Prosecution Insights
Last updated: April 19, 2026
Application No. 18/697,038

PLANT DISEASE RESISTANCE GENES AGAINST STEM RUST AND METHODS OF USE

Non-Final OA §101§102§112
Filed
Mar 29, 2024
Examiner
ORDAZ, CHRISTIAN JOSE
Art Unit
1663
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
The Sainsbury Laboratory
OA Round
1 (Non-Final)
64%
Grant Probability
Moderate
1-2
OA Rounds
3y 0m
To Grant
99%
With Interview

Examiner Intelligence

Grants 64% of resolved cases
64%
Career Allow Rate
9 granted / 14 resolved
+4.3% vs TC avg
Strong +100% interview lift
Without
With
+100.0%
Interview Lift
resolved cases with interview
Typical timeline
3y 0m
Avg Prosecution
29 currently pending
Career history
43
Total Applications
across all art units

Statute-Specific Performance

§101
9.1%
-30.9% vs TC avg
§103
32.2%
-7.8% vs TC avg
§102
18.2%
-21.8% vs TC avg
§112
35.2%
-4.8% vs TC avg
Black line = Tech Center average estimate • Based on career data from 14 resolved cases

Office Action

§101 §102 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Election/Restrictions The Office acknowledges the receipt of Applicant’s restriction election filed on September 05, 2025 Applicant elects Group I, according to claims 1, 2, 6, 10, 13, 14, 16, 17, 20-25, 30, 31, and 34, without traverse. However, for the species election the Applicant elects SEQ ID NO: 14 with traverse stating that “[t]he amino acid sequence corresponding to SEQ ID NO: 14 is SEQ ID NO: 15. The Specification further discloses SEQ ID NO: 16, which sets forth the nucleotide sequence of the full-length coding region of the cDNA of Sr62, and SEQ ID NO: 17, which sets forth the nucleotide sequence of the transcript of Sr62”, (see Applicant’s traversal 09/05/2025, page 2). Applicant’s traversals are persuasive. The species election requirement is withdrawn. The restriction is made FINAL. Claim Status 2. Claims 1, 6, 13-14, 16-17, 20-25, 30-31, and 33-36, are pending. Claims 2-5, 7-10, 11-12, 15, 18-19, 26-29, 32, and 37-39, are canceled. Claims 33 and 35-36, are withdrawn. Claims 1, 6, 13-14, 16-17, 20-25, 30-31, and 34, are examined in the instant application. Furthermore, claim 10 shows canceled in page 2, however on page 3 claim 10 is also indicated as previously presented. Therefore, the Office is treating it as it is canceled and claim 10 will not be examined on its merits. Priority This application is claiming the priority benefit of provisional App# 63/250,413 filed September 30, 2021. Information Disclosure Statement The information disclosure statement (IDS) submitted on December 03, 2025, is being considered by the examiner. Claim Rejections - 35 USC § 101 5. 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. 6. Claims 1, 6, 13-14, 16-17, 20-25, 30, 31 and 34, are rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claim(s) do not fall within at least one of the four categories of patent eligible subject matter because the claimed invention is directed to a natural phenomenon without conveying a “markedly different” characteristic. As described in MPEP § 2106, subsection III, Step 2A of the Office’s eligibility analysis is the first part of the Alice/Mayo test, i.e., the Supreme Court’s "framework for distinguishing patents that claim laws of nature, natural phenomena, and abstract ideas from those that claim patent-eligible applications of those concepts." Alice Corp. Pty. Ltd. v. CLS Bank Int'l, 573 U.S. 208, 217-18, 110 USPQ2d 1976, 1981 (2014) (citing Mayo, 566 U.S. at 77-78, 101 USPQ2d at 1967-68). Claim interpretation: The limitations “transformed” and “transgenic” are not given patentable weight because there is nothing in the plant that is structurally different to make it transgenic. In regard to claim 1, the vector comprising a nucleic acid molecule is indistinguishable from the naturally occurring gene from a wild-type Aegilops sharonensis wheat plant. The specification discloses SEQ ID NO:14 encoding SEQ ID NO:15 is a wildtype sequence obtained from A. sharonensis. The claimed invention is directed to a naturally-occurring nucleic acid or fragment thereof, whether isolated or not, that is not patent-eligible pursuant to the Supreme Court decision in Association for Molecular Pathology v. Myriad Genetics, Inc., --U.S.--(June 13, 2013). In regard to claim 6, a transformed host cell is indistinguishable from the naturally occurring A. sharonensis cell. In regard to claim 13, the transgenic plant or seed comprising the heterologous polynucleotide is indistinguishable from the naturally occurring A. sharonensis plant or seed comprising SEQ ID NO: 14 or expressing SEQ ID NO: 15. In regard to claim 14, the transgenic plant or seed comprising the promoter is indistinguishable from the naturally occurring A. sharonensis plant or seed comprising a wild-type promoter. In regard to claim 16, the transgenic plant or seed is indistinguishable from the naturally occurring A. sharonensis wheat plant or seed. In regard to claim 17, the transgenic plant or seed comprising a nucleic acid molecule that is claimed is indistinguishable from a naturally occurring wild-type A. sharonensis plant which inherently resistant to Puccinia graminis f. sp. tritici. In regard to claim 20, the naturally occurring A. sharonensis naturally hybridizes with another wheat plant and passes on the resistant gene to a wild-type progeny A. sharonensis plant, which is the same as the claimed method and does not require the hand of man. In regard to claim 21, when the A. sharonensis plant that comprises the naturally occurring SEQ ID NO: 14 hybridizes with another wild-type plant, the resistant gene is stably incorporated into the genome of the progeny plant. Therefore, the method of stably incorporating the polynucleotide construct into the genome of a plant cell is indistinguishable from the naturally occurring process of A. sharonensis plants in the wild. In regard to claim 22, the wildtype progeny A. sharonensis cell naturally fully regenerates into a mature wheat plant and comprises the resistance gene in its genome. In regard to claims 23-24, the wild-type gene in the progeny plant inherently comprises at least one of the recited promoters in claim 24, because the resistance gene is expressed. In regard to claim 25, the naturally occurring progeny plant, which expresses the gene comprising SEQ ID NO:14 encoding SEQ ID NO:15, is inherently resistant to the pathogen Puccinia graminis f. sp. tritici. In regard to claim 30, the naturally occurring A. sharonensis wheat plant does naturally hybridize with another wheat plant passing on the resistant genes to another wild-type. Additionally, when two plants cross and they produce a seed, the seed will fall to the ground, which is the same as Applicant’s “planting” step. The planted seed grows into a wheat plant carrying the stem rust resistance gene therefore limiting wheat stem rust infection in a field. The recitation of “crop” is not given patentable weight because no structure is recited which distinguishes Applicant’s crop from a field of naturally occurring A. sharonensis plants. In regard to claim 31, Applicant’s “harvesting” step is indistinguishable from birds picking or collecting at least one seed from the naturally occurring wheat plant growing in a field. In regard to claim 34, the polypeptide comprising the amino acid sequence 15 is indistinguishable from the naturally occurring A. sharonensis wheat plant expressing SEQ ID NO:15. Claim Rejections - 35 USC § 112(a) (Written description) 7. The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor of carrying out his invention. 8. Claims 1, 6, 13-14, 16-17, 20-25, 30-31, and 34, are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for applications subject to pre-AIA 35 U.S.C. 112, the inventor(s), at the time the application was filed, had possession of the claimed invention. Applicant’s disclosure is as follows. Applicant identified stem rust resistance gene Sr62 (SEQ ID NO: 14-17) from Aegilops sharonensis accession 1644 that confers fungal resistance P. graminis, (see page 40-44 example 2), specifically race TKTTF, TTKSK, QTHJC, TKTSC, TTTTF, TTTTC, TTRTF, TKKTF, TTRTF, and TTKTT, (see figures 2D and 3). Additionally, Applicant transformed a susceptible wheat plant (Fielder) with SEQ ID NO: 15, which conferred resistance, (see page 40-44 example 2 and figure 2). Any gene with at least 85% sequence identity – Only shown 100% SEQ ID NO: 14-17 from Aegilops sharonensis accession 1644. The claimed invention lacks adequate written description for the following reasons. Claims 1, 13, 20, and 34, are directed to an expression or vector construct comprising SEQ ID NO: 14-17, that was isolated from the natural occurring A. sharonensis accession 1644 plant. Additionally, these sequences having at least 85% sequence identity to SEQ ID NO: 14-17 (also known as Sr62, tandem kinase proteins (TKP) or Sr-1644-1Sh), (see specification page 40 line 9), the 85% scope encompasses genes obtained from sources other than A. sharonensis accession 1644, whereby their structures and identities are not disclosed, so long as they share at least 85% sequence identity to SEQ ID NO: 14-17. While one skilled in the art can theoretically generate a population of sequences having 85% sequence identity to any of SEQ ID Nos. 14-17, one skilled in the art cannot predict which sequence(s) within said population would confer wheat stem rust resistance to a plant. From the disclosure of SEQ ID Nos. 14-17 one skilled in the art cannot predict the structures of other sequences within the 85% sequence identity from other sources and their allelic variants having stem rust resistance. Applicant does not disclose a common structure or motif sequences within the 85% sequence identity that would allow one skilled in the art to predict sequences from other sources, including monocots and dicots. The claims encompass mutants, derivatives, fragments, and allelic variants of SEQ ID Nos. 14-17 and thus imply that structural variants exist in nature, yet no structural variant has been disclosed. The implication is that there is a gene and a protein other than that disclosed which exists in nature, but the structure thereof is not known. The disclosure of SEQ ID NO: 14-17 isolated from A. sharonensis accession 1644 is not representative of other sequences having 85% sequence identity to any one of SEQ ID Nos. 14-17 for conferring stem rust resistance. Thus, there are insufficient relevant identifying characteristics to allow one skilled in the art to predictably determine such allelic variants or other genes for conferring stem rust resistance, from another plant other than A. sharonensis accession 1644, absent further guidance. Accordingly, there is lack of adequate description to inform a skilled artisan that Applicant was in possession of the claimed invention at the time of filing. See Written Description guidelines published in Federal Register/ Vol.66, No. 4/ Friday, January 5, 2001/ Notices; p. 1099-1111 Claim Rejections - 35 USC § 112(a) (Enablement) 9. Claims 1, 6, 13-14, 16-17, 20-25, 30-31, and 34, are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. An “analysis of whether a particular claim is supported by the disclosure in an application requires a determination of whether that disclosure, when filed, contained sufficient information regarding the subject matter of the claims as to enable one skilled in the pertinent art to make and use the claimed invention.” MPEP 2164.01. “A conclusion of lack of enablement means that. . . the specification, at the time the application was filed, would not have taught one skilled in the art how to make and/or use the full scope of the claimed invention [i.e. commensurate scope] without undue experimentation.” In re Wright, 999 F.2d 1557,1562, 27 USPQ2d 1510, 1513 (Fed. Cir. 1993); MPEP 2164.01. In In re Wands, 858 F.2d 731,8 USPQ2d 1400 (Fed. Cir. 1988), several factors implicated in determination of whether a disclosure satisfies the enablement requirement and whether any necessary experimentation is “undue” are identified. These factors include, but are not limited to: (A) The breadth of the claims; (B) The nature of the invention; (C) The state of the prior art; (D) The level of one of ordinary skill; (E) The level of predictability in the art; (F) The amount of direction provided by the inventor; (G) The existence of working examples; and (H) The quantity of experimentation needed to make or use the invention based on the content of the disclosure. In re Wands, 858 F.2d 731,737, 8 USPQ2d 1400, 1404 (Fed. Cir. 1988). No single factor is independently determinative of enablement; rather “[i]t is improper to conclude that a disclosure is not enabling based on an analysis of only one of the above factors while ignoring one or more of the others.” MPEP 2164.01. Likewise, all factors may not be relevant to the enablement analysis of any individual claim. Applicant’s disclosure is as set forth above. The claimed invention is not enabled for the following reasons. To comply with 35 USC 112(a) enablement, one skilled in the art must be able to make and use the claimed invention. The nature of the claimed invention is introducing a gene to a plant to confer resistance to stem rust. The breadth of the claims encompasses mutations comprising deletions, additions, substitutions and any combination thereof to SEQ ID NO.: 14-17 within the 85% sequence identity scope, so long as said mutations retain resistance to wheat stem rust when expressed in a plant. With regard to claims 1, 13, 20, and 34, none of the working examples show a sequence having at least 85% sequence identity to SEQ ID NOs: 14-17 (also known as Sr62, tandem kinase proteins (TKP) or Sr-1644-1Sh), (see specification page 40 line 9), for conferring stem rust resistance to a plant. Neither the state of the prior art nor Applicant’s disclosure teaches which regions of SEQ ID Nos. 14-17 must be retained for stem rust resistance. It is unlikely that any sequence within the 85% sequence identity genus would be able to confer stem rust resistance to a plant, as some mutations would alter the three-dimensional structure of SEQ ID NO:15 necessary for recognition and activation of the resistance mechanism. Applicant provides no guidance as to how one skilled in the art can readily identify operable embodiments or eliminate inoperable embodiments without resorting to random trial and error requiring undue experimentation. Jones, J. (Plant Disease Resistance Genes: Structure, Function and Evolution. Apr. 1996. Science Direct, Current Opinion in Biotechnology Volume 7, Issue 2, Pages 155-160 (U)), mentions that “some R gene loci carry specificities that were once termed alleles, but which on closer examination can recombine quite frequently. Also, some of these 'alleles' are highly unstable, exhibiting frequent meiotic loss. The Rp1 locus of maize has been investigated in detail [47], and loss of Rp allele function has been correlated with meiotic recombination [48]. This substantiates the idea that some R gene loci might exist as tandem repeats of related sequences and that these repeats might exhibit unequal crossing over that might not only lead to loss of certain specificities, but also create new specificities.” This suggests that the sequence identity at the loci is dynamic and is prone to change due to recombination within these repetitive structure, which results in new or lost resistance specificities. This constant change would not allow one skilled in the art to predictably produce a gene with said phenotype. Given the breadth of the claims, the lack of sufficient guidance, the absence of working examples within the 85% sequence identity scope, the state of the prior art, and unpredictability in the art, one skilled in the art cannot make and use the claimed invention as commensurate in scope with the claims without excessive burden and undue experimentation. Claim Rejections - 35 USC § 112(b)(Indefinite) 10. The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. 11. Claims 1, 6, 13-14, 16-17, 20-25, 30-31, and 34, are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. In regard to claims 1, 13, and 20, sections (c) and (d), the term “capable” is unclear, because it is not known what conditions are necessary for the nucleic acid molecule to be capable of conferring resistance to stem rust. In regard to claim 20, the term “enhancing” is indefinite because it lacks a comparative basis. In regard to claim 30, line 2, “a wheat seed” should be amended to “the wheat seed” for proper antecedence. Clarification/correction is required. Claim Rejections - 35 USC § 102 12. In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. 13. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. 14. Claim 1, is rejected under 35 U.S.C. 102(a)(1) as being anticipated by NCBI (Hordeum vulgare subsp. vulgare cDNA clone: FLbaf134f22 GenBank: AK251960. 2009 (V)). In regard to claim 1, NCBI discloses GenBank: AK251960 sequence having 86% sequence identity to Applicant’s SEQ ID NO: 16, (see sequence alignment below). Since Applicants claims that any sequence with at least 85% sequence identity confers resistance to stem rust resistance to a wheat plant, therefore the function is inherent to the structure. LOCUS AK251960 2883 bp mRNA linear PLN 22-APR-2009 DEFINITION Hordeum vulgare subsp. vulgare cDNA clone: FLbaf134f22, mRNA sequence. ACCESSION AK251960 VERSION AK251960.1 KEYWORDS FLI_CDNA. SOURCE Hordeum vulgare subsp. vulgare (domesticated barley) ORGANISM Hordeum vulgare subsp. vulgare Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Pooideae; Triticodae; Triticeae; Hordeinae; Hordeum. REFERENCE 1 AUTHORS Sato,K., Shin-I,T., Seki,M., Shinozaki,K., Yoshida,H., Takeda,K., Yamazaki,Y., Conte,M. and Kohara,Y. TITLE Development of 5006 Full-Length CDNAs in Barley: A Tool for Accessing Cereal Genomics Resources JOURNAL DNA Res. 16 (2), 81-89 (2009) PUBMED 19150987 REFERENCE 2 (bases 1 to 2883) AUTHORS Sato,K., Shin-i,T., Minakuchi,Y., Takeda,K. and Kohara,Y. TITLE Direct Submission JOURNAL Submitted (09-JUL-2007) Contact:Kazuhiro Sato Okayama University, CREST, Barley Germplasm Center, Research Institute for Bioresources; 2-20-1 Chuo, Kurashiki, Okayama 710-0046, Japan URL :http://shigen.lab.nig.ac.jp/barley/ FEATURES Location/Qualifiers source 1..2883 /organism="Hordeum vulgare subsp. vulgare" /mol_type="mRNA" /cultivar="Haruna Nijo" /sub_species="vulgare" /db_xref="taxon:112509" /clone="FLbaf134f22" /tissue_type="mixture of seed, leaf, spike, stem and root" /clone_lib="K Sato, M Seki, K Shinozaki unpublished cDNA library" /dev_stage="mixture of germination, seedling, vegetative, heading and maturing" >Hordeum vulgare subsp. vulgare cDNA clone: FLbaf134f22, mRNA sequence Sequence ID: AK251960.1 Length: 2883 Range 1: 198 to 2426 Score:2351 bits(1273), Expect:0.0, Identities:1919/2236(86%), Gaps:23/2236(1%), Strand: Plus/Plus Query 1 ATGGACGGATACGAGTTCGAGAGGGCGGAGATAGATGCACTGGAGCGCGTCGTACGGGAT 60 |||||||||||||||||||||||||||||| ||| ||||||||||||||||||| | ||| Sbjct 198 ATGGACGGATACGAGTTCGAGAGGGCGGAGCTAGCTGCACTGGAGCGCGTCGTAGGCGAT 257 Query 61 CCAAGAGAAAAGCCAATAAGCCTGTCGTTTTGGCTTCTCAGGCGCATAACGAATGATTTC 120 || || | |||| | || |||||| |||||| ||||||||||||||||| |||| |||| Sbjct 258 CCGAGCGCAAAGGCGATGAGCCTGACGTTTTCCCTTCTCAGGCGCATAACAAATGGTTTC 317 Query 121 TCTAACGCATCTGAAATTGGTCGAGGTGGATTTTCGAACGTTTACCTGGGGGTGCTTCCA 180 || | | | | |||||| || |||| ||||| |||||| |||||||||||||| Sbjct 318 TCCGATGATTTTCTAATTGGGCGCGGTGCTTTTTCAGTGGTTTACATGGGGGTGCTTCCA 377 Query 181 AGTGGGTTGCGTATTGCTGTCAAAAAGCTTTACCAACT-TAC-TGCATTGGCT--AA-TG 235 |||||||| | ||||||||||| ||||||| || || | | || ||||| | || || Sbjct 378 AGTGGGTTACAAATTGCTGTCAAGAAGCTTTTCC--CTCTGCTTGGATTGGATGAAAGTG 435 Query 236 AATTTGAAGATGAAGTTCTTACCACAATGAGGGTTGCTCACAAAAACATAGTGCGACTCA 295 ||| || |||||||| | |||| |||||||||||||||||| ||| ||||||||||| Sbjct 436 CGTTTAAAAATGAAGTTTTGACCAAAATGAGGGTTGCTCACAAGAACGTAGTGCGACTCG 495 Query 296 TAGGCTACTGTCGTCACACGCAATCTGAAGTCTTCGAATTAAAAGGAGAATCTATTTTCG 355 ||||||||||| ||||||||||||||||| ||||||||| |||||| ||||| |||||| Sbjct 496 TAGGCTACTGTAGTCACACGCAATCTGAAATCTTCGAATACAAAGGAAAATCTGTTTTCG 555 Query 356 CACAGGTCAGAGAAAGGTTGATCTGTACAGAGTATGTGCCTAATGGAACTCTTGATGGAC 415 || |||||||| |||||||||||||||| |||||||||||| ||||||| ||| | | Sbjct 556 CAGAGGTCAGACAAAGGTTGATCTGTACGGAGTATGTGCCTCATGGAACCCTTCACAGGT 615 Query 416 ATATCACTGATAAGTTTCATGGAGGACTTGATTGGGACCAGCGTTATCAAGTTCTCAAAG 475 |||||| |||| |||||| |||||||||||| ||| |||| |||||| |||||||||||| Sbjct 616 ATATCATTGATGAGTTTCCTGGAGGACTTGACTGGAACCATCGTTATAAAGTTCTCAAAG 675 Query 476 GAATTTGTCACGGTTTGCATTATCTGCACGATGAAATACGCGTTATCCACAGAGATATCA 535 |||||||||| ||||||| |||||| || || ||| | ||| || | |||| ||||||| Sbjct 676 GAATTTGTCATGGTTTGCGTTATCTACATGACGAAGTGCGCATTGTTCACAAGGATATCA 735 Query 536 AAACAGAAAATATATTGCTAGATGATAACGGCGTGCCAAAAGTTTTTGACTTTGGTTTTT 595 || | ||||||| |||||| |||| | |||||| ||| | || ||||||||||||| Sbjct 736 AAGAATCAAATATACTGCTAGGGGATAGCCTCGTGCCTAAAATATTCGACTTTGGTTTTT 795 Query 596 CGAAGTGCCTTCCTGATGGAGAATCTTTAATTAAAGATGAAGCAACCCA-GGGAACCCTA 654 | | | |||||| ||||||||||||||| | | || || || || ||||||| || Sbjct 796 CCACGAGCCTTCATGATGGAGAATCTTTGAGTGTTGA-CAACCATATCACGGGAACCATA 854 Query 655 GGGTATTTGGCGCCGGAG-TCAGTTGATAAGCAAGAATATTCCTTTAAGTCCGACATATA 713 || ||| ||||||||||| | | || | | || ||||||||||||||||||||||| Sbjct 855 GGCTATATGGCGCCGGAGGTGA-TTATTCACGGAGCATATTCCTTTAAGTCCGACATATT 913 Query 714 CAGCTTTGGTGTTGTGATCATACAATTATTGACTGGATCG---TGGATCAGTAAGAACCG 770 ||||||||| |||||||| || |||| |||| ||||||| ||| ||| |||||| Sbjct 914 CAGCTTTGGCGTTGTGATGATGAAATTGTTGATTGGATCGACTTGGGACAGGGAGAACCA 973 Query 771 AAATGTTGAGCTAGAACTTAAGGAGTTGAGAAAAAGGTTGGTAAGAGAAGGAGCATTTCC 830 |||||||||||| |||| | ||||||||||||||||||| || ||||||| ||| | Sbjct 974 CAATGTTGAGCTAATACTTCAAAAGTTGAGAAAAAGGTTGGT--GA-AAGGAGCGTTTTC 1030 Query 831 ATCATGGGAAAACAAATACCACCAAGTTAGAACATGTCTGGAGATTGTGTATAACTGCAT 890 |||||||||||| || |||||||||||||||||||| ||| | |||||||||| |||||| Sbjct 1031 ATCATGGGAAAATAATTACCACCAAGTTAGAACATGCCTGCAAATTGTGTATAGCTGCAT 1090 Query 891 GGACATCGACCCAGATAAAAGGCCGACTGCATTGGAAATTATCCAACGGCTTGATGAAAC 950 |||||| |||||| |||| ||||| |||||||||||||||||||| ||||| |||||||| Sbjct 1091 GGACATGGACCCAAATAATAGGCCTACTGCATTGGAAATTATCCAGCGGCTAGATGAAAC 1150 Query 951 CGAAAGCGCGAACTATTCTGTTAGCAGTGGCCATGCAACACCACTTTGGCAGTCAGGAGA 1010 |||||| || ||||||| |||||||||| ||||||| ||| |||||||||| ||||||| Sbjct 1151 CGAAAGTACGGACTATTCAGTTAGCAGTGCCCATGCACCACTACTTTGGCAGCCAGGAGA 1210 Query 1011 TGAAGAATCCGACTCAGCGGAAGTGGATGCTTTTGAGCCAGAGAGAACACCATCAAAAGA 1070 |||||||||||| ||| | | ||||||||| |||||||||||||||||||||| | || Sbjct 1211 TGAAGAATCCGATTCATCAAATATGGATGCTTCTGAGCCAGAGAGAACACCATCAGACGA 1270 Query 1071 CATTCTTTCAGATGATGAGGAACCCGCATCAGCAGACGCAAATGGAGAAACGAGCACACA 1130 |||||| || ||| || |||||||| ||||||||| | | |||||||||||||||||| Sbjct 1271 TATTCTTCCATGTGACGATGAACCCGCCTCAGCAGACACGACTGGAGAAACGAGCACACA 1330 Query 1131 AAAACATAATATGCCTGATCTTGTAAGTAAACAGTCAGTGTCGGCGGAACTGTCCTCGCT 1190 | || | |||||||| || ||||||||| ||| |||| ||||||||||||||||| Sbjct 1331 AGAAGCCGACATGCCTGACCTACTAAGTAAACTGTCTTTGTCAGCGGAACTGTCCTCGCT 1390 Query 1191 AGATTTCCTTGAGAAAATCACAGATGGTTTTTCATACGAGCAAATACTCGGGAAGGAAAG 1250 ||||||||| ||||||||||||||||||||||| |||| | |||| | |||||||| | Sbjct 1391 AGATTTCCTGGAGAAAATCACAGATGGTTTTTCGCACGAACGAATAGTTGGGAAGGACGG 1450 Query 1251 TCTGGACGCAGATGTTCATAAAGCATTTCTTTATGAGGGCAGCATTTCAGGTCCAGCAAA 1310 | |||||| | ||||||||||||| |||||||||||||||||||||||| | ||| Sbjct 1451 CCCTCACGCAGTTTATCATAAAGCATTTGTTTATGAGGGCAGCATTTCAGGTCGAACAAT 1510 Query 1311 GGTAGTTGTGAAGAGGTTAATTGGAGTAGCAATTCCAGTTGCGAAGTTTAAGAGGGATGC 1370 ||||| |||||||||||||||||||||||||||||||||| |||||| ||| |||||| Sbjct 1511 GGTAGCTGTGAAGAGGTTAATTGGAGTAGCAATTCCAGTTAAAAAGTTTGAGATGGATGC 1570 Query 1371 AGAACAGCTGATGAGCCTGGATCACAAGAATATAGTAAAGCTCCTTGGCTACTGCCACGA 1430 ||||| ||||||| || ||||||||||||||||||||||||||||||||||||||||| Sbjct 1571 TAAACAGTTGATGAGTCTAGATCACAAGAATATAGTAAAGCTCCTTGGCTACTGCCACGA 1630 Query 1431 CGAATCTAGAGGGCATAAGCTGGTACAGTTTAAAGCAAAACCACCGCAAGATTTTAAAGG 1490 ||||||||||| ||||||||||||||||||||| ||||||| | ||||| |||||||| Sbjct 1631 TGAATCTAGAGGACATAAGCTGGTACAGTTTAAAAGAAAACCATCACAAGACTTTAAAGG 1690 Query 1491 AGCCGAGCAACTTCTCTGCTATGAATATATGCACAATGGAAGCCTCCGTGAGTATCTTAC 1550 |||||| ||||| |||||||||||||||||||||||||| |||||||||| |||||||| Sbjct 1691 AGCCGAACAACTACTCTGCTATGAATATATGCACAATGGGAGCCTCCGTGGGTATCTTAT 1750 Query 1551 TGGACAAGGATCTCGTGAAGTTGATTGGCACATGTGCTACAAATTGATCAAAGGGACCTG 1610 |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| || Sbjct 1751 TGGACAAGGATCTCATGAAGTTGATTGGCATATGTGCTACAAATTGATCAAAGGGACATG 1810 Query 1611 CGAAGGTTTACGCTACCTCCATGAGGGTTGTGGAGATCGTCCAATTCTTCATTTGAATCT 1670 |||||||||| |||||||| ||||||||||||||| |||||||| ||||||||||||| Sbjct 1811 TGAAGGTTTACTTTACCTCCACGAGGGTTGTGGAGATTGTCCAATTGTTCATTTGAATCT 1870 Query 1671 AAACCCGTCAAATATACTGCTGGACGAAAACAACATACCACGCATCACGGGTTTTGATTT 1730 |||||| ||||||||||||||||| |||||||||| ||||||||||||||| |||||||| Sbjct 1871 AAACCCTTCAAATATACTGCTGGATGAAAACAACACACCACGCATCACGGGATTTGATTT 1930 Query 1731 TTCGAAGCTCATTGGTGAAAAGAACACAAAATCCGTGGTTCTTAAGAAGAATGGACCACT 1790 ||| ||||||||||| |||||||||||||| |||||| || ||||| |||||||| | | Sbjct 1931 TTCAAAGCTCATTGGGGAAAAGAACACAAAGTCCGTGTTTTCTAAGATGAATGGACAATT 1990 Query 1791 AGGTTACCTGCCACCGGACTTCCTGTACTCAAAGGGTACTGACCTCAAGTATCTACCTAC 1850 |||||||||| ||||||||||| ||||||||||||| ||||||||||| |||||| |||| Sbjct 1991 AGGTTACCTGTCACCGGACTTCTTGTACTCAAAGGGCACTGACCTCAAATATCTAGCTAC 2050 Query 1851 GGTGGACATATACAGCTTGGGTCTTATAATTTTAGAGATTGCAACACGTCAAGAGATCAA 1910 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct 2051 GGTGGACATATACAGCTTGGGTCTTATAATTTTAGAGATTGCAACACGTCAAGAGATCAA 2110 Query 1911 GGGAGACCATGGAATAATTATTAGGACTGTCGAGACAAACTGGAGGCAAGATACACAAAT 1970 ||||||||||||||||||||||| ||| ||| ||| || |||||||||||| ||||||| Sbjct 2111 GGGAGACCATGGAATAATTATTAAGACCGTCAAGAACAATTGGAGGCAAGATTCACAAAT 2170 Query 1971 AGCAACACTGTATGGTTCACTAGAAGATAAATTACGGGAGCAAGTAAAAATGTGCATTGA 2030 ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| Sbjct 2171 AGCAACACTGTATGGCTCACTAGAAGATAAATTACGGGAGCAAGTAAAAATGTGCATTGA 2230 Query 2031 CATTGGCCTAGACTGTGTCAAGTCAAACCCTAAAAAGAGACCTACAGCTGGGGCCATCAT 2090 ||||||||| | ||||| |||||||||||| | | ||||| || ||||||| ||||| Sbjct 2231 TATTGGCCTACATTGTGTGAAGTCAAACCCTGGAGACAGACCAACTGCTGGGGAGATCAT 2290 Query 2091 GCTCTGGCTTGACAAAGGGAGCAAACCGGGAGTTGCCAGACCTCCACTCCGCG--A---- 2144 ||||||||||||||||||||||||||| ||||||||||||||||||||| | | | Sbjct 2291 GCTCTGGCTTGACAAAGGGAGCAAACCAGGAGTTGCCAGACCTCCACTCGGTGCTACTGC 2350 Query 2145 TAATGTCACCCATGCAGATGATCACATCCAAGAAAAGGAGAAGCAGACGCCATTGAGGAG 2204 ||||||||||||||||||||| | |||||||||||||||||| |||||| |||||||||| Sbjct 2351 TAATGTCACCCATGCAGATGACCCCATCCAAGAAAAGGAGAAACAGACGTCATTGAGGAG 2410 Query 2205 ATTTTTCAGAAGAAAG 2220 |||||||||||| ||| Sbjct 2411 ATTTTTCAGAAGGAAG 2426 Accordingly, the claimed invention is anticipated by the prior art. 15. Claims 1, 6, 13-14, 16-17, 20-25, 30-31, and 34 are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Yu et al. (Discovery and characterization of two new stem rust resistance genes in Aegilops sharonensis. 2017. Theor Appl Genet 130, 1207–1222 (W)). In regard to claims 1, 13, 20 and 34, Yu teaches crossing A. sharonensis (AEG) accessions “1644 and 409 are stem rust resistant parents, while 2189 is a susceptible parent”, (see page 1208 right column “plant materials” section), which is the same as the Applicants accession and references the Yu 2017 as the source plant material (see specification page 40 line 9). Specifically, Yu teaches “two novel wheat stem rust resistance genes, Sr-1644-1Sh and Sr-1644-5Sh in Aegilops sharonensis that are effective against widely virulent African races of the wheat stem rust pathogen”, (see Abstract). Yu also discloses that Sr-1644-1Sh confers resistance against Puccinia graminis f. sp. tritici TTKSK, TPMKC, and TTTTF, (see page 1219 left column bottom paragraph and page 1208 right column top paragraph). Additionally, the Applicant identifies Sr-1644-1Sh as Sr62, (see specification page 40 line 9). Yu teaches that “Sr-QTL-1Sh conferred a high level of resistance, we designated it as gene Sr-1644-1Sh, which indicates the gene is from Ae. sharonensis accession 1644 and located on chromosome 1SSh”, (see page 1218 left column top paragraph), which pinpoints the location of the gene to chromosome 1 similar to Applicants Sr62. The plant of Yu inherently has a vector comprising the nucleic acid molecule. Lastly, Yu discloses the accession numbers of the DNA and RNA sequences for Sr-1644-1Sh. In regard to claim 6, the limitation “transformed” is not given patentable weight because no structure is recited in the claim that distinguishes the plant of Yu from Applicant’s claimed invention. The plant cell of Yu comprises said nucleic acid molecule. In regard to claim 13, the limitations “heterologous” and “transgenic” are not given patentable weight because no structure is recited in the claims that distinguishes the plant of Yu from Applicant’s claimed invention. For the same reasons above, (see claim 1 rejection), Yu 2017 teaches a plant comprising SEQ ID NO:14 (Sr62). In regard to claim 14, because the plant of Yu has stem rust resistance, it inherently has a promoter operably linked to the nucleotide sequence for the expression of said nucleotide sequence. In regard to claim 16, Yu teaches crossing two wheat plants, (see figure 1). In regard to claims 17 and 25, the limitation “transgenic” is not given patentable weight because no structure is recited in the claims that distinguishes the plant of Yu from Applicant’s claimed invention. Since both the Applicant and Yu use the same accession number A. sharonensis accession 1644, (see specification page 40 line 9), the plant of Yu has resistance to Puccinia graminis f. sp. tritici, (see page 1211 right column middle paragraph and figure 1). Yu teaches using stem rust resistant wheat plant, crossing the resistant wheat plant with a susceptible plant to introduce the stem rust resistance phenotype into a progeny plant. The progeny plant of Yu has resistance to the pathogen Puccinia graminis f. sp. tritici. In regard to claim 20, Yu teaches the method of crossing two wheat plants A. sharonensis accessions 1644 (resistant) X 2189 (susceptible), (seepage 1208 materials and methods), to introduce the resistance gene into a progeny wheat plant. In regard to claim 21, by simple Mendelian genetics, the progeny plant of Yu has the resistance gene stably incorporated in its genome (see page 1208 right column last paragraph). In regard to claim 22, Yu teaches that seeds were tested for resistance, (see page 1209 left column middle paragraph), which means the progeny seed is regenerated into a wheat plant and comprises in its genome the resistance gene. In regard to claims 23-24, because the resistance gene is expressed in the progeny plant, the plant of Yu inherently comprises at least one of the recited promoters in claim 24. In regard to claim 30, Yu teaches reducing stem rust in wheat plants (see figure 1). Wheat is an agricultural crop. In regard to claim 31, Yu teaches crossing the wild-type A. sharonensis 1644 with susceptible plants to produce seeds, (see page 1209 left column middle paragraph), which they mentions that seeds were tested for resistance. Additionally, mentions that the F1 and F2 were phenotype and genotyped, (see page 1208 right column last paragraph), meaning they had to harvest seed from the wheat plants. In regard to claim 34, since both Applicant and Yu use the same staring material, (see specification page 40 line 9), and the progeny plant has stem rust resistance, the progeny plant of Yu inherently expresses the claimed polypeptide. Accordingly, the claimed invention is anticipated by the prior art. Conclusion 16. No claims are allowed. 17. Any inquiry concerning this communication or earlier communications from the examiner should be directed to CHRISTIAN JOSE ORDAZ whose telephone number is (703)756-1967. The examiner can normally be reached 8:30 am-5:00 pm. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, Applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Amjad A Abraham can be reached on (571) 270-7058. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /C.J.O./Examiner, Art Unit 1663 /PHUONG T BUI/Primary Examiner, Art Unit 1663
Read full office action

Prosecution Timeline

Mar 29, 2024
Application Filed
Sep 05, 2025
Response after Non-Final Action
Dec 05, 2025
Non-Final Rejection — §101, §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12588644
ROOT-KNOT NEMATODE RESISTANCE CONFERRING GENE
2y 5m to grant Granted Mar 31, 2026
Patent 12565662
PLANT PATHOGEN EFFECTOR AND DISEASE RESISTANCE GENE IDENTIFICATION, COMPOSITIONS, AND METHODS OF USE
2y 5m to grant Granted Mar 03, 2026
Patent 12507651
METHODS FOR IMPROVING SEED PRODUCTION IN MAIZE
2y 5m to grant Granted Dec 30, 2025
Patent 12501868
HAPLOID INDUCTION COMPONDS AND METHODS FOR USE THEREOF
2y 5m to grant Granted Dec 23, 2025
Patent 12446504
METHOD FOR ACTIVATING CROP SEED BY HIGH-VOLTAGE ELECTRIC FIELD COLD PLASMA (HVCP), AND USE THEREOF
2y 5m to grant Granted Oct 21, 2025
Study what changed to get past this examiner. Based on 5 most recent grants.

AI Strategy Recommendation

Get an AI-powered prosecution strategy using examiner precedents, rejection analysis, and claim mapping.
Powered by AI — typically takes 5-10 seconds

Prosecution Projections

1-2
Expected OA Rounds
64%
Grant Probability
99%
With Interview (+100.0%)
3y 0m
Median Time to Grant
Low
PTA Risk
Based on 14 resolved cases by this examiner. Grant probability derived from career allow rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month