DETAILED ACTION
Claims 1-66 were/stand cancelled. Claims 67-93 are pending.
Notice of Pre-AIA or AIA Status
The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA .
Priority
This application is a 371 of PCT/US2022/077389 (09/30/2022) which claims benefit of 63/287,960 (12/09/2021) and claims benefit of 63/251,562 (10/01/2021) as reflected in the filing receipt issued March 18 2025.
Information Disclosure Statement
The information disclosure statement (IDS) submitted on November 26 2024 is in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statement is being considered by the examiner.
Claim Rejections - 35 USC § 112
The following is a quotation of 35 U.S.C. 112(b):
(b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention.
The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph:
The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention.
Claim 67-93 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention.
Claim 67 recites “a modified oligonucleotide”…comprising at least 14 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 134 or 294. Looking to the sequence listing, neither SEQ ID No: 134 or 294 includes modifications (see also table 24 of the instant specification). Claim 87 refers to a first modified oligonucleotide of Ref ID NO: IA0443 and a second modified oligonucleotide of Ref ID NO: IS0505 which are also referenced as SEQ ID No: 134 and 294 but with specific modification patterns. Since this specific modified strand is also referred to as SEQ ID No: 134 and 294 and claim 67 refers to a modified oligonucleotide, it isn’t clear if in claim 67 the claim is open to any modification or if it is required to possess the specific modification pattern as recited in Table 25.
Claim 83 as currently written is vague and indefinite. Claim 83 refers to Formula II but neither claim 83 nor any of the previous claims reference formula II. Therefore, the scope of the claim is indefinite. "Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table ‘is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience.' Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993)" (MPEP 2173.05(s)). While claim 83 refers to a formula, the same issues would occur with this recitation. Applicants must copy the contents of the formula into the claim.
Claim 87 as currently written is indefinite. As indicated above "Where possible, claims are to be complete in themselves. Incorporation by reference to a specific figure or table ‘is permitted only in exceptional circumstances where there is no practical way to define the invention in words and where it is more concise to incorporate by reference than duplicating a drawing or table into the claim. Incorporation by reference is a necessity doctrine, not for applicant’s convenience.' Ex parte Fressola, 27 USPQ2d 1608, 1609 (Bd. Pat. App. & Inter. 1993)" (MPEP 2173.05(s)). While claim 87 refers to specific reference IDs, the same issues would occur with this recitation. Applicants must copy the contents of the reference ID into the claim (specifically the sequence structure).
Claims 63-82, 84-86 and 88-93 are included in the rejection as they depend on a rejected base claim and they do not clarify the issues.
Claim Rejections - 35 USC § 102
The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action:
A person shall be entitled to a patent unless –
(a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention.
Claim(s) 69 is/are rejected under 35 U.S.C. 102(a)(1) as being anticipated by Foster et al. (USPGPUB NO. 20190298842).
The instant application claims a compound comprising a modified oligonucleotide having a nucleobase sequence of SEQ ID NO: 134 or 294. The BRI of this claim is that a modified oligonucleotide meets the limitations of claim 69 wherein two nucleobases match SEQ ID No: 134 or 294 as the recitation “a nucleobase of” is interpreted as requiring either the full length sequence or any portion of SEQ ID NO: 134 or 294. The examiner notes that other claims such as claim 67 are interpreted differently as they recite “nucleobases of the nucleobase sequence of SEQ ID No: 134 or 294”.
Foster et al. is directed to angiotensinogen (AGT) iRNA compositions and methods of use thereof. Claimed is a double stranded ribonucleic acid (RNAi) agent or inhibiting expression of angiotensinogen (AGT) in a cell, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region.
A specific strand sequence taught is SEQ ID NO: 535: UUUGAUCAUACACAGCAAACAGG (table 7) which as shown in the alignment below has 92.4% identity with instantly claimed SEQ ID No: 134 (Qy). This sequence anticipates claim 69 in light of the BRI of the claim 69 which include any portion of SEQ ID No: 134.
PNG
media_image1.png
345
667
media_image1.png
Greyscale
Claim Rejections - 35 USC § 103
The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action:
A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102 of this title, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made.
The factual inquiries set forth in Graham v. John Deere Co., 383 U.S. 1, 148 USPQ 459 (1966), that are applied for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows:
1. Determining the scope and contents of the prior art.
2. Ascertaining the differences between the prior art and the claims at issue.
3. Resolving the level of ordinary skill in the pertinent art.
4. Considering objective evidence present in the application indicating obviousness or nonobviousness.
This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention.
Claims 67-78, 80 and 84-93 are rejected under 35 U.S.C. 103 as being unpatentable over Foster et al. (USPGPUB No. 20190298842) in view of Brown (WO2010080129).
Applicant Claims
The instant application claims a compound comprising a modified oligonucleotide 14 to 23 linked nucleosides in length having a nucleobase sequence comprising at least 14 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 134 or 294. The instant application claims a compound comprising: a first modified oligonucleotide 14 to 23 linked nucleosides in length having a nucleobase sequence comprising at least 14 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 134; and a second modified oligonucleotide 14 to 23 linked nucleosides in length having a region of complementarity to the first modified oligonucleotide. The instant application claims a method comprising administering the compound to an individual. The instant application claims a method of inhibiting expression of angiotensinogen (AGT) in a cell comprising contacting the cell with the compound, thereby inhibiting expression of AGT in the cell.
The instant specification defines in paragraph 0031: “Inhibiting the expression or activity” with reference to a target nucleic acid or protein means to reduce or block the expression or activity of such target relative to the expression or activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity. Therefore, inhibiting is not interpreted as encompassing preventing and the scope of inhibits or reduces are the same.
Determination of the Scope and Content of the Prior Art
(MPEP §2141.01)
Foster et al. is directed to angiotensinogen (AGT) iRNA compositions and methods of use thereof. Claimed is a double-stranded ribonucleic acid (RNAi) agent for inhibiting expression of angiotensinogen (AGT) in a cell, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region wherein the sense strand comprises at least 15 contiguous nucleotides of nucleotides of various portions of SEQ ID NO: 1 and the antisense strand comprises at least 15 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 2 wherein the antisense strand is substantially complementary to the sense strand wherein substantially all of the nucleotides of said sense strand are modified nucleotides, substantially all of the nucleotides of said antisense strand are modified nucleotides, or substantially all of the nucleotides of said sense strand and substantially all of the nucleotides of said antisense strand are modified nucleotides (claim 1). The ds RNAi agent is conjugated to a ligand (claim 4). The iRNA contains no more then 3 mismatches (paragraph 0247). In one embodiment, the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings (paragraph 0311). Adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil respectively to form a G-U wobble base pairing with the target mRNA (paragraph 0177).
As shown in the alignment below SEQ ID NO: 134 corresponds to SEQ ID NO: 2 at positions 680-700 and SEQ ID NO: 294 corresponds to positions 1887-1908 of SEQ ID NO: 1 with one mismatch.
PNG
media_image2.png
357
688
media_image2.png
Greyscale
PNG
media_image3.png
311
673
media_image3.png
Greyscale
A specific strand sequence taught is SEQ ID NO: 535: UUUGAUCAUACACAGCAAACAGG (table 7) which as shown in the alignment below has 92.4% identity with instantly claimed SEQ ID No: 134 (Qy).
PNG
media_image1.png
345
667
media_image1.png
Greyscale
Ascertainment of the Difference Between Scope the Prior Art and the Claims
(MPEP §2141.02)
While Foster et al. teaches that mismatches can be included and teaches a sequence which corresponds to instantly claimed SEQ ID NO: 134 except for a mismatch at position 14 and Foster et al. does not expressly teach a mismatch at this position. However, this deficiency is cured by Brown.
Brown is directed to extended dicer substrate agents and methods for the specific inhibition of gene expression. Taught are double-stranded RNA (dsRNA) agents that are effective inhibitors of target gene expression in mammalian cells (page 1). Mismatches at position 14 are taught (page 16, lines 12-13; claim 82). As shown in figure 6, position 14 of the antisense strand is substituted with a U instead of a C and the target nucleotide is a guanosine. Exemplary mismatched or wobble base pairs of agents include G:A, C:A, C:U, G:G, A:A, C:C, U:U, I:A, I:U and I:C (page 75, lines 11-13). Lengths of 21-23 of a guide (antisense) strand is taught (page 74, lines 11-13). Shown in figures 8 and 9, agents possessing mismatched residues at position 14 were effective inhibitor agents.
Finding of Prima Facie Obviousness Rationale and Motivation
(MPEP §2142-2143)
Regarding claims 67-69, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Foster et al. and Brown and form a wobble base pair between an antisense strand (specifically SEQ ID No: 535) and target strand at position 14. One skilled in the art would have been motivated to replace the C with U to form a wobble pair as Foster et al. expressly teaches replacing the C with U to form a mismatch. One skilled in the art would choose position 14 as it is known to allow for effective inhibitor agents as taught by Brown. Thus, replacement of the C with U would form instantly claimed SEQ ID No: 134 (100% identity).
Regarding claims 70 and 84, Foster et al. teaches a dsRNA comprising a sense and antisense strand which are substantially complementary. Thus the use of SEQ ID No: 134 with the position 14 mismatch in combination with the complementary strand results in SEQ ID No: 134 and 294.
Regarding claim 71-77 and 87, as claimed in Foster et al. substantially all of the nucleotides of said sense strand are modified nucleotides, substantially all of the nucleotides of said antisense strand are modified nucleotides, or substantially all of the nucleotides of said sense strand and substantially all of the nucleotides of said antisense strand are modified nucleotides (claim 1). Modifications include phosphorothioates (paragraph 0250;0255; 0308). A specific modified sequence taught is SEQ ID NO: 1028 (table 13) which is usUfsugaUfcAfUfacacAfgCfaaacasgsg and aligns with instant SEQ ID No: 134:
PNG
media_image4.png
353
724
media_image4.png
Greyscale
which includes phosphorothioate linkages, 2’-fluoro modifications, 2’-O-methyl modifications (see table 2 for explanation of abbreviations) and include phosphorothioate internucleotide linkages at the 3’ terminus and 5’ terminus. As shown in SEQ ID NO: 1028 there are 6 2’-F modifications (which is less than 10). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Foster et al. and Brown and manipulate the modification pattern in order to achieve the desired level of inhibition, absent a demonstration of the criticality. Since Foster et al. teaches and exemplifies, phosphorothioate, 2’-fluoro and 2’-O-methyl modifications there is a reasonable expectation of success in forming the modified oligonucleotides as claimed.
Regarding claims 78 and 80, Foster et al. teaches a ligand can be conjugated which can be a GalNAc (paragraph 0435; claim 4 and 31).
Regarding claim 85, Foster et al. teaches the RNA agents can include various salts, mixed salts or free acid forms (paragraph 0250; 0592). Brown teaches solids include sodium chloride (page 135-136).
Regarding claim 86, Foster et al. teaches pharmaceutical compositions comprising the iRNA and a pharmaceutically acceptable carrier (paragraph 0460).
Regarding claims 88-93, Foster et al. teaches therapeutic methods which include administering to a subject having, or prone to developing, an AGT-associated disease, disorder and/or condition (e.g. hypertension) (paragraph 0602). Other AGT associated diseases are expressly taught (paragraph 0603) which overlap with the conditions/symptoms of claim 89. The methods involve contacting a cell wherein the cell can be a human liver cell (paragraph 0634-0635). Parenteral routes can be utilized (paragraph 0637). Various different time intervals for administration are taught include once every three months (paragraph 0476).
Claims 78-83 and 87 are rejected under 35 U.S.C. 103 as being unpatentable over Foster et al. in view of Brown as applied to claims 67-78, 80 and 84-93 above and in further view of Li et al. (USPGPUB No. 20240083934, EFD of November 13 2020).
The applied reference, Li et al., has a common Applicant/Inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2).
This rejection under 35 U.S.C. 103 might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C.102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B); or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. See generally MPEP § 717.02.
Applicant Claims
The instant claims are interpreted as limiting the conjugate to be Formula X.
Determination of the Scope and Content of the Prior Art
(MPEP §2141.01)
The teachings of Foster et al. and Brown are set forth above.
Ascertainment of the Difference Between Scope the Prior Art and the Claims
(MPEP §2141.02)
While Foster et al. suggest a ligand can be conjugated, Foster et al. does not teach attachment to the 5’ end of the second modified oligonucleotide or formula X. However, this deficiency is cured by Li et al.
Li et al. is directed to N-acetylgalactosamine (GALNAC)-derived compounds and oligonucleotides. Li et al. claims a compound of formula (IX-a) which overlaps in scope with instantly claimed Formula X (see claim 1 and claim 30). A nucleic acid is conjugated to the GalNAc moiety. It can be conjugated through the 5’ end of the nucleic acid (paragraph 0804). The GalNAc moieties are useful directing the nucleic acid to a locality which is the liver (paragraph 0802).
Finding of Prima Facie Obviousness Rationale and Motivation
(MPEP §2142-2143)
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Foster et al., Brown and Li et al. and utilize the GalNAc compounds of Li et al. and conjugate to the 5’ end of the sense strand of the nucleic acids of Foster et al. One skilled in the art would have been motivated to utilize these GalNAc moieties as they are taught as directing to the liver by Li et al. Since Foster et al. suggest a GalNAc ligand can be attached and Li et al. teaches the GalNAc compounds can be conjugated to oligonucleotides, there is a reasonable expectation of success.
Regarding claim 82, claims 1/30 of Li et al. teach the same/overlapping definition of R9, L, R2, Y1, Y2, Y3, Y4, n1, n2, n3, n4 and n5.
Double Patenting
The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969).
A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b).
The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13.
The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer.
Claims 67-93 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 7-8,13,18-19,26-27,35,38-40,56-58,62-63,65,67-69 and 86 of copending Application No. 18194203 (USPGPUB NO. 20240041913). Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
This is a provisional nonstatutory double patenting rejection.
The instant application claims a compound comprising a modified oligonucleotide 14 to 23 linked nucleosides in length having a nucleobase sequence comprising at least 14 contiguous nucleobases of the nucleobase sequence of SEQ ID NO: 134 or 294.
Copending ‘203 claims a compound comprising; a first modified oligonucleotide that is 14 to 24 linked nucleosides in length having a nucleobase sequence comprising at least 14 contiguous nucleobases of any one of the nucleobase sequences of SEQ ID NOs: 11-20; and a second modified oligonucleotide that is 14 to 23 linked nucleosides in length having a region of complementarity of at least 14 linked nucleosides to the first modified oligonucleotide, wherein one or more GalNAc are attached to the 5' nucleoside of the second first modified oligonucleotide, and wherein the compound is an siRNA compound (claim 7).
Regarding claims 67-70 As shown in the alignment below SEQ ID NO: 11 (Db) of copending ‘203 has 100% identity to instantly claimed SEQ ID No: 134 (Qy):
PNG
media_image5.png
534
871
media_image5.png
Greyscale
Regarding claim 71-72, Copending ‘203 claims at least one internucleoside linkage of the first or second modified oligonucleotide is a phosphorothioate internucleoside linkage or a methylphosphonate internucleoside linkage (claim 18).
Regarding claim 73, Copending ‘203 claims the phosphorothioate internucleoside linkage or methylphosphonate internucleoside linkage is at the 3' terminus of the first or second modified oligonucleotide or at the 5' terminus of the first or second modified oligonucleotide (claim 19).
Regarding claims 74-77, Copending ‘203 claims the first or second modified oligonucleotide comprises a modification selected from group consisting of LNA, cEt, 2'-MOE, 2'- F, 2'-OMe, and 2'-deoxy, or a combination thereof (claim 26) The second modified oligonucleotide comprises no more than 5 2’-F sugar modifications (claim 27).
Regarding claims 78-83, the same formula X is claimed (claim 35).
Regarding claim 84, Copending ‘203 claims the second modified oligonucleotide is 14 to 23 linked nucleosides in length having a nucleobase sequence comprising at least 14 contiguous nucleobases of any one of the nucleobases of sequences of SEQ ID No: 31-42.
As shown in the alignment below, SEQ ID NO: 31 (Db) of copending ‘302 has 100% identity to instantly claimed SEQ ID No: 294 (Qy).
PNG
media_image6.png
468
865
media_image6.png
Greyscale
Regarding claim 85, copending ‘203 claims a sodium or potassium salt (claim 57).
Regarding claim 86, copending ‘203 claims a composition with a carrier (claims 62 and 63).
Regarding claim 87, copending’ 203 claims sequences comprising the same in claims 39-40.
Regarding claims 88-93, Copending ‘209 claims a method comprising administering the compound (claim 65). The same conditions are claimed (claim 67). Inhibiting the expression of angiotensinogen (AGT) is claimed (claim 68). The cell is a cell in the liver (claim 59).
Claims 67-81 and 84-93 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-7,9-12,16-18,22-24 and 49-51 of copending Application No. 18286640 (USPGPUB No. 20240191229) in view of Foster et al. (USPGPUB No. 20190298842). Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
This is a provisional nonstatutory double patenting rejection.
The instant claims are set forth above.
Copending ‘640 claims a nucleic acid for reducing expression of a target mRNA, the nucleic acid comprising an antisense strand of 15 to 31 nucleotides in length having a sequence that is at least 90% complementary to a contiguous sequence of the target mRNA, wherein the sequence of the antisense strand comprises, at position 14 from its 5' end, an abasic site or a nucleotide that does not form a canonical base pair with a target nucleotide at a corresponding position on the contiguous sequence of the target mRNA (claim 1). The target nucleotide comprises either cytidine or guanosine (claim 2). The nucleotide at position 14 on the antisense strand and the target nucleotide comprise a mismatched base pair (claim 3). The mismatched base pair is a wobble base pair (claim 4). The nucleotide at position 14 on the antisense strand comprise either inosine or uridine (claim 6).
While copending ‘640 claims a sequence with an overlapping length which is at least 90% complementary to a target mRNA and has a wobble base pair at position 14, copending ‘640 does not expressly claim SEQ ID NO: 134 or 294. However, this deficiency is cured by Foster et al.
Foster et al. is directed to angiotensinogen (AGT) iRNA compositions and methods of use thereof. Claimed is a double-stranded ribonucleic acid (RNAi) agent for inhibiting expression of angiotensinogen (AGT) in a cell, wherein said double-stranded RNAi agent comprises a sense strand and an antisense strand forming a double-stranded region wherein the sense strand comprises at least 15 contiguous nucleotides of nucleotides of various portions of SEQ ID NO: 1 and the antisense strand comprises at least 15 contiguous nucleotides of the nucleotide sequence of SEQ ID NO: 2 wherein the antisense strand is substantially complementary to the sense strand wherein substantially all of the nucleotides of said sense strand are modified nucleotides, substantially all of the nucleotides of said antisense strand are modified nucleotides, or substantially all of the nucleotides of said sense strand and substantially all of the nucleotides of said antisense strand are modified nucleotides (claim 1). The ds RNAi agent is conjugated to a ligand (claim 4). The iRNA contains no more than 3 mismatches (paragraph 0247). In one embodiment, the RNAi agent comprises mismatch(es) with the target, within the duplex, or combinations thereof. The base pair may be ranked on the basis of their propensity to promote dissociation or melting (e.g., on the free energy of association or dissociation of a particular pairing, the simplest approach is to examine the pairs on an individual pair basis, though next neighbor or similar analysis can also be used). In terms of promoting dissociation: A:U is preferred over G:C; G:U is preferred over G:C; and I:C is preferred over G:C (I=inosine). Mismatches, e.g., non-canonical or other than canonical pairings (as described elsewhere herein) are preferred over canonical (A:T, A:U, G:C) pairings; and pairings which include a universal base are preferred over canonical pairings (paragraph 0311). Adenine and cytosine anywhere in the oligonucleotide can be replaced with guanine and uracil respectively to form a G-U wobble base pairing with the target mRNA (paragraph 0177).
As shown in the alignment below SEQ ID NO: 134 corresponds to SEQ ID NO: 2 at positions 680-700 and SEQ ID NO: 294 corresponds to positions 1887-1908 of SEQ ID NO: 1 with one mismatch.
PNG
media_image2.png
357
688
media_image2.png
Greyscale
PNG
media_image3.png
311
673
media_image3.png
Greyscale
A specific strand sequence taught is SEQ ID NO: 535: UUUGAUCAUACACAGCAAACAGG (table 7) which as shown in the alignment below has 92.4% identity with instantly claimed SEQ ID No: 134 (Qy).
PNG
media_image1.png
345
667
media_image1.png
Greyscale
Regarding claims 67-69, It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending ‘640 and Foster et al. and utilize AGT as the target mRNA. One skilled in the would have been motivated to utilize this target as Foster et al. specifically teaches this is a target for inhibitory RNA. There would be a reasonable expectation of success as copending ‘640 claims any target mRNA.
Regarding claims 70 and 84, Foster et al. teaches a dsRNA comprising a sense and antisense strand which are substantially complementary. Thus the use of SEQ ID No: 134 with the position 14 mismatch in combination with the complementary strand results in SEQ ID No: 134 and 294. Copending ‘640 claims the nucleic acid further comprising a sense strand of 15 to 40 nucleotides in length, wherein the sense strand forms a duplex region with the antisense strand (claim 16).
Regarding claim 71-77 and 87, as claimed in Foster et al. substantially all of the nucleotides of said sense strand are modified nucleotides, substantially all of the nucleotides of said antisense strand are modified nucleotides, or substantially all of the nucleotides of said sense strand and substantially all of the nucleotides of said antisense strand are modified nucleotides (claim 1). Modifications include phosphorothioates (paragraph 0250;0255; 0308). A specific modified sequence taught is SEQ ID NO: 1028 (table 13) which is usUfsugaUfcAfUfacacAfgCfaaacasgsg and aligns with instant SEQ ID No: 134:
PNG
media_image4.png
353
724
media_image4.png
Greyscale
which includes phosphorothioate linkages, 2’-fluoro modifications, 2’-O-methyl modifications (see table 2 for explanation of abbreviations) and include phosphorothioate internucleotide linkages at the 3’ terminus and 5’ terminus. As shown in SEQ ID NO: 1028 there are 6 2’-F modifications (which is less than 10). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Foster et al. and Brown and manipulate the modification pattern in order to achieve the desired level of inhibition, absent a demonstration of the criticality. Since Foster et al. teaches and exemplifies, phosphorothioate, 2’-fluoro and 2’-O-methyl modifications there is a reasonable expectation of success in forming the modified oligonucleotides as claimed. Copending ‘640 claims wherein the antisense strand comprises at least one modified nucleoside and/or at least one modified internucleotide linkage (claim 9). Copending ‘640 claims the antisense strand comprises one or more nucleoside modifications selected from 2'-aminoethyl, 2'- fluoro, 2'-O-methyl, 2'-O-methoxyethyl, and 2'-deoxy-2'-fluoro-3-d-arabinonucleic acid (claim 10). Copending ‘640 claims the antisense strand comprises at least one phosphorothioate internucleotide linkages (claim 11).
Regarding claims 78-81, Copending ‘640 claims the sense strand is conjugated to at least one N-acetylgalactosamine (GalNAc) moiety (claim 22).
Regarding claim 85, Copending ‘640 claims a composition comprising the nucleic acid and a counterion (claim 49).
Regarding claim 86, Copending ‘640 claims a composition comprising the nucleic acid and a pharmaceutically acceptable carrier (claim 50).
Regarding claims 88-93, Copending ‘640 claims a method of reducing expression of a target mRNA in a cell (claim 51).
Claims 78-83 and 87 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-7,9-12,16-18,22-24 and 49-51 of copending Application No. 18286640 (USPGPUB No. 20240191229) in view of Foster et al. (USPGPUB No. 20190298842) as applied to claims 67-81 and 84-93 above and in further view of Li et al. (USPGPUB No. 20240083934, EFD of November 13 2020). Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
The instant application claims a conjugate of formula X.
The teachings of copending ‘640 and Foster et al. are set forth above.
While copending ‘640 claims a ligand can be conjugated, copending ‘640 does not claim formula X. However, this deficiency is cured by Li et al.
Li et al. is directed to N-acetylgalactosamine (GALNAC)-derived compounds and oligonucleotides. Li et al. claims a compound of formula (IX-a) which overlaps in scope with instantly claimed Formula X (see claim 1 and claim 30). A nucleic acid is conjugated to the GalNAc moiety. It can be conjugated through the 5’ end of the nucleic acid (paragraph 0804). The GalNAc moieties are useful directing the nucleic acid to a locality which is the liver (paragraph 0802).
It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending ‘640, Foster et al., and Li et al. and utilize the GalNAc compounds of Li et al. and conjugate to the 5’ end of the sense strand of the nucleic acids of copending ‘640. One skilled in the art would have been motivated to utilize these GalNAc moieties as they are taught as directing to the liver by Li et al. Since copending ‘640 claims a GalNAc ligand can be attached and Li et al. teaches the GalNAc compounds can be conjugated to oligonucleotides, there is a reasonable expectation of success.
Regarding claim 82, claims 1/30 of Li et al. teach the same/overlapping definition of R9, L, R2, Y1, Y2, Y3, Y4, n1, n2, n3, n4 and n5.
Claims 67-93 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 1-2,5-7,9-10,13,17,19-21,23-24,27,30,32 and 34-42 of copending Application No. 18030968 (USPGPUB NO. 20240083934) in view of Foster et al. and Brown. Although the conflicting claims are not identical, they are not patentably distinct from each other because both sets of claims overlap in scope.
This is a provisional nonstatutory double patenting rejection.
Copending ‘968 claims a compound of Formula Xa or a salt, solvate or hydrate thereof:
PNG
media_image7.png
344
466
media_image7.png
Greyscale
wherein R2 is an oligonucleotide (claim 19). The oligonucleotide as claimed include siRNA and antisense (claim 32). Copending ‘968 claims the compound and a carrier (claim 34). Copending ’968 claims administering the compound to a subject (claim 35). Copending ‘968 claims a method for treating or ameliorating a disease, disorder or symptom in a subject (claim 36-37).
While Copending ‘968 claims the same Formula as instantly claimed Formula X and an oligonucleotide which is an siRNA, copending ‘968 does not claim a sequence which is the same as instantly claimed SEQ ID No: 134 or 294. However, this deficiency is cured by Foster et al. and Brown.
The teachings of Foster et al. are set forth above.
Brown is directed to extended dicer substrate agents and methods for the specific inhibition of gene expression. Taught are double-stranded RNA (dsRNA) agents that are effective inhibitors of target gene expression in mammalian cells (page 1). Mismatches at position 14 are taught (page 16, lines 12-13; claim 82). As shown in figure 6, position 14 of the antisense strand is substituted with a U instead of a C and the target nucleotide is a guanosine. Exemplary mismatched or wobble base pairs of agents include G:A, C:A, C:U, G:G, A:A, C:C, U:U, I:A, I:U and I:C (page 75, lines 11-13). Lengths of 21-23 of a guide (antisense) strand is taught (page 74, lines 11-13). Shown in figures 8 and 9, agents possessing mismatched residues at position 14 were effective inhibitor agents.
Regarding claims 67-69, it would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of copending ‘968, Foster et al. and Brown and utilize a dsRNA which forms a wobble base pair between an antisense strand (specifically SEQ ID No: 535) and target strand at position 14. One skilled in the art would have been motivated to replace the C with U to form a wobble pair as Foster et al. expressly teaches replacing the C with U to form a mismatch. One skilled in the art would choose position 14 as it is known to allow for effective inhibitor agents as taught by Brown. Thus, replacement of the C with U would form instantly claimed SEQ ID No: 134 (100% identity). There is a reasonable expectation of success as copending ‘968 claims the oligonucleotide can be an siRNA.
Regarding claims 70 and 84, Foster et al. teaches a dsRNA comprising a sense and antisense strand which are substantially complementary. Thus the use of SEQ ID No: 134 with the position 14 mismatch in combination with the complementary strand results in SEQ ID No: 134 and 294.
Regarding claim 71-77 and 87, as claimed in Foster et al. substantially all of the nucleotides of said sense strand are modified nucleotides, substantially all of the nucleotides of said antisense strand are modified nucleotides, or substantially all of the nucleotides of said sense strand and substantially all of the nucleotides of said antisense strand are modified nucleotides (claim 1). Modifications include phosphorothioates (paragraph 0250;0255; 0308). A specific modified sequence taught is SEQ ID NO: 1028 (table 13) which is usUfsugaUfcAfUfacacAfgCfaaacasgsg and aligns with instant SEQ ID No: 134:
PNG
media_image4.png
353
724
media_image4.png
Greyscale
which includes phosphorothioate linkages, 2’-fluoro modifications, 2’-O-methyl modifications (see table 2 for explanation of abbreviations) and include phosphorothioate internucleotide linkages at the 3’ terminus and 5’ terminus. As shown in SEQ ID NO: 1028 there are 6 2’-F modifications (which is less than 10). It would have been obvious to one of ordinary skill in the art before the effective filing date of the claimed invention to combine the teachings of Foster et al. and Brown and manipulate the modification pattern in order to achieve the desired level of inhibition, absent a demonstration of the criticality. Since Foster et al. teaches and exemplifies, phosphorothioate, 2’-fluoro and 2’-O-methyl modifications there is a reasonable expectation of success in forming the modified oligonucleotides as claimed.
Regarding claims 78-83, copending ‘968 claims the same conjugates.
Regarding claim 85, Foster et al. teaches the RNA agents can include various salts, mixed salts or free acid forms (paragraph 0250; 0592). Brown teaches solids include sodium chloride (page 135-136).
Regarding claim 86, Foster et al. teaches pharmaceutical compositions comprising the iRNA and a pharmaceutically acceptable carrier (paragraph 0460).
Regarding claims 88-93, Foster et al. teaches therapeutic methods which include administering to a subject having, or prone to developing, an AGT-associated disease, disorder and/or condition (e.g. hypertension) (paragraph 0602). Other AGT associated diseases are expressly taught (paragraph 0603) which overlap with the conditions/symptoms of claim 89. The methods involve contacting a cell wherein the cell can be a human liver cell (paragraph 0634-0635). Parenteral routes can be utilized (paragraph 0637). Various different time intervals for administration are taught include once every three months (paragraph 0476).
Conclusion
The prior art made of record and not relied upon is considered pertinent to applicant's disclosure. Mogi et al. (International Journal of Hypertension, 2012) teaches that RAAS (renin-angiotensin-aldosterone system) has been highlighted as having a pathological role in strike, dementia and neurodegenerative disorders. Tellers et al. (USPGPUB NO. 20150246133) teaches conjugating groups which are similar to the instant claims except they are tetraGalNAc ligands.
Any inquiry concerning this communication or earlier communications from the examiner should be directed to ABIGAIL VANHORN whose telephone number is (571)270-3502. The examiner can normally be reached M-Th 6 am-4 pm EST.
Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice.
If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Neil Hammell can be reached at 571-270-5919. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300.
Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000.
/ABIGAIL VANHORN/Primary Examiner, Art Unit 1636