present a sufficient showing that the dependent claim(s) complies with the statutory requirements. Claim Rejections - 35 USC § 112(b) The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1-10 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. This is a new rejection necessitated by amendments to the claims and remarks filed by the Applicant. The recitation of a cucumber mosaic virus (CMV) recombinant vector in claim 1 comprising a first, second, and third vector is not clear based on the definition of a recombinant vector provided by the instant specification. The Applicant Arguments/Remarks Made in an Amendment filed May 26th state that the recombinant vector is actually not a single vector by a three-segment system, which does not align with the previous definition of a recombinant vector. Additionally, a single recombinant vector does not itself contain multiple plasmids, however a single host cell, like bacterium, can be engineered to carry multiple different plasmids. It is not clear if the Applicant intends to claim that the actual recombinant vector itself comprises three vectors and if the regulatory elements are linked to cause expression of the gene insert in the modified RNA3 within the recombinant vector or if each of the vectors are recombinant. Claims 2-10 are also rejected insofar as they depend from claim 1, and do not overcome the stated rejection. Claim Rejections - 35 USC § 112(a) The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. Written Description Claims 1-10 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claims contain subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. This is a new rejection necessitated by amendments to the claims. The instant disclosure describes: Preparation of several CMV modified vectors comprising genomic DNA for RNA1, RNA2, and RNA3 of the highly pathogenic CMV-GTN strain. Transformation into Agrobacterium strain EHA105 of CMV-GTN-R1, pCMV-GTN-R2, pCMV-R3V-GFP, pCMV-R2V-B2, pCMV-Fny-R1, ppCMV-Fny-R2, and PZP-GFP. Agrobacterium suspension transformed with individual plasmids mixed in equal proportion and infiltrated for expression of GFP. The instant disclosure does not describe: A recombinant vector comprising a first vector comprising RNA1 of CMV, a second vector comprising RNA2 of CMV, and a third vector comprising RNA3 of CMV. A single Agrobacterium transformed by the recombinant vector. The broadest reasonable interpretation of the claims is a single recombinant vector comprising three vectors (see claim interpretation above) and an Agrobacterium transformed with that vector. The instant disclosure does not describe that the created plasmids with the different RNA segments of CMV are within one recombinant vector based on the definition of recombinant vector provided by the Applicant. The disclosure instead describes plasmids transformed into Agrobacterium strains individually and the suspensions then mixed in equal proportions and infiltrated under pressure on the adaxial surface of a tobacco plant in various combinations [Example 1; Clone preparation to evaluate expression efficiency]. No species are provided to support the claim of a single recombinant vector comprising three individual vectors, particularly wherein the single vector is incorporated into a single transgenic Agrobacterium, as in claim 6. The art does not suggest that a single recombinant vector itself can contain multiple plasmids, but discloses that multi-plasmid systems wherein bacteria carry multiple plasmids may be achieved (Kiattisewee C. 2025. “How many plasmids can bacteria carry? A synthetic biology perspective.” Open Biol. 15: 240378. https://doi.org/10.1098/rsob.24037) [Abstract]. Such systems often become unstable over extended culture periods and require fine-tuning [Fig. 1; pg. 9, ¶1-2], demonstrating unpredictability in the art. There are insufficient structural attributes of the examples provided to suggest that the recombinant vector as claimed would perform the function of expressing a gene of interest. A person of skill in the art at the time the application was filed would not have recognized that the inventor was in possession of the invention as claimed in view of the disclosure of the application. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. This is a new rejection necessitated by amendments to the claims. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. Claims 1, 3, and 6 are rejected under 35 U.S.C. 103 as being unpatentable over Seo et al. “Gene delivery vector for simultaneous expression of two foreign genes using broad bean wilt virus 2,” (KR 10-2020-0004185) (as cited in IDS and in Office action filed 02/24/2026), in view of Hwang, M. et al. (2012). “Bipartite and tripartite Cucumber mosaic virus-based vectors for producing the Acidothermus cellulolyticus endo-1,4-β-glucanase and other proteins in non-transgenic plants.” BMC Biotechnol. 12:66. doi: 10.1186/1472-6750-12-66. Claim 1 recites a cucumber mosaic virus (CMV) recombinant vector comprising; a first vector comprising RNA1 of CMV; a second vector comprising RNA2 of CMV; and a third vector comprising a modified RNA3 of CMV, wherein the modified RNA3 comprises a polynucleotide consisting of SEQ ID NO: 1, in which a coat protein (CP) gene is deleted and into which a multi-cloning site (MCS) for insertion of a gene of interest and a tag are introduced. Claim 3 recites the recombinant vector of claim 1 wherein the RNA1 comprises a polynucleotide consisting of SEQ ID NO: 3. Claim 6 recites a transgenic microorganism, transformed by the recombinant vector of claim 1, wherein the microorganism is Agrobacterium. Regarding claim 1, Seo teaches a method for expressing foreign genes in a plant using an infectious clone, including inserting a foreign gene into the expression vector to prepare a recombinant expression vector and introducing said vector into a plant [¶23]. The foreign gene may be a disease-resistant gene and, more specifically, a gene encoding a coat protein which is a virus-resistant protein [¶25]. It may also be a green fluorescent protein [¶26]. The plant in which the vector is expressed is preferably a pepper [¶27]. A Broad Bean Wilt Virus 2 infectious cDNA clone was used consisting of two RNA segments, RNA1 and RNA2, encoding open reading reams and expressing mature proteins of the virus [¶38]. The RNA2 of BBWV2 includes a movement protein (mp), a large coat protein (lcp), and a small coat protein (scp) gene [¶11]. In particular, rna2 of bbwv2 in the vector of the present invention includes a gene insertion cassette, and specifically, includes a restriction enzyme site capable of inserting a foreign gene between the mp and the lcp, and a cleavage site by a piconin 3c-like protease [¶11]. For the expression vector, a pCass-Rz vector was used based on Lonicera japonica virus 2, including the left side border of t-dna, the dual 35s promoter of camv, the multiple cloning site (mcs)StuI,KpnI,XbaI,BamHi), cis-cleaved ribozyme sequence (rz), 35s terminator (t), and right border of t-dna, transformed into Agrobacterium so the desired gene can be delivered to plants through Agro-infiltration [¶37]. The pCass-Rz vector includes a kanamycin resistance gene so the pcassrz vector can be selectively cultured [¶37]. The constructed BBWV2 vector was named pbbwv2-r2-oex2 and has the base sequence of SEQ ID NO. 2 (Acc. No. LY802598). SEQ ID NO. 2 has 100% identity to positions 1655-11926 of SEQ ID NO. 1 of the instant application (see sequence alignment at the end of Office action). Seo does not teach that the vector is a CMV recombinant vector comprising RNA1, RNA2, and RNA3 of CMV, consecutively, or that the coat protein gene has been deleted from the RNA3. However, Hwang teaches that Cucumber mosaic virus (CMV) is another virus used for protein production in plants, offering an extremely wide plant host range [pg. 2, col. 1, ¶2]. Thus, an optimized CMV-based protein production system would be very desirable. CMV has a tripartite single-stranded genome including RNAs 1 and 2, encoding the 1a and 2a proteins, respectively. RNA 2 also encodes a small protein called 2b, which affects virulence and is known to suppress the initiation of the plant defense. RNA 3 also is bicistronic, encoding the cell-to-cell movement protein (MP) and the virion capsid protein (CP). CMV genome segments 2 and 3 have been modified in some cases for insertion of specific sequences which can give foreign protein production in plants. Hwang teaches various combinations of the genome segments, teaching that there are the advantages of having all CMV components on a single plasmid, such as ensuring that all CMV components are simultaneously introduced into the same cell [pg. 2, col. 2, ¶2]. Hwang teaches a tripartite, autonomously replicating form of CMV [pg. 2, col. 2, ¶2]. Hwang teaches that the gene of interest was inserted into the coat protein coding region of CMV RNA3 and that the CMV RNA3 was modified, giving rise to the mRNA 4 leader sequence by PCR primer tagging to introduce additional restriction enzyme sites for easier cloning (i.e., into which a multi-cloning site for insertion of a gene of interest and a tag are introduced) [pg. 3, col. 1, ¶1]. Hwang teaches that the GFP and E1 sequence (codon optimized for dicots) were PCR amplified and cloned into the CP coding region of PCMVar RNA3 [pg. 3, col. 2, ¶2]. This was done by reverse PCR to remove the CP coding region and amplification and ligation of the E1 (the Acidothermus cellulolyticus endo 1, 4-β-glucanase, a cellulose degrading enzyme) gene and GFP coding sequence into the coat protein-gene deleted pCMVar RNA3 (i.e., in which a coat protein gene is deleted) [pg. 3, col. 2, ¶2]. Hwang teaches that RNA1 and RNA2 can be added similarly [pg. 3, col. 2, ¶4]. Hwang teaches that when the genes of interest were inserted in place of the CMV coat protein, they were produced in plants as shown by fluorescence (GFP) and immunoblot analysis. Indeed, enzymatic activity showed that active E1 was produced in plants with yields up to ~11 µg/g fresh weight [Abstract]. Given that Seo teaches a recombinant expression vector comprising a Broad Bean Wilt Virus 2 infectious cDNA clone consisting of two RNA segments, RNA1 and RNA2 and with the base sequence of SEQ ID NO. 2 (Acc. No. LY802598) with 100% identity to positions 1655-11926 of SEQ ID NO. 1 of the instant application; and given that Hwang teaches vectors of RNA1 CMV, RNA2 CMV, and RNA3 CMV, wherein the coat protein gene is replaced with a restriction enzyme sites for easier cloning by a tag, and teaches that the replacement of the coat protein gene resulted in enhanced expression of inserted genes (E1 and GFP), it would have been prima facie obvious to one of ordinary skill in the art at the time of filing to use the CMV as the virus used to protein production in plants instead of the BBWV2 virus. As Seo teaches, BBWV2 has a bipartite genome with two RNA segments (RNA1 and RNA2) as opposed to CMV’s three RNA segments and falls in the Bromoviridae family with CMV. BBWV2 includes coat proteins and movement proteins derived from RNA2, essentially enabling the same function of RNA3 in CMV (i.e. encoding the viral MP and CP genes). SEQ ID NO. 2 of Seo has a 100% identity match to positions 1655-11926 of SEQ ID NO. 1 of the instant application and the same construction of the expression vector. As the Applicant does not disclose which regions of the sequence are the edited RNA segments within the vector of SEQ ID NO. 1, it is assumed that the beginning of the sequence lacking alignment to SEQ ID NO. 2 of Seo is the 3A/RNA2 movement protein family based on a BLAST® analysis of the conserved domains of SEQ ID NO. 1 of the instant application, falling within the RNA3 segment on the genome (alignment shown below). It would have been prima facie obvious to one of ordinary skill in the art at the time of filing to use this sequence as it is designated as an RNA3 segment of CMV. The expression vector sequences would vary based on the bipartite genome of BBWV2 versus the tripartite genome of CMV, as taught by Hwang. One would have further been motivated to modify the RNA3 as Hwang teaches expression of genes inserted into the vector in place of the coat protein when the vector was transformed into a plant. Additionally, Hwang teaches that an optimized CMV-based protein production system would be very desirable. One would have reasonable expectation of success as Hwang teaches that CMV is a virus sed for protein production and can be used in a wide variety of plants. Thus, differences could be easily derived or made by a person skilled in the art. PNG media_image1.png 851 1216 media_image1.png Greyscale Regarding claim 3, SEQ ID NO. 3 (positions 3358-13557) of the instant application has 100% identity to SEQ ID NO. 2 of Seo. A BLAST® conserved domains search (shown below) shows that the beginning of SEQ ID NO. 3 of the instant application contains conserved domains of viral methyltransferase (domain is found in a wide range of ssRNA viruses, including Bromoviruses, i.e. CMV), 1a protein family and protein C terminal (the major virulence factor of the CMV), and viral helicase (for viral RNA replication) which would be obvious to modify from the BBWV2 expression vector for a CMV specific vector. PNG media_image2.png 854 1209 media_image2.png Greyscale Regarding claim 6, Seo teaches that, in order to reproduce the infectious activity of the virus in a plant, and infectious clone of the virus was prepared using a binary vector transformed into an Agrobacterium strain (i.e. a transgenic microorganism transformed by the recombinant vector of claim 1, wherein the microorganism is Agrobacterium) [¶7]. Hwang further teaches that recent progress in developing Agrobacterium tumefaciens delivered plant virus-based protein production systems has been made by several research groups using different plant viruses [pg. 11, col. 1, ¶2]. Hwang teaches that the vectors were transformed into Agrobacterium tumefaciens GV3101 or EHA105 cells [pg. 4, col. 1, ¶1; col. 2, ¶1], demonstrating the applicability of Agrobacterium-mediated transformation with CMV. Claims 2, 9 and 10 are rejected under 35 U.S.C. 103 as being unpatentable over Seo in view of Hwang, as applied to claim 1 above, and further in view of Sinha, K. et al. (2021), “Overexpression of a RNA silencing suppressor, B2 protein encoded by Flock House virus, in tobacco plants results in tolerance to salt stress,” Phytoparasitica, 49:299-316 (cited in IDS filed 03/28/2024 and Office action filed 02/24/2026). This is a new rejection necessitated by amendments to the claims. Claim 9 recites the recombinant vector of claim 1, wherein the RNA2 is a modified RNA2. Claim 2 recites the recombinant vector of claim 9, wherein the modified RNA2 comprises a polynucleotide consisting of SEQ ID NO: 2. Claim 10 recites the recombinant vector of claim 9, wherein the modified RNA2 has a substitution of a B2 gene of flock house virus (FHV) for 2b gene. Regarding claims 2, 9 and 10, as detailed above, Seo and Hwang combined teach a CMV recombinant vector comprising RNA1, RNA2, and RNA3 of CMV, wherein the CP of RNA3 is replaced for insertion of a gene of interest and a tag. Seo further teaches a recombinant expression vector with 100% sequence identity to positions 1655-11910 of SEQ ID NO. 1. These references do not explicitly teach the recombinant vector comprising a modified RNA2 consisting of SEQ ID NO: 2 wherein the modified RNA2 has a substitution of a B2 gene of FHV for 2b gene. However, Sinha teaches a B2 protein encoded by insect FHV (resulting in FHVB2) that is a well-known RNA silencing suppressor (RSS) [Abstract]. Sinha teaches that FHVB2 is functionally similar to Cucumber mosaic virus encoded 2b and can act as an RSS in plants (i.e., wherein the modified RNA2 has a substitution of a B2 gene of FHV for 2b gene) [Abstract, pg. 312, col. 1, para 1]. Sinha concludes that FHVB2 not only suppresses the RNA silencing machinery per se but modulates a complex network of host proteins thereby increasing the tolerance of plants to stress [pg. 313, col. 1, para 3]. Hwang teaches that RNA 2 encodes a small protein called 2b, which affects virulence and is known to suppress the initiation of the plant defense, RNA silencing, and to play a role in promoting cell to-cell movement [pg. 2, col. 1, ¶2]. Hwang teaches that subgroup II CMV isolates, one of the taxonomic groupings of CMV, shows mild or almost symptomless infections and is suggested to be associated with the 2b protein as a silencing suppressor [pg. 8, col. 2, ¶2]. As the B2 protein encoded by FHVB2 is a more powerful suppressor, as disclosed by Sinha, the introduction of the FHVB2 sequence would be obvious to one of ordinary skill in the art (i.e., wherein the RNA2 is modified). This would have resulted in the FHV B2 sequence introduction to the recombinant vector of claim 2 of the instant application [described on pg. 6, ¶5-6 to pg. 7, ¶1 of the instant application]. One would have reasonable expectation of success as Sinha additionally discloses that FHVB2 is functionally similar to CMV encoded 2b. Although SEQ ID NO: 2 is not explicitly disclosed, one of ordinary skill in the art would have arrived at the claimed sequence by methods previously disclosed in the prior art. Applicant has not provided any evidence for unexpected results, nor for any criticality of the full-length sequence of instant SEQ ID NO: 2. Claims 4 and 5 are rejected under 35 U.S.C. 103 as being unpatentable over Seo in view of Hwang, as applied to claim 1 above, and further in view of Heo, K. et al. (2020). “Newly emerged resistance-breaking variants of cucumber mosaic virus represent ongoing host-interactive evolution of an RNA virus.” Virus Evolution. 6(2):veaa070 (as cited in Office action filed 02/24/2026). This is a new rejection necessitated by amendments to the claims. Claim 4 recites the recombinant vector of claim 1 wherein the cucumber mosaic virus is a P1 type cucumber mosaic virus. Claim 5 recites the recombinant vector of claim 4, wherein the P1 type cucumber mosaic virus is a CMV-GTN strain. Regarding claims 4 and 5, as detailed above, Seo and Hwang combined teach a CMV recombinant vector comprising RNA1, RNA2, and RNA3 of CMV, wherein the CP of RNA3 is replaced for insertion of a gene of interest and a tag. Seo further teaches a recombinant expression vector with 100% sequence identity to positions 1655-11910 of SEQ ID NO. 1. Seo and Hwang do not teach that the CMV strain was isolated from the highly pathogenic CMV-GTN strain. However, Heo teaches infectious cDNA clones of two CMV strains, CMV CMV-GTN (a resistance-breaking strain isolated from pepper in 2013) and CMV-P1 (a strain isolated from pepper in 2004 belonging to the P1 pathotype), to identify mutations responsible for resistance breaking in pepper [pg. 2, col. 2, ¶1]. CMV-GTN was isolated from pepper in a previous study (Choi et al. et al. (2015) ‘Characteristics of Cucumber Mosaic virus-GTN and Resistance Evaluation of Chilli Pepper Cultivars to Two Cucumber Mosaic Virus Isolates’, Research in Plant Disease, 21:99–102; incorporated herein by reference), which appears to be the same strain used in the instant application [instant app. pg. 6, ¶1]. Infectious cDNA clones of CMV-GTN were constructed for RNA1, RNA2, and RNA3. Amplified full-length RNA2 and RNA3 were digested with XbaI and BamHI and cloned into a pCassRz vector opened with XabI and BamHI [pg. 2, col. 2, ¶3] and transformed into the Agrobacterium tumefaciens strain GV3101 [pg. 3, col. 1, ¶1]. Heo teaches that since the early 2010s, CMV variants have emerged that can infect pepper cultivars resistant to CMV pathotype P1 and that CP accumulation levels of CMV-P1 and -GTN, the highly pathogenic strains isolated from peppers, were much higher than that of CMV-Fny, which exhibited lower mosaic symptoms [pg. 6, col.1, ¶1]. Heo teaches that pepper cultivars were susceptible to the -GTN strain even when resistant to the -Fny and -P1 strains [pg. 7, col. 1, ¶1]. Heo teaches isolates were collected from pepper cultivars resistant to CMV pathotype P1, and that CMV-Fny, -P1, and -GTN were included in the study as reference strains (i.e. wherein the cucumber mosaic virus a P1 type and further, is a CMV-GTN strain). Heo teaches that pepper cultivars were susceptible to the -GTN strain even when resistant to the -Fny and -P1 strains [pg. 7, col. 1, ¶1]. It would have been prima facie obvious to one of ordinary skill in the art at the time of filing to utilize the highly pathogenic strain disclosed in Heo, CMV-GTN, with the recombinant vector as taught by Seo and Hwang as more cultivars are emerging with resistance to other CMV strains. One would have been motivated to use this strain as the virulence analysis demonstrated that CMV-GTN could infect most commercial pepper cultivars [pg. 4, col. 1, ¶3]. As such the virus can overcome host resistance, surpassing plant suppression and allowing for greater viral replication and thus higher expression of a foreign protein inserted into its genome. Thus, one would be motivated to use the highly pathogenic CMV-GTN strain in a recombinant vector to increase expression of a desired protein. One would have reasonable expectation of success as Heo teaches the use of CMV-GTN in several RNA plasmids. Thus, one of ordinary skill in the art would have arrived at the claimed subject matter without inventive skills in light of Seo, Hwang, and Heo. Claims 7 and 8 are rejected under 35 U.S.C. 103 as being unpatentable over Seo in view of Hwang, as applied to claim 1, and further in view of Lee, C. (2017). “A Simple Outline of Methods for Protein Isolation and Purification.” Endocrinol Metab (Seoul). (1):18-22. doi: 10.3803/EnM.2017.32.1.18. This is a new rejection necessitated by amendments to the claims. Claim 7 recites a method of preparing a protein, comprising: preparing a cucumber mosaic virus recombinant vector in which a gene of interest is inserted into the MCS of the cucumber mosaic virus recombinant vector according to claim 1; transforming the recombinant vector into an Agrobacterium; inoculating the transformed Agrobacterium into a host plant; and extracting or isolating the protein expressed from the gene of interest from the host plant. Claim 8 recites the method of claim 7 wherein the protein prepared by the method of preparing a protein comprises a 2xFLAG tag and a 6xHIS tag at the C terminus. Regarding claim 7, as detailed above, Seo and Hwang combined teach a CMV recombinant vector comprising RNA1, RNA2, and RNA3 of CMV, wherein the CP of RNA3 is replaced for insertion of a gene of interest and a tag. Seo further teaches a recombinant expression vector with 100% sequence identity to positions 1655-11910 of SEQ ID NO. 1. Seo further teaches that the pcassrz vector was used as a binary vector for constructing a dual gene transfer vector based on BBWV2. The pcassrz vector includes a multiple cloning site so the desired gene can be delivered to plants through agro-infiltration (i.e., a method of preparing a protein comprising preparing a virus recombinant vector, transforming the recombinant vector into Agrobacterium, inoculating the transformed Agrobacterium into a host plant) [¶37]. Hwang further teaches Agrobacterium infiltration of the CMV vectors for recombinant protein production [pg. 12, col. 1, ¶1] and teaches enzymatic assays for assessing the E1 protein production [Abstract]. Seo and Hwang do not explicitly teach that the expressed protein is extracted or isolated from the host plant, however, this is a well-understood, routine, and conventional activity in the art. For example, Lee teaches a simple outline of methods for protein isolation and purification. Lee teaches numerous isolation, purification, and analysis techniques that may be optimized accordingly [pg. 19-21]. Lee teaches that proteins can be obtained from a wide variety of samples [pg. 18, col. 1, ¶1]. Thus, the protein extraction or isolation would have been routine and well understood to one of ordinary skill in the art. Regarding claim 8, Hwang teaches vectors of RNA1 CMV, RNA2 CMV, and RNA3 CMV, wherein the coat protein gene is replaced with a restriction enzyme sites for easier cloning by a tag [pg. 3, col. 1, ¶1]. A 2xFLAG tag and a 6xHIS tag at the C terminus are not explicitly disclosed, however this is a routine addition in the art at the time the instant application was filed. The addition is a mere optimization of the invention, absent evidence to the contrary. Response to Applicant’s Arguments The Applicant’s arguments in the response submitted May 26th, 2026 have been carefully considered but are moot in light of new grounds of rejection due to the amendment to claim 1 explicitly requiring the complete tripartite CMV system [see Applicant Arguments/Remarks Made in an Amendment filed 05/26/2026, pg. 7, end paragraph]. Thus, claim 1-10 are rejected under 35 USC § 112 & 103, as detailed above. Examiner notes that Applicant contends that claim 1 is amended to explicitly require the complete tripartite cucumber mosaic virus (CMV) system, reciting the CMV RNA1 vector, CMV RNA1 vector, and CMV RNA1 vector. Applicant further states that the amendment clarifies that the claimed recombinant vector is not a single vector by an integrated three-segment system. Examiner notes that, in the specification, Applicant recites that “the term "recombinant vector" refers to a vector capable of expressing a targeted foreign gene in a host cell, including an essential regulatory element operably linked to cause expression of the gene insert. A suitable vector includes an expression regulatory sequence such as a promoter, operator, initiation codon, termination codon, polyadenylation signal, and an enhancer, as well as a signal sequence or leader sequence for membrane targeting or secretion, and may be prepared in various ways depending on the purpose. As used herein, the term "operably linked" refers to a gene requiring expression and a regulatory sequence thereof are linked together in a manner that enables gene expression” [pg. 2, last paragraph to pg. 3 first two paragraphs]. Thus, the claim language claiming “a CMV recombinant vector” comprising three vectors limits the claim to the definition provided in the specification, wherein the vector elements are operably linked to cause expression of the gene insert. A recombinant vector is not defined as an integrated three-segment system in the original specification and thus is not interpreted as Applicant Arguments/Remarks Made in an Amendment filed 05/26/2026 [pg. 7, end paragraph]. As stated in the MPEP, an applicant may not add a special definition or disavowal after the filing date of the application. MPEP § 2173.01. Summary Claims 1-10 are rejected. Applicants’ amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). Applicant is reminded of the extension of time policy as set forth in 37 CFR § 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any nonprovisional extension fee (37 CFR 1.17(a)) pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the mailing date of this final action. Contact Information Any inquiry concerning this communication or earlier communications from the examiner should be directed to EMILY K. JOHNSON whose telephone number is (571)272-5761. The examiner can normally be reached Monday - Friday 7:30 am - 5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic can be reached at 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /EMILY K JOHNSON/Examiner, Art Unit 1662 /BRATISLAV STANKOVIC/Supervisory Patent Examiner, Art Units 1661 & 1662 ____________________________________________________________________ KR 1020200011845-A/3: Virus-induced gene silencing in pepper using broad bean wilt virus 2 SEQ ID NO. 2 alignment with SEQ ID NO. 1 of the instant application. Score Expect Identities Gaps 18940 bits(10256) 0.0 10256/10256(100%) 0/10256(0%) Query 1655 AGGATCCGATACCCTGTCACCGGATGTGTTTTCCGGTCTGATGAGTCCGTGAGGACGAAA 1714 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3887 AGGATCCGATACCCTGTCACCGGATGTGTTTTCCGGTCTGATGAGTCCGTGAGGACGAAA 3946 Query 1715 CAGGACTGTCCTGCAGGAGCTCGAATTCGGTACGCTGAAATCACCAGtctctctctacaa 1774 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 3947 CAGGACTGTCCTGCAGGAGCTCGAATTCGGTACGCTGAAATCACCAGTCTCTCTCTACAA 4006 Query 1775 atctatctctctctattttctcCATAAATAATGTGTGAGTAGTTTCCGATAAGGAAATTA 1834 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4007 ATCTATCTCTCTCTATTTTCTCCATAAATAATGTGTGAGTAGTTTCCGATAAGGAAATTA 4066 Query 1835 GGGTTCTTATAGGGTTTCGTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGT 1894 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4067 GGGTTCTTATAGGGTTTCGTCATGTGTTGAGCATATAAGAAACCCTTAGTATGTATTTGT 4126 Query 1895 ATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCAGTACTAAA 1954 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4127 ATTTGTAAAATACTTCTATCAATAAAATTTCTAATTCCTAAAACCAAAATCAGTACTAAA 4186 Query 1955 TCAGATCCCCAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGT 2014 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4187 TCAGATCCCCAATTCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCGT 4246 Query 2015 TACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGTGGCACTGGCCGTCGTTT 2074 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4247 TACCCAACTTAATCGCCTTGCAGCACATCCCCCTTTCGCCAGTGGCACTGGCCGTCGTTT 4306 Query 2075 TACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATC 2134 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4307 TACAACGTCGTGACTGGGAAAACCCTGGCGTTACCCAACTTAATCGCCTTGCAGCACATC 4366 Query 2135 CCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGT 2194 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4367 CCCCTTTCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGT 4426 Query 2195 TGCGCAGCCTGAATGGCGAATGCTAGAGCAGCTTGAGCTTGGATCAGATTGTCGTTTCCC 2254 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4427 TGCGCAGCCTGAATGGCGAATGCTAGAGCAGCTTGAGCTTGGATCAGATTGTCGTTTCCC 4486 Query 2255 GCCTTCAGTTTAAACTATCAGTGTTTGACAGGATATATTGGCGGGTAAACCTAAGAGAAA 2314 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4487 GCCTTCAGTTTAAACTATCAGTGTTTGACAGGATATATTGGCGGGTAAACCTAAGAGAAA 4546 Query 2315 AGAGCGTTTATTAGAATAACGGATATTTAAAAGGGCGTGAAAAGGTTTATCCGTTCGTCC 2374 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4547 AGAGCGTTTATTAGAATAACGGATATTTAAAAGGGCGTGAAAAGGTTTATCCGTTCGTCC 4606 Query 2375 ATTTGTATGTGCATGCCAACCACAGGGTTCCCCTCGGGATCAAAGTACTTTGATCCAACC 2434 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4607 ATTTGTATGTGCATGCCAACCACAGGGTTCCCCTCGGGATCAAAGTACTTTGATCCAACC 4666 Query 2435 CCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGA 2494 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4667 CCTCCGCTGCTATAGTGCAGTCGGCTTCTGACGTTCAGTGCAGCCGTCTTCTGAAAACGA 4726 Query 2495 CATGTCGCACAAGTCCTAAGTTACGCGACAGGCTGCCGCCCTGCCCTTTTCCTGGCGTTT 2554 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4727 CATGTCGCACAAGTCCTAAGTTACGCGACAGGCTGCCGCCCTGCCCTTTTCCTGGCGTTT 4786 Query 2555 TCTTGTCGCGTGTTTTAGTCGCATAAAGTAGAATACTTGCGACTAGAACCGGAGACATTA 2614 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4787 TCTTGTCGCGTGTTTTAGTCGCATAAAGTAGAATACTTGCGACTAGAACCGGAGACATTA 4846 Query 2615 CGCCATGAACAAGAGCGCCGCCGCTGGCCTGCTGGGCTATGCCCGCGTCAGCACCGACGA 2674 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4847 CGCCATGAACAAGAGCGCCGCCGCTGGCCTGCTGGGCTATGCCCGCGTCAGCACCGACGA 4906 Query 2675 CCAGGACTTGACCAACCAACGGGCCGAACTGCACGCGGCCGGCTGCACCAAGCTGTTTTC 2734 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4907 CCAGGACTTGACCAACCAACGGGCCGAACTGCACGCGGCCGGCTGCACCAAGCTGTTTTC 4966 Query 2735 CGAGAAGATCACCGGCACCAGGCGCGACCGCCCGGAGCTGGCCAGGATGCTTGACCACCT 2794 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 4967 CGAGAAGATCACCGGCACCAGGCGCGACCGCCCGGAGCTGGCCAGGATGCTTGACCACCT 5026 Query 2795 ACGCCCTGGCGACGTTGTGACAGTGACCAGGCTAGACCGCCTGGCCCGCAGCACCCGCGA 2854 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5027 ACGCCCTGGCGACGTTGTGACAGTGACCAGGCTAGACCGCCTGGCCCGCAGCACCCGCGA 5086 Query 2855 CCTACTGGACATTGCCGAGCGCATCCAGGAGGCCGGCGCGGGCCTGCGTAGCCTGGCAGA 2914 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5087 CCTACTGGACATTGCCGAGCGCATCCAGGAGGCCGGCGCGGGCCTGCGTAGCCTGGCAGA 5146 Query 2915 GCCGTGGGCCGACACCACCACGCCGGCCGGCCGCATGGTGTTGACCGTGTTCGCCGGCAT 2974 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5147 GCCGTGGGCCGACACCACCACGCCGGCCGGCCGCATGGTGTTGACCGTGTTCGCCGGCAT 5206 Query 2975 TGCCGAGTTCGAGCGTTCCCTAATCATCGACCGCACCCGGAGCGGGCGCGAGGCCGCCAA 3034 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5207 TGCCGAGTTCGAGCGTTCCCTAATCATCGACCGCACCCGGAGCGGGCGCGAGGCCGCCAA 5266 Query 3035 GGCCCGAGGCGTGAAGTTTGGCCCCCGCCCTACCCTCACCCCGGCACAGATCGCGCACGC 3094 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5267 GGCCCGAGGCGTGAAGTTTGGCCCCCGCCCTACCCTCACCCCGGCACAGATCGCGCACGC 5326 Query 3095 CCGCGAGCTGATCGACCAGGAAGGCCGCACCGTGAAAGAGGCGGCTGCACTGCTTGGCGT 3154 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5327 CCGCGAGCTGATCGACCAGGAAGGCCGCACCGTGAAAGAGGCGGCTGCACTGCTTGGCGT 5386 Query 3155 GCATCGCTCGACCCTGTACCGCGCACTTGAGCGCAGCGAGGAAGTGACGCCCACCGAGGC 3214 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5387 GCATCGCTCGACCCTGTACCGCGCACTTGAGCGCAGCGAGGAAGTGACGCCCACCGAGGC 5446 Query 3215 CAGGCGGCGCGGTGCCTTCCGTGAGGACGCATTGACCGAGGCCGACGCCCTGGCGGCCGC 3274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5447 CAGGCGGCGCGGTGCCTTCCGTGAGGACGCATTGACCGAGGCCGACGCCCTGGCGGCCGC 5506 Query 3275 CGAGAATGAACGCCAAGAGGAACAAGCATGAAACCGCACCAGGACGGCCAGGACGAACCG 3334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5507 CGAGAATGAACGCCAAGAGGAACAAGCATGAAACCGCACCAGGACGGCCAGGACGAACCG 5566 Query 3335 TTTTTCATTACCGAAGAGATCGAGGCGGAGATGATCGCGGCCGGGTACGTGTTCGAGCCG 3394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5567 TTTTTCATTACCGAAGAGATCGAGGCGGAGATGATCGCGGCCGGGTACGTGTTCGAGCCG 5626 Query 3395 CCCGCGCACGTCTCAACCGTGCGGCTGCATGAAATCCTGGCCGGTTTGTCTGATGCCAAG 3454 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5627 CCCGCGCACGTCTCAACCGTGCGGCTGCATGAAATCCTGGCCGGTTTGTCTGATGCCAAG 5686 Query 3455 CTGGCGGCCTGGCCGGCCAGCTTGGCCGCTGAAGAAACCGAGCGCCGCCGTCTAAAAAGG 3514 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5687 CTGGCGGCCTGGCCGGCCAGCTTGGCCGCTGAAGAAACCGAGCGCCGCCGTCTAAAAAGG 5746 Query 3515 TGATGTGTATTTGAGTAAAACAGCTTGCGTCATGCGGTCGCTGCGTATATGATGCGATGA 3574 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5747 TGATGTGTATTTGAGTAAAACAGCTTGCGTCATGCGGTCGCTGCGTATATGATGCGATGA 5806 Query 3575 GTAAATAAACAAATACGCAAGGGGAACGCATGAAGGTTATCGCTGTACTTAACCAGAAAG 3634 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5807 GTAAATAAACAAATACGCAAGGGGAACGCATGAAGGTTATCGCTGTACTTAACCAGAAAG 5866 Query 3635 GCGGGTCAGGCAAGACGACCATCGCAACCCATCTAGCCCGCGCCCTGCAACTCGCCGGGG 3694 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5867 GCGGGTCAGGCAAGACGACCATCGCAACCCATCTAGCCCGCGCCCTGCAACTCGCCGGGG 5926 Query 3695 CCGATGTTCTGTTAGTCGATTCCGATCCCCAGGGCAGTGCCCGCGATTGGGCGGCCGTGC 3754 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5927 CCGATGTTCTGTTAGTCGATTCCGATCCCCAGGGCAGTGCCCGCGATTGGGCGGCCGTGC 5986 Query 3755 GGGAAGATCAACCGCTAACCGTTGTCGGCATCGACCGCCCGACGATTGACCGCGACGTGA 3814 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 5987 GGGAAGATCAACCGCTAACCGTTGTCGGCATCGACCGCCCGACGATTGACCGCGACGTGA 6046 Query 3815 AGGCCATCGGCCGGCGCGACTTCGTAGTGATCGACGGAGCGCCCCAGGCGGCGGACTTGG 3874 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6047 AGGCCATCGGCCGGCGCGACTTCGTAGTGATCGACGGAGCGCCCCAGGCGGCGGACTTGG 6106 Query 3875 CTGTGTCCGCGATCAAGGCAGCCGACTTCGTGCTGATTCCGGTGCAGCCAAGCCCTTACG 3934 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6107 CTGTGTCCGCGATCAAGGCAGCCGACTTCGTGCTGATTCCGGTGCAGCCAAGCCCTTACG 6166 Query 3935 ACATATGGGCCACCGCCGACCTGGTGGAGCTGGTTAAGCAGCGCATTGAGGTCACGGATG 3994 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6167 ACATATGGGCCACCGCCGACCTGGTGGAGCTGGTTAAGCAGCGCATTGAGGTCACGGATG 6226 Query 3995 GAAGGCTACAAGCGGCCTTTGTCGTGTCGCGGGCGATCAAAGGCACGCGCATCGGCGGTG 4054 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6227 GAAGGCTACAAGCGGCCTTTGTCGTGTCGCGGGCGATCAAAGGCACGCGCATCGGCGGTG 6286 Query 4055 AGGTTGCCGAGGCGCTGGCCGGGTACGAGCTGCCCATTCTTGAGTCCCGTATCACGCAGC 4114 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6287 AGGTTGCCGAGGCGCTGGCCGGGTACGAGCTGCCCATTCTTGAGTCCCGTATCACGCAGC 6346 Query 4115 GCGTGAGCTACCCAGGCACTGCCGCCGCCGGCACAACCGTTCTTGAATCAGAACCCGAGG 4174 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6347 GCGTGAGCTACCCAGGCACTGCCGCCGCCGGCACAACCGTTCTTGAATCAGAACCCGAGG 6406 Query 4175 GCGACGCTGCCCGCGAGGTCCAGGCGCTGGCCGCTGAAATTAAATCAAAACTCATTTGAG 4234 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6407 GCGACGCTGCCCGCGAGGTCCAGGCGCTGGCCGCTGAAATTAAATCAAAACTCATTTGAG 6466 Query 4235 TTAATGAGGTAAAGAGAAAATGAGCAAAAGCACAAACACGCTAAGTGCCGGCCGTCCGAG 4294 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6467 TTAATGAGGTAAAGAGAAAATGAGCAAAAGCACAAACACGCTAAGTGCCGGCCGTCCGAG 6526 Query 4295 CGCACGCAGCAGCAAGGCTGCAACGTTGGCCAGCCTGGCAGACACGCCAGCCATGAAGCG 4354 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6527 CGCACGCAGCAGCAAGGCTGCAACGTTGGCCAGCCTGGCAGACACGCCAGCCATGAAGCG 6586 Query 4355 GGTCAACTTTCAGTTGCCGGCGGAGGATCACACCAAGCTGAAGATGTACGCGGTACGCCA 4414 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6587 GGTCAACTTTCAGTTGCCGGCGGAGGATCACACCAAGCTGAAGATGTACGCGGTACGCCA 6646 Query 4415 AGGCAAGACCATTACCGAGCTGCTATCTGAATACATCGCGCAGCTACCAGAGTAAATGAG 4474 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6647 AGGCAAGACCATTACCGAGCTGCTATCTGAATACATCGCGCAGCTACCAGAGTAAATGAG 6706 Query 4475 CAAATGAATAAATGAGTAGATGAATTTTAGCGGCTAAAGGAGGCGGCATGGAAAATCAAG 4534 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6707 CAAATGAATAAATGAGTAGATGAATTTTAGCGGCTAAAGGAGGCGGCATGGAAAATCAAG 6766 Query 4535 AACAACCAGGCACCGACGCCGTGGAATGCCCCATGTGTGGAGGAACGGGCGGTTGGCCAG 4594 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6767 AACAACCAGGCACCGACGCCGTGGAATGCCCCATGTGTGGAGGAACGGGCGGTTGGCCAG 6826 Query 4595 GCGTAAGCGGCTGGGTTGTCTGCCGGCCCTGCAATGGCACTGGAACCCCCAAGCCCGAGG 4654 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6827 GCGTAAGCGGCTGGGTTGTCTGCCGGCCCTGCAATGGCACTGGAACCCCCAAGCCCGAGG 6886 Query 4655 AATCGGCGTGACGGTCGCAAACCATCCGGCCCGGTACAAATCGGCGCGGCGCTGGGTGAT 4714 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6887 AATCGGCGTGACGGTCGCAAACCATCCGGCCCGGTACAAATCGGCGCGGCGCTGGGTGAT 6946 Query 4715 GACCTGGTGGAGAAGTTGAAGGCCGCGCAGGCCGCCCAGCGGCAACGCATCGAGGCAGAA 4774 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 6947 GACCTGGTGGAGAAGTTGAAGGCCGCGCAGGCCGCCCAGCGGCAACGCATCGAGGCAGAA 7006 Query 4775 GCACGCCCCGGTGAATCGTGGCAAGCGGCCGCTGATCGAATCCGCAAAGAATCCCGGCAA 4834 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7007 GCACGCCCCGGTGAATCGTGGCAAGCGGCCGCTGATCGAATCCGCAAAGAATCCCGGCAA 7066 Query 4835 CCGCCGGCAGCCGGTGCGCCGTCGATTAGGAAGCCGCCCAAGGGCGACGAGCAACCAGAT 4894 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7067 CCGCCGGCAGCCGGTGCGCCGTCGATTAGGAAGCCGCCCAAGGGCGACGAGCAACCAGAT 7126 Query 4895 TTTTTCGTTCCGATGCTCTATGACGTGGGCACCCGCGATAGTCGCAGCATCATGGACGTG 4954 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7127 TTTTTCGTTCCGATGCTCTATGACGTGGGCACCCGCGATAGTCGCAGCATCATGGACGTG 7186 Query 4955 GCCGTTTTCCGTCTGTCGAAGCGTGACCGACGAGCTGGCGAGGTGATCCGCTACGAGCTT 5014 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7187 GCCGTTTTCCGTCTGTCGAAGCGTGACCGACGAGCTGGCGAGGTGATCCGCTACGAGCTT 7246 Query 5015 CCAGACGGGCACGTAGAGGTTTCCGCAGGGCCGGCCGGCATGGCCAGTGTGTGGGATTAC 5074 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7247 CCAGACGGGCACGTAGAGGTTTCCGCAGGGCCGGCCGGCATGGCCAGTGTGTGGGATTAC 7306 Query 5075 GACCTGGTACTGATGGCGGTTTCCCATCTAACCGAATCCATGAACCGATACCGGGAAGGG 5134 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7307 GACCTGGTACTGATGGCGGTTTCCCATCTAACCGAATCCATGAACCGATACCGGGAAGGG 7366 Query 5135 AAGGGAGACAAGCCCGGCCGCGTGTTCCGTCCACACGTTGCGGACGTACTCAAGTTCTGC 5194 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7367 AAGGGAGACAAGCCCGGCCGCGTGTTCCGTCCACACGTTGCGGACGTACTCAAGTTCTGC 7426 Query 5195 CGGCGAGCCGATGGCGGAAAGCAGAAAGACGACCTGGTAGAAACCTGCATTCGGTTAAAC 5254 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7427 CGGCGAGCCGATGGCGGAAAGCAGAAAGACGACCTGGTAGAAACCTGCATTCGGTTAAAC 7486 Query 5255 ACCACGCACGTTGCCATGCAGCGTACGAAGAAGGCCAAGAACGGCCGCCTGGTGACGGTA 5314 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7487 ACCACGCACGTTGCCATGCAGCGTACGAAGAAGGCCAAGAACGGCCGCCTGGTGACGGTA 7546 Query 5315 TCCGAGGGTGAAGCCTTGATTAGCCGCTACAAGATCGTAAAGAGCGAAACCGGGCGGCCG 5374 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7547 TCCGAGGGTGAAGCCTTGATTAGCCGCTACAAGATCGTAAAGAGCGAAACCGGGCGGCCG 7606 Query 5375 GAGTACATCGAGATCGAGCTAGCTGATTGGATGTACCGCGAGATCACAGAAGGCAAGAAC 5434 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7607 GAGTACATCGAGATCGAGCTAGCTGATTGGATGTACCGCGAGATCACAGAAGGCAAGAAC 7666 Query 5435 CCGGACGTGCTGACGGTTCACCCCGATTACTTTTTGATCGATCCCGGCATCGGCCGTTTT 5494 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7667 CCGGACGTGCTGACGGTTCACCCCGATTACTTTTTGATCGATCCCGGCATCGGCCGTTTT 7726 Query 5495 CTCTACCGCCTGGCACGCCGCGCCGCAGGCAAGGCAGAAGCCAGATGGTTGTTCAAGACG 5554 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7727 CTCTACCGCCTGGCACGCCGCGCCGCAGGCAAGGCAGAAGCCAGATGGTTGTTCAAGACG 7786 Query 5555 ATCTACGAACGCAGTGGCAGCGCCGGAGAGTTCAAGAAGTTCTGTTTCACCGTGCGCAAG 5614 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7787 ATCTACGAACGCAGTGGCAGCGCCGGAGAGTTCAAGAAGTTCTGTTTCACCGTGCGCAAG 7846 Query 5615 CTGATCGGGTCAAATGACCTGCCGGAGTACGATTTGAAGGAGGAGGCGGGGCAGGCTGGC 5674 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7847 CTGATCGGGTCAAATGACCTGCCGGAGTACGATTTGAAGGAGGAGGCGGGGCAGGCTGGC 7906 Query 5675 CCGATCCTAGTCATGCGCTACCGCAACCTGATCGAGGGCGAAGCATCCGCCGGTTCCTAA 5734 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7907 CCGATCCTAGTCATGCGCTACCGCAACCTGATCGAGGGCGAAGCATCCGCCGGTTCCTAA 7966 Query 5735 TGTACGGAGCAGATGCTAGGGCAAATTGCCCTAGCAGGGGAAAAAGGTCGAAAAGGTCTC 5794 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 7967 TGTACGGAGCAGATGCTAGGGCAAATTGCCCTAGCAGGGGAAAAAGGTCGAAAAGGTCTC 8026 Query 5795 TTTCCTGTGGATAGCACGTACATTGGGAACCCAAAGCCGTACATTGGGAACCGGAACCCG 5854 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8027 TTTCCTGTGGATAGCACGTACATTGGGAACCCAAAGCCGTACATTGGGAACCGGAACCCG 8086 Query 5855 TACATTGGGAACCCAAAGCCGTACATTGGGAACCGGTCACACATGTAAGTGACTGATAta 5914 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8087 TACATTGGGAACCCAAAGCCGTACATTGGGAACCGGTCACACATGTAAGTGACTGATATA 8146 Query 5915 aaagagaaaaaaggcgatttttccgcctaaaactctttaaaacttattaaaactcttaaa 5974 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8147 AAAGAGAAAAAAGGCGATTTTTCCGCCTAAAACTCTTTAAAACTTATTAAAACTCTTAAA 8206 Query 5975 acCCGCCTGGCCTGTGCATAACTGTCTGGCCAGCGCACAGCCGAAGAGCTGCAAAAAGCG 6034 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8207 ACCCGCCTGGCCTGTGCATAACTGTCTGGCCAGCGCACAGCCGAAGAGCTGCAAAAAGCG 8266 Query 6035 CCTACCCTTCGGTCGCTGCGCTCCCTACGCCCCGCCGCTTCGCGTCGGCCTATCGCGGCC 6094 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8267 CCTACCCTTCGGTCGCTGCGCTCCCTACGCCCCGCCGCTTCGCGTCGGCCTATCGCGGCC 8326 Query 6095 GCTGGCCGCTCAAAAATGGCTGGCCTACGGCCAGGCAATCTACCAGGGCGCGGACAAGCC 6154 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8327 GCTGGCCGCTCAAAAATGGCTGGCCTACGGCCAGGCAATCTACCAGGGCGCGGACAAGCC 8386 Query 6155 GCGCCGTCGCCACTCGACCGCCGGCGCCCACATCAAGGCACCCTGCCTCGCGCGTTTCGG 6214 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8387 GCGCCGTCGCCACTCGACCGCCGGCGCCCACATCAAGGCACCCTGCCTCGCGCGTTTCGG 8446 Query 6215 TGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTA 6274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8447 TGATGACGGTGAAAACCTCTGACACATGCAGCTCCCGGAGACGGTCACAGCTTGTCTGTA 8506 Query 6275 AGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCG 6334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8507 AGCGGATGCCGGGAGCAGACAAGCCCGTCAGGGCGCGTCAGCGGGTGTTGGCGGGTGTCG 8566 Query 6335 GGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCG 6394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8567 GGGCGCAGCCATGACCCAGTCACGTAGCGATAGCGGAGTGTATACTGGCTTAACTATGCG 8626 Query 6395 GCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGC 6454 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8627 GCATCAGAGCAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGC 8686 Query 6455 GTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGC 6514 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8687 GTAAGGAGAAAATACCGCATCAGGCGCTCTTCCGCTTCCTCGCTCACTGACTCGCTGCGC 8746 Query 6515 TCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCC 6574 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8747 TCGGTCGTTCGGCTGCGGCGAGCGGTATCAGCTCACTCAAAGGCGGTAATACGGTTATCC 8806 Query 6575 ACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGG 6634 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8807 ACAGAATCAGGGGATAACGCAGGAAAGAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGG 8866 Query 6635 AACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCAT 6694 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8867 AACCGTAAAAAGGCCGCGTTGCTGGCGTTTTTCCATAGGCTCCGCCCCCCTGACGAGCAT 8926 Query 6695 CACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAG 6754 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8927 CACAAAAATCGACGCTCAAGTCAGAGGTGGCGAAACCCGACAGGACTATAAAGATACCAG 8986 Query 6755 GCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGA 6814 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 8987 GCGTTTCCCCCTGGAAGCTCCCTCGTGCGCTCTCCTGTTCCGACCCTGCCGCTTACCGGA 9046 Query 6815 TACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGG 6874 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9047 TACCTGTCCGCCTTTCTCCCTTCGGGAAGCGTGGCGCTTTCTCATAGCTCACGCTGTAGG 9106 Query 6875 TATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTT 6934 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9107 TATCTCAGTTCGGTGTAGGTCGTTCGCTCCAAGCTGGGCTGTGTGCACGAACCCCCCGTT 9166 Query 6935 CAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACAC 6994 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9167 CAGCCCGACCGCTGCGCCTTATCCGGTAACTATCGTCTTGAGTCCAACCCGGTAAGACAC 9226 Query 6995 GACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGC 7054 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9227 GACTTATCGCCACTGGCAGCAGCCACTGGTAACAGGATTAGCAGAGCGAGGTATGTAGGC 9286 Query 7055 GGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTT 7114 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9287 GGTGCTACAGAGTTCTTGAAGTGGTGGCCTAACTACGGCTACACTAGAAGGACAGTATTT 9346 Query 7115 GGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCC 7174 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9347 GGTATCTGCGCTCTGCTGAAGCCAGTTACCTTCGGAAAAAGAGTTGGTAGCTCTTGATCC 9406 Query 7175 GGCAAACAAACCACCGCTGGTAGCGGTGGtttttttGTTTGCAAGCAGCAGATTACGCGC 7234 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9407 GGCAAACAAACCACCGCTGGTAGCGGTGGTTTTTTTGTTTGCAAGCAGCAGATTACGCGC 9466 Query 7235 AGaaaaaaaGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGG 7294 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9467 AGAAAAAAAGGATCTCAAGAAGATCCTTTGATCTTTTCTACGGGGTCTGACGCTCAGTGG 9526 Query 7295 AACGAAAACTCACGTTAAGGGATTTTGGTCATGCATTCTAGGTACTAAAACAATTCATCC 7354 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9527 AACGAAAACTCACGTTAAGGGATTTTGGTCATGCATTCTAGGTACTAAAACAATTCATCC 9586 Query 7355 AGTAAAATATAATATTTTATTTTCTCCCAATCAGGCTTGATCCCCAGTAAGTCAAAAAAT 7414 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9587 AGTAAAATATAATATTTTATTTTCTCCCAATCAGGCTTGATCCCCAGTAAGTCAAAAAAT 9646 Query 7415 AGCTCGACATACTGTTCTTCCCCGATATCCTCCCTGATCGACCGGACGCAGAAGGCAATG 7474 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9647 AGCTCGACATACTGTTCTTCCCCGATATCCTCCCTGATCGACCGGACGCAGAAGGCAATG 9706 Query 7475 TCATACCACTTGTCCGCCCTGCCGCTTCTCCCAAGATCAATAAAGCCACTTACTTTGCCA 7534 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9707 TCATACCACTTGTCCGCCCTGCCGCTTCTCCCAAGATCAATAAAGCCACTTACTTTGCCA 9766 Query 7535 TCTTTCACAAAGATGTTGCTGTCTCCCAGGTCGCCGTGGGAAAAGACAAGTTCCTCTTCG 7594 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9767 TCTTTCACAAAGATGTTGCTGTCTCCCAGGTCGCCGTGGGAAAAGACAAGTTCCTCTTCG 9826 Query 7595 GGCTTTTCCGTCTTTAAAAAATCATACAGCTCGCGCGGATCTTTAAATGGAGTGTCTTCT 7654 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9827 GGCTTTTCCGTCTTTAAAAAATCATACAGCTCGCGCGGATCTTTAAATGGAGTGTCTTCT 9886 Query 7655 TCCCAGTTTTCGCAATCCACATCGGCCAGATCGTTATTCAGTAAGTAATCCAATTCGGCT 7714 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9887 TCCCAGTTTTCGCAATCCACATCGGCCAGATCGTTATTCAGTAAGTAATCCAATTCGGCT 9946 Query 7715 AAGCGGCTGTCTAAGCTATTCGTATAGGGACAATCCGATATGTCGATGGAGTGAAAGAGC 7774 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 9947 AAGCGGCTGTCTAAGCTATTCGTATAGGGACAATCCGATATGTCGATGGAGTGAAAGAGC 10006 Query 7775 CTGATGCACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGTTCATCTTCATACTCT 7834 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10007 CTGATGCACTCCGCATACAGCTCGATAATCTTTTCAGGGCTTTGTTCATCTTCATACTCT 10066 Query 7835 TCCGAGCAAAGGACGCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCATGCCGT 7894 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10067 TCCGAGCAAAGGACGCCATCGGCCTCACTCATGAGCAGATTGCTCCAGCCATCATGCCGT 10126 Query 7895 TCAAAGTGCAGGACCTTTGGAACAGGCAGCTTTCCTTCCAGCCATAGCATCATGTCCTTT 7954 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10127 TCAAAGTGCAGGACCTTTGGAACAGGCAGCTTTCCTTCCAGCCATAGCATCATGTCCTTT 10186 Query 7955 TCCCGTTCCACATCATAGGTGGTCCCTTTATACCGGCTGTCCGTCATTTTTAAATATAGG 8014 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10187 TCCCGTTCCACATCATAGGTGGTCCCTTTATACCGGCTGTCCGTCATTTTTAAATATAGG 10246 Query 8015 TTTTCATTTTCTCCCACCAGCTTATATACCTTAGCAGGAGACATTCCTTCCGTATCTTTT 8074 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10247 TTTTCATTTTCTCCCACCAGCTTATATACCTTAGCAGGAGACATTCCTTCCGTATCTTTT 10306 Query 8075 ACGCAGCGGTATTTTTCGATCAGTTTTTTCAATTCCGGTGATATTCTCATTTTAGCCATT 8134 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10307 ACGCAGCGGTATTTTTCGATCAGTTTTTTCAATTCCGGTGATATTCTCATTTTAGCCATT 10366 Query 8135 TATTATTTCCTTCCTCTTTTCTACAGTATTTAAAGATACCCCAAGAAGCTAATTATAACA 8194 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10367 TATTATTTCCTTCCTCTTTTCTACAGTATTTAAAGATACCCCAAGAAGCTAATTATAACA 10426 Query 8195 AGACGAACTCCAATTCACTGTTCCTTGCATTCTAAAACCTTAAATACCAGAAAACAGCTT 8254 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10427 AGACGAACTCCAATTCACTGTTCCTTGCATTCTAAAACCTTAAATACCAGAAAACAGCTT 10486 Query 8255 TTTCAAAGTTGTTTTCAAAGTTGGCGTATAACATAGTATCGACGGAGCCGATTTTGAAAC 8314 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10487 TTTCAAAGTTGTTTTCAAAGTTGGCGTATAACATAGTATCGACGGAGCCGATTTTGAAAC 10546 Query 8315 CGCGGTGATCACAGGCAGCAACGCTCTGTCATCGTTACAATCAACATGCTACCCTCCGCG 8374 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10547 CGCGGTGATCACAGGCAGCAACGCTCTGTCATCGTTACAATCAACATGCTACCCTCCGCG 10606 Query 8375 AGATCATCCGTGTTTCAAACCCGGCAGCTTAGTTGCCGTTCTTCCGAATAGCATCGGTAA 8434 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10607 AGATCATCCGTGTTTCAAACCCGGCAGCTTAGTTGCCGTTCTTCCGAATAGCATCGGTAA 10666 Query 8435 CATGAGCAAAGTCTGCCGCCTTACAACGGCTCTCCCGCTGACGCCGTCCCGGACTGATGG 8494 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10667 CATGAGCAAAGTCTGCCGCCTTACAACGGCTCTCCCGCTGACGCCGTCCCGGACTGATGG 10726 Query 8495 GCTGCCTGTATCGAGTGGTGATTTTGTGCCGAGCTGCCGGTCGGGGAGCTGTTGGCTGGC 8554 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10727 GCTGCCTGTATCGAGTGGTGATTTTGTGCCGAGCTGCCGGTCGGGGAGCTGTTGGCTGGC 10786 Query 8555 TGGTGGCAGGATATATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACACATT 8614 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10787 TGGTGGCAGGATATATTGTGGTGTAAACAAATTGACGCTTAGACAACTTAATAACACATT 10846 Query 8615 GCGGACGTTTTTAATGTACTGAATTAACGCCGAATTAATTCGGGGGATCTGGATTTTAGT 8674 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10847 GCGGACGTTTTTAATGTACTGAATTAACGCCGAATTAATTCGGGGGATCTGGATTTTAGT 10906 Query 8675 ACTGGATTTTGGTTTTAGGAATTAGAAATTTTATTGATAGAAGTATTTTACAAATACAAA 8734 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10907 ACTGGATTTTGGTTTTAGGAATTAGAAATTTTATTGATAGAAGTATTTTACAAATACAAA 10966 Query 8735 TACATACTAAGGGTTTCTTATATGCTCAACACATGAGCGAAACCCTATAGGAACCCTAAT 8794 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 10967 TACATACTAAGGGTTTCTTATATGCTCAACACATGAGCGAAACCCTATAGGAACCCTAAT 11026 Query 8795 TCCCTTATCTGGGAACTACTCACACATTATTATGGAGAAACTCGAGCTTGTCGATCGACA 8854 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11027 TCCCTTATCTGGGAACTACTCACACATTATTATGGAGAAACTCGAGCTTGTCGATCGACA 11086 Query 8855 GATCCGGTCGGCATCTACTCTATTTCTTTGCCCTCGGACGAGTGCTGGGGCGTCGGTTTC 8914 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11087 GATCCGGTCGGCATCTACTCTATTTCTTTGCCCTCGGACGAGTGCTGGGGCGTCGGTTTC 11146 Query 8915 CACTATCGGCGAGTACTTCTACACAGCCATCGGTCCAGACGGCCGCGCTTCTGCGGGCGA 8974 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11147 CACTATCGGCGAGTACTTCTACACAGCCATCGGTCCAGACGGCCGCGCTTCTGCGGGCGA 11206 Query 8975 TTTGTGTACGCCCGACAGTCCCGGCTCCGGATCGGACGATTGCGTCGCATCGACCCTGCG 9034 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11207 TTTGTGTACGCCCGACAGTCCCGGCTCCGGATCGGACGATTGCGTCGCATCGACCCTGCG 11266 Query 9035 CCCAAGCTGCATCATCGAAATTGCCGTCAACCAAGCTCTGATAGAGTTGGTCAAGACCAA 9094 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11267 CCCAAGCTGCATCATCGAAATTGCCGTCAACCAAGCTCTGATAGAGTTGGTCAAGACCAA 11326 Query 9095 TGCGGAGCATATACGCCCGGAGTCGTGGCGATCCTGCAAGCTCCGGATGCCTCCGCTCGA 9154 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11327 TGCGGAGCATATACGCCCGGAGTCGTGGCGATCCTGCAAGCTCCGGATGCCTCCGCTCGA 11386 Query 9155 AGTAGCGCGTCTGCTGCTCCATACAAGCCAACCACGGCCTCCAGAAGAAGATGTTGGCGA 9214 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11387 AGTAGCGCGTCTGCTGCTCCATACAAGCCAACCACGGCCTCCAGAAGAAGATGTTGGCGA 11446 Query 9215 CCTCGTATTGGGAATCCCCGAACATCGCCTCGCTCCAGTCAATGACCGCTGTTATGCGGC 9274 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11447 CCTCGTATTGGGAATCCCCGAACATCGCCTCGCTCCAGTCAATGACCGCTGTTATGCGGC 11506 Query 9275 CATTGTCCGTCAGGACATTGTTGGAGCCGAAATCCGCGTGCACGAGGTGCCGGACTTCGG 9334 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11507 CATTGTCCGTCAGGACATTGTTGGAGCCGAAATCCGCGTGCACGAGGTGCCGGACTTCGG 11566 Query 9335 GGCAGTCCTCGGCCCAAAGCATCAGCTCATCGAGAGCCTGCGCGACGGACGCACTGACGG 9394 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11567 GGCAGTCCTCGGCCCAAAGCATCAGCTCATCGAGAGCCTGCGCGACGGACGCACTGACGG 11626 Query 9395 TGTCGTCCATCACAGTTTGCCAGTGATACACATGGGGATCAGCAATCGCGCATATGAAAT 9454 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11627 TGTCGTCCATCACAGTTTGCCAGTGATACACATGGGGATCAGCAATCGCGCATATGAAAT 11686 Query 9455 CACGCCATGTAGTGTATTGACCGATTCCTTGCGGTCCGAATGGGCCGAACCCGCTCGTCT 9514 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11687 CACGCCATGTAGTGTATTGACCGATTCCTTGCGGTCCGAATGGGCCGAACCCGCTCGTCT 11746 Query 9515 GGCTAAGATCGGCCGCAGCGATCGCATCCATAGCCTCCGCGACCGGTTGTAGAACAGCGG 9574 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11747 GGCTAAGATCGGCCGCAGCGATCGCATCCATAGCCTCCGCGACCGGTTGTAGAACAGCGG 11806 Query 9575 GCAGTTCGGTTTCAGGCAGGTCTTGCAACGTGACACCCTGTGCACGGCGGGAGATGCAAT 9634 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11807 GCAGTTCGGTTTCAGGCAGGTCTTGCAACGTGACACCCTGTGCACGGCGGGAGATGCAAT 11866 Query 9635 AGGTCAGGCTCTCGCTAAACTCCCCAATGTCAAGCACTTCCGGAATCGGGAGCGCGGCCG 9694 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11867 AGGTCAGGCTCTCGCTAAACTCCCCAATGTCAAGCACTTCCGGAATCGGGAGCGCGGCCG 11926 Query 9695 ATGCAAAGTGCCGATAAACATAACGATCTTTGTAGAAACCATCGGCGCAGCTATTTACCC 9754 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11927 ATGCAAAGTGCCGATAAACATAACGATCTTTGTAGAAACCATCGGCGCAGCTATTTACCC 11986 Query 9755 GCAGGACATATCCACGCCCTCCTACATCGAAGCTGAAAGCACGAGATTCTTCGCCCTCCG 9814 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 11987 GCAGGACATATCCACGCCCTCCTACATCGAAGCTGAAAGCACGAGATTCTTCGCCCTCCG 12046 Query 9815 AGAGCTGCATCAGGTCGGAGACGCTGTCGAACTTTTCGATCAGAAACTTCTCGACAGACG 9874 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12047 AGAGCTGCATCAGGTCGGAGACGCTGTCGAACTTTTCGATCAGAAACTTCTCGACAGACG 12106 Query 9875 TCGCGGTGAGTTCAGGCTTTTTCATATCTCATTGCCCCCCGGGATCTGCGAAAGCTCGAG 9934 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12107 TCGCGGTGAGTTCAGGCTTTTTCATATCTCATTGCCCCCCGGGATCTGCGAAAGCTCGAG 12166 Query 9935 AGAGATAGATTTGTAGAGAGAGACTGGTGATTTCAGCGTGTCCTCTCCAAATGAAATGAA 9994 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12167 AGAGATAGATTTGTAGAGAGAGACTGGTGATTTCAGCGTGTCCTCTCCAAATGAAATGAA 12226 Query 9995 CTTCCTTATATAGAGGAAGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGT 10054 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12227 CTTCCTTATATAGAGGAAGGTCTTGCGAAGGATAGTGGGATTGTGCGTCATCCCTTACGT 12286 Query 10055 CAGTGGAGATATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTT 10114 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12287 CAGTGGAGATATCACATCAATCCACTTGCTTTGAAGACGTGGTTGGAACGTCTTCTTTTT 12346 Query 10115 CCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTT 10174 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12347 CCACGATGCTCCTCGTGGGTGGGGGTCCATCTTTGGGACCACTGTCGGCAGAGGCATCTT 12406 Query 10175 GAACGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGTGCCACCTTCCTTTTCTA 10234 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12407 GAACGATAGCCTTTCCTTTATCGCAATGATGGCATTTGTAGGTGCCACCTTCCTTTTCTA 12466 Query 10235 CTGTCCTTTTGATGAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCCGATA 10294 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12467 CTGTCCTTTTGATGAAGTGACAGATAGCTGGGCAATGGAATCCGAGGAGGTTTCCCGATA 12526 Query 10295 TTACCCTTTGTTGAAAAGTCTCAATAGCCCTTTGGTCTTCTGAGACTGTATCTTTGATAT 10354 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12527 TTACCCTTTGTTGAAAAGTCTCAATAGCCCTTTGGTCTTCTGAGACTGTATCTTTGATAT 12586 Query 10355 TCTTGGAGTAGACGAGAGTGTCGTGCTCCACCATGTTATCACATCAATCCACTTGCTTTG 10414 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12587 TCTTGGAGTAGACGAGAGTGTCGTGCTCCACCATGTTATCACATCAATCCACTTGCTTTG 12646 Query 10415 AAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTT 10474 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12647 AAGACGTGGTTGGAACGTCTTCTTTTTCCACGATGCTCCTCGTGGGTGGGGGTCCATCTT 12706 Query 10475 TGGGACCACTGTCGGCAGAGGCATCTTGAACGATAGCCTTTCCTTTATCGCAATGATGGC 10534 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12707 TGGGACCACTGTCGGCAGAGGCATCTTGAACGATAGCCTTTCCTTTATCGCAATGATGGC 12766 Query 10535 ATTTGTAGGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTGGGC 10594 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12767 ATTTGTAGGTGCCACCTTCCTTTTCTACTGTCCTTTTGATGAAGTGACAGATAGCTGGGC 12826 Query 10595 AATGGAATCCGAGGAGGTTTCCCGATATTACCCTTTGTTGAAAAGTCTCAATAGCCCTTT 10654 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12827 AATGGAATCCGAGGAGGTTTCCCGATATTACCCTTTGTTGAAAAGTCTCAATAGCCCTTT 12886 Query 10655 GGTCTTCTGAGACTGTATCTTTGATATTCTTGGAGTAGACGAGAGTGTCGTGCTCCACCA 10714 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12887 GGTCTTCTGAGACTGTATCTTTGATATTCTTGGAGTAGACGAGAGTGTCGTGCTCCACCA 12946 Query 10715 TGTTGGCAAGCTGCTCTAGCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCA 10774 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 12947 TGTTGGCAAGCTGCTCTAGCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCA 13006 Query 10775 TTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAAT 10834 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13007 TTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAAT 13066 Query 10835 TAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCG 10894 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13067 TAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCG 13126 Query 10895 TATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGA 10954 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13127 TATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGA 13186 Query 10955 TTACGAATTCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAAT 11014 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13187 TTACGAATTCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAAT 13246 Query 11015 TAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCG 11074 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13247 TAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCG 13306 Query 11075 TATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGA 11134 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13307 TATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGA 13366 Query 11135 TTACGCCAAGCTTGCATGCCTGCAGGTCAACATGGTGGAGCACGACACTCTCGTCTACTC 11194 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13367 TTACGCCAAGCTTGCATGCCTGCAGGTCAACATGGTGGAGCACGACACTCTCGTCTACTC 13426 Query 11195 CAAGAATATCAAAGATACAGTCTCAGAAGACCAGAGGGCTATTGAGACTTTTCAACAAAG 11254 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13427 CAAGAATATCAAAGATACAGTCTCAGAAGACCAGAGGGCTATTGAGACTTTTCAACAAAG 13486 Query 11255 GGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCGAAAG 11314 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13487 GGTAATATCGGGAAACCTCCTCGGATTCCATTGCCCAGCTATCTGTCACTTCATCGAAAG 13546 Query 11315 GACAGTAGAAAAGGAAGATGGCTTCTACAAATGCCATCATTGCGATAAAGGAAAGGCTAT 11374 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13547 GACAGTAGAAAAGGAAGATGGCTTCTACAAATGCCATCATTGCGATAAAGGAAAGGCTAT 13606 Query 11375 CGTTCAAGATGCCTCTACCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAACAT 11434 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13607 CGTTCAAGATGCCTCTACCGACAGTGGTCCCAAAGATGGACCCCCACCCACGAGGAACAT 13666 Query 11435 CGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATGGTCA 11494 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13667 CGTGGAAAAAGAAGACGTTCCAACCACGTCTTCAAAGCAAGTGGATTGATGTGATGGTCA 13726 Query 11495 ACATGGTGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAG 11554 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13727 ACATGGTGGAGCACGACACTCTCGTCTACTCCAAGAATATCAAAGATACAGTCTCAGAAG 13786 Query 11555 ACCAGAGGGCTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCC 11614 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13787 ACCAGAGGGCTATTGAGACTTTTCAACAAAGGGTAATATCGGGAAACCTCCTCGGATTCC 13846 Query 11615 ATTGCCCAGCTATCTGTCACTTCATCGAAAGGACAGTAGAAAAGGAAGATGGCTTCTACA 11674 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13847 ATTGCCCAGCTATCTGTCACTTCATCGAAAGGACAGTAGAAAAGGAAGATGGCTTCTACA 13906 Query 11675 AATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTACCGACAGTGGTC 11734 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13907 AATGCCATCATTGCGATAAAGGAAAGGCTATCGTTCAAGATGCCTCTACCGACAGTGGTC 13966 Query 11735 CCAAAGATGGACCCCCACCCACGAGGAACATCGTGGAAAAAGAAGACGTTCCAACCACGT 11794 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 13967 CCAAAGATGGACCCCCACCCACGAGGAACATCGTGGAAAAAGAAGACGTTCCAACCACGT 14026 Query 11795 CTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCC 11854 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14027 CTTCAAAGCAAGTGGATTGATGTGATATCTCCACTGACGTAAGGGATGACGCACAATCCC 14086 Query 11855 ACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGG 11910 |||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 14087 ACTATCCTTCGCAAGACCCTTCCTCTATATAAGGAAGTTCATTTCATTTGGAGAGG 14142
Read full office action

Prosecution Timeline

Dec 26, 2024
Application Filed
Feb 24, 2026
Non-Final Rejection mailed — §103, §112
May 26, 2026
Response Filed
Jul 31, 2026
Final Rejection mailed — §103, §112 (current)

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

3-4
Expected OA Rounds
83%
Grant Probability
99%
With Interview (+27.8%)
2y 3m (~7m remaining)
Median Time to Grant
Moderate
PTA Risk
Based on 6 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month