Prosecution Insights
Last updated: October 04, 2026
Application No. 18/698,499

ARTIFICIAL EXPRESSION CONSTRUCTS FOR MODULATING GENE EXPRESSION IN THE CEREBELLUM AND A SECONDARY CELL TYPE

Non-Final OA §102§112§DP
Filed
Apr 04, 2024
Priority
Oct 05, 2021 — provisional 63/252,520 +1 more
Examiner
WESTON, ALYSSA G
Art Unit
1633
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Allen Institute
OA Round
1 (Non-Final)
60%
Grant Probability
Moderate
1-2
OA Rounds
12m
Est. Remaining
99%
With Interview

Examiner Intelligence

Grants 60% of resolved cases
60%
Career Allowance Rate
67 granted / 112 resolved
At TC average
Strong +51% interview lift
Without
With
+50.9%
Interview Lift
resolved cases with interview
Typical timeline
3y 5m
Avg Prosecution
52 currently pending
Career history
176
Total Applications
across all art units

Statute-Specific Performance

§101
2.3%
-37.7% vs TC avg
§103
33.9%
-6.1% vs TC avg
§102
30.3%
-9.7% vs TC avg
§112
23.3%
-16.7% vs TC avg
Black line = Tech Center average estimate • Based on career data from 112 resolved cases

Office Action

§102 §112 §DP
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Priority The instant application is a national stage entry under 35 USC 371 of PCT/US2022/077586, filed 05 October 2022. Acknowledgment is made of Applicant’s claim for benefit under 35 USC 119(e) to US Provisional Application No. 63252520, filed 05 October 2021. However, the Examiner notes that US Provisional Application No. 63252520 fails to disclose the sequences of at least SEQ ID NOs: 100, 102, 106, 114, 118, 119, and 122-126, with the first recitation of those sequences instead being in PCT/US2022/077586. As these sequences are recited within independent claim 90, the effective filing date of the instant invention is 05 October 2022. Election/Restrictions Applicant’s election without traverse of Group I, encompassing claims 90-96 in the reply filed on 21 July 2026 is acknowledged. The requirement is still deemed proper and is therefore made FINAL. Accordingly, claims 97-109 are withdrawn from further consideration pursuant to 37 CFR 1.142(b) as being drawn to nonelected inventions, there being no allowable generic or linking claim. In addition, Applicant’s election of 3xcore3_eGHT_453m (SEQ ID NO: 104) for the species of enhancer is acknowledged. However, the Examiner hereby withdraws the species election required in the Restriction Requirement filed 21 May 2026. Therefore, claims 90-109, of record 13 June 2025, are pending. Claims 97-109 are withdrawn for reading on non-elected inventions. Prosecution on the merits commences for claims 90-96. Specification The substitute Specification filed 04 April 2024 is acknowledged and entered into the application file. However, the disclosure is objected to because of the following informalities: The clean version of the substitute Specification filed 04 April 2024 retains revision markings, specifically within Paragraph [0001]. Appropriate correction is required. Claim Objections Claims 91 and 94-95 are objected to because of the following informalities: Regarding claim 91: The instant claim is objected to for reciting “a fluorescent protein or neurotransmitter” instead of “a fluorescent protein or a neurotransmitter”, or the like. Appropriate correction is required. Regarding claim 94: The instant claim is objected to for reciting “wherein the artificial expression construct comprises or encodes a skipping element” instead of “wherein the artificial expression construct further comprises or encodes a skipping element”, as it is an additional component of the artificial expression construct. Appropriate correction is required. Regarding claim 95: The instant claim is objected to for reciting “a T2A peptide, P2A peptide, E2A peptide, F2A peptide, or an internal ribosome entry site (IRES)” instead of “a T2A peptide, a P2A peptide, an E2A peptide, a F2A peptide, or an internal ribosome entry site (IRES)”, or the like. Appropriate correction is required. Claim Rejections - 35 USC § 112 The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 90-96 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claim 90: The instant claim recites the limitation “an enhancer having the sequence of 3xcore3_eHGT_453m (SEQ ID NO: 104), eHGT_023m (SEQ ID NO: 2), 3xCore-eHGT_023h v3 (SEQ ID NO: 26), eHGT_181h (SEQ ID NO: 8), eHGT_023h v2 (SEQ ID NO: 4), eHGT_356h (SEQ ID NO: 10), eHGT_467m (SEQ ID NO: 18), eHGT_483m (SEQ ID NO: 19), eHGT_796h (SEQ ID NO: 22), eHGT_588m (SEQ ID NO: 24), eHGT_007m (SEQ ID NO: 13), eHGT_589m (SEQ ID NO: 100), eHGT_963m (SEQ ID NO: 102), 3xcore2_eHGT_387m (SEQ ID NO: 106), eHGT_882m (SEQ ID NO: 114), MGTE122 (SEQ ID NO: 118), MGTE146 (SEQ ID NO: 119), 3xcore_MGT_E116 (SEQ ID NO: 122), MGT_E150 (SEQ ID NO: 123), eHGT_1032h (SEQ ID NO: 124), eHGT_1027h (SEQ ID NO: 125), or eHGT_1027m (SEQ ID NO: 126)”. The scope of the claim is indefinite, as it is unclear if the parenthetical language is required by the claim, or is instead optional. Therefore, since the recitation of the parenthetical language is being treated as exemplary language, the metes and bounds of the claim cannot be determined. Instant claims 91-96 are included in the rejection because they depend from instant claim 90 and fail to correct the deficiencies of the parent claim. Appropriate correction is required. For the sake of compact prosecution, the instant claim is interpreted as requiring the associated sequence identifier. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 90-96 are rejected under 35 U.S.C. 102(a)(1) and 35 U.S.C. 102(a)(2) as being anticipated by Ting et al (WO 2020/168279 A2, of record on IDS filed 04 April 2024). It is of note that although Ting et al share joint inventors and a common assignee/applicant with the instant application, Ting et al is published greater than one year prior to the effective filing date of the instant invention and constitutes prior art under 35 U.S.C. 102(a)(1) at a minimum. Ting et al disclose artificial expression constructs for selectively modulating gene expression in selected central nervous system cell types, wherein the artificial expression constructs comprise an enhancer, a promoter, and a coding sequence of either a fluorescent protein or a neurotransmitter (Abstract; Paragraphs [0009], [0036]-[0040], [0048]-[0051], [0054], [0138]). As such, Ting et al disclose an artificial expression construct embodiment named CN1259 comprising an enhancer having the sequence of eHGT_023h, a minBGlobin promoter, and a SYFYP2 fluorescent protein (Paragraphs [0007], [0018], [0030], [0034], [0130], [0138]; Figures 21A, 22). Ting et al further disclose that the CN1259 artificial expression construct comprises the sequence of SEQ ID NO: 54, which has 100% sequence identity to instant SEQ ID NO: 4 (Paragraph [0030]; Figure 22). See sequence alignment at the end of document. Ting et al further disclose that the artificial expression constructs are comprised within a viral vector having a capsid protein that can cross the blood-brain barrier, including PHP.eB (Paragraphs [0007], [0009], [0027], [0034]-[0036], [0064]-[0095], [0138]). Ting et al further disclose that the artificial expression construct further comprises a skipping element, wherein the skipping element is P2A, T2A, E2A, F2A, or an internal ribosome entry site (Paragraphs [0030], [0060], [0138]; Figure 22). Accordingly, Ting et al anticipate the claims as follows: Regarding claims 90-91: Ting et al disclose an artificial expression construct comprising an enhancer having the sequence of eHGT_023h, a minBGlobin promoter, and a SYFYP2 fluorescent protein (claim 91), wherein the artificial expression construct comprises the sequence of SEQ ID NO: 54. As the sequence of SEQ ID NO: 54 has 100% sequence identity to instant SEQ ID NO: 4, this therefore reads on the artificial expression construct of instant claim 90. Regarding claims 92-93 and 96: Following the discussion of claim 90, Ting et al further disclose that the artificial expression constructs are comprised within a viral vector (claim 96) having a capsid protein that can cross the blood-brain barrier (claim 92), including PHP.eB (claim 93). This therefore reads on the artificial expression construct of this instant claims. Regarding claims 94-95: Following the discussion of claim 90, Ting et al further disclose that the artificial expression construct further comprises a skipping element (claim 94), wherein the skipping element is P2A, T2A, E2A, F2A, or an internal ribosome entry site (claim 95). This therefore reads on the artificial expression construct of this instant claims. Double Patenting The nonstatutory double patenting rejection is based on a judicially created doctrine grounded in public policy (a policy reflected in the statute) so as to prevent the unjustified or improper timewise extension of the “right to exclude” granted by a patent and to prevent possible harassment by multiple assignees. A nonstatutory double patenting rejection is appropriate where the conflicting claims are not identical, but at least one examined application claim is not patentably distinct from the reference claim(s) because the examined application claim is either anticipated by, or would have been obvious over, the reference claim(s). See, e.g., In re Berg, 140 F.3d 1428, 46 USPQ2d 1226 (Fed. Cir. 1998); In re Goodman, 11 F.3d 1046, 29 USPQ2d 2010 (Fed. Cir. 1993); In re Longi, 759 F.2d 887, 225 USPQ 645 (Fed. Cir. 1985); In re Van Ornum, 686 F.2d 937, 214 USPQ 761 (CCPA 1982); In re Vogel, 422 F.2d 438, 164 USPQ 619 (CCPA 1970); In re Thorington, 418 F.2d 528, 163 USPQ 644 (CCPA 1969). A timely filed terminal disclaimer in compliance with 37 CFR 1.321(c) or 1.321(d) may be used to overcome an actual or provisional rejection based on nonstatutory double patenting provided the reference application or patent either is shown to be commonly owned with the examined application, or claims an invention made as a result of activities undertaken within the scope of a joint research agreement. See MPEP § 717.02 for applications subject to examination under the first inventor to file provisions of the AIA as explained in MPEP § 2159. See MPEP § 2146 et seq. for applications not subject to examination under the first inventor to file provisions of the AIA . A terminal disclaimer must be signed in compliance with 37 CFR 1.321(b). The filing of a terminal disclaimer by itself is not a complete reply to a nonstatutory double patenting (NSDP) rejection. A complete reply requires that the terminal disclaimer be accompanied by a reply requesting reconsideration of the prior Office action. Even where the NSDP rejection is provisional the reply must be complete. See MPEP § 804, subsection I.B.1. For a reply to a non-final Office action, see 37 CFR 1.111(a). For a reply to final Office action, see 37 CFR 1.113(c). A request for reconsideration while not provided for in 37 CFR 1.113(c) may be filed after final for consideration. See MPEP §§ 706.07(e) and 714.13. The USPTO Internet website contains terminal disclaimer forms which may be used. Please visit www.uspto.gov/patent/patents-forms. The actual filing date of the application in which the form is filed determines what form (e.g., PTO/SB/25, PTO/SB/26, PTO/AIA /25, or PTO/AIA /26) should be used. A web-based eTerminal Disclaimer may be filled out completely online using web-screens. An eTerminal Disclaimer that meets all requirements is auto-processed and approved immediately upon submission. For more information about eTerminal Disclaimers, refer to www.uspto.gov/patents/apply/applying-online/eterminal-disclaimer. Claims 90-96 are provisionally rejected on the ground of nonstatutory double patenting as being unpatentable over claims 59-65 of copending Application No. 18/717907 (reference application). Although the claims at issue are not identical, they are not patentably distinct from each other because the patent claims anticipate the instant claims. Copending claim 59 is directed to an artificial expression construct comprising (i) an enhancer selected from SEQ ID NO 5, SEQ ID NO 6, SEQ ID NO: 62, SEQ ID NO: 63, SEQ ID NO: 64, SEQ ID NO: 65, SEQ ID NO: 66, SEQ ID NO: 67, SEQ ID NO: 68, SEQ ID NO: 69, SEQ ID NO:70, SEQ ID NO: 71, SEQ ID NO: 2, SEQ ID NO: 61, or SEQ ID NO 4 or a sequence having at least 95% sequence identity to the sequence as set forth in any of SEQ ID NOs: 2, 4-6, or 61-71 and having a same enhancer activity as SEQ ID NOs: 2, 4-6, or 61-71, wherein the same enhancer activity comprises selective expression within layer 4 or layer 5 intratelencephalic (IT) neurons; (ii) a promoter; and (iii) a coding sequence. This therefore anticipates the artificial expression construct of instant claim 90, as the enhancer of copending claim 59 having a sequence of SEQ ID NO: 62 is identical to the enhancer having a sequence of instant SEQ ID NO: 13. See sequence alignment below. With that, copending claims 60-65 directly teach the limitations of instant claims 91-96. This is a provisional nonstatutory double patenting rejection because the patentably indistinct claims have not in fact been patented. Allowable Subject Matter The Examiner notes that the originally elected enhancer species of 3xcore3_eGHT_453m having a required sequence of SEQ ID NO: 104 is free of the art. Conclusion Any inquiry concerning this communication or earlier communications from the examiner should be directed to ALYSSA G WESTON whose telephone number is (571)272-0337. The examiner can normally be reached Monday-Thursday 8AM - 4PM (CT); Friday 8AM - 11AM (CT). Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Christopher Babic can be reached at (571) 272-8507. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /ALYSSA G WESTON/Examiner, Art Unit 1633 Sequence Alignment Query Match 100.0%; Score 633; Matches 633; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCGTCCCTAAGCTGAGCTGAGACGTTTTAGTTATAAATGGCTTCTGTGCTTAGCAATCTG 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 9 GCGTCCCTAAGCTGAGCTGAGACGTTTTAGTTATAAATGGCTTCTGTGCTTAGCAATCTG 68 Qy 61 CTCTTTTTATTCCCGTGTGGACTTTCCCTAGCTCTGGCCTTATGCTGCACTAGAAAAGAT 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 69 CTCTTTTTATTCCCGTGTGGACTTTCCCTAGCTCTGGCCTTATGCTGCACTAGAAAAGAT 128 Qy 121 TTAGCAAGGGGAGAGGAAGCAGCCTTCCTTACATAACTGGCCTCTTGTGAAAGGGAGCAG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 129 TTAGCAAGGGGAGAGGAAGCAGCCTTCCTTACATAACTGGCCTCTTGTGAAAGGGAGCAG 188 Qy 181 CTGCTTGGTGGAAAAAGACATTCCCCTCCATGCATCCCTCTCCTTCTGCCTCTGGGGGTT 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 189 CTGCTTGGTGGAAAAAGACATTCCCCTCCATGCATCCCTCTCCTTCTGCCTCTGGGGGTT 248 Qy 241 GCAGCTTGAGTCAGAACCAGGACCATTTAACTCCAACCTTTGAGGAAGAGACGCACCCTG 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 249 GCAGCTTGAGTCAGAACCAGGACCATTTAACTCCAACCTTTGAGGAAGAGACGCACCCTG 308 Qy 301 GCCCCAGCCACGCCTGTTAGAATCTTCCTAGCTGAGTGACACAGTGACACTCAGCCTCAG 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 309 GCCCCAGCCACGCCTGTTAGAATCTTCCTAGCTGAGTGACACAGTGACACTCAGCCTCAG 368 Qy 361 TTTCTCTGTAAACAAAATGAAGATAAGAGAGCCGACGAGGATGAAATGGAATAACACACC 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 369 TTTCTCTGTAAACAAAATGAAGATAAGAGAGCCGACGAGGATGAAATGGAATAACACACC 428 Qy 421 GTGCGGTGCCTGGTACAGAGTGAGCCCCAGAACTGTTGACGCGGCCTCCTTGTGGCTGTC 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 429 GTGCGGTGCCTGGTACAGAGTGAGCCCCAGAACTGTTGACGCGGCCTCCTTGTGGCTGTC 488 Qy 481 TGGCTTGACCCGGAGTGACTCTGCCTCCCAGTTCTCCGGGATGGGAAGGTGATCCCTGTT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 489 TGGCTTGACCCGGAGTGACTCTGCCTCCCAGTTCTCCGGGATGGGAAGGTGATCCCTGTT 548 Qy 541 TGAGATACCAATTTATAAGAAACCGAGCCCGGGAGCTATTTAGAGGTGAGGTGATAAACC 600 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 549 TGAGATACCAATTTATAAGAAACCGAGCCCGGGAGCTATTTAGAGGTGAGGTGATAAACC 608 Qy 601 AGGAGGCCGGCTCCTTCATCCCGGTCATCACGA 633 (INSTANT SEQ ID NO: 4) ||||||||||||||||||||||||||||||||| Db 609 AGGAGGCCGGCTCCTTCATCCCGGTCATCACGA 641 (TING ET AL SEQ ID NO: 54) Query Match 100.0%; Score 508; Matches 508; Mismatches 0; Indels 0; Gaps 0; Qy 1 CTGGTAGAGTGGCAGAGAGAGAGAGAGAAAAGGAAACGCTAGAAAAGCTGAGCTGCAAGC 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 CTGGTAGAGTGGCAGAGAGAGAGAGAGAAAAGGAAACGCTAGAAAAGCTGAGCTGCAAGC 60 Qy 61 CCAGGCTGCCATTTGAAAGAGCAGTTGAGGAAGATCTGAATGAAAAACTCTGCAAATTTA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 CCAGGCTGCCATTTGAAAGAGCAGTTGAGGAAGATCTGAATGAAAAACTCTGCAAATTTA 120 Qy 121 TGCTAATTGTGTTCAGTTCCATGAGTTTCATCCCATTGAGTGGGAGCCAGGCCACCTGAT 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 TGCTAATTGTGTTCAGTTCCATGAGTTTCATCCCATTGAGTGGGAGCCAGGCCACCTGAT 180 Qy 181 TGCTTCTCCTTTTGGTAAAGAACATCTCAGATGAACCAGCTGTCATGGACATGGTTCAGA 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TGCTTCTCCTTTTGGTAAAGAACATCTCAGATGAACCAGCTGTCATGGACATGGTTCAGA 240 Qy 241 AAATTGGCCCTAAAAAGAAACCTGGGCCATCTGTGTGTGCTGTTCTATTCATAGGATGCC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 AAATTGGCCCTAAAAAGAAACCTGGGCCATCTGTGTGTGCTGTTCTATTCATAGGATGCC 300 Qy 301 CTCCAAATCACATATTTCTATTAGGAACCTCACAGCAAGGGCCTCTACCATGGGAGCAAT 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 CTCCAAATCACATATTTCTATTAGGAACCTCACAGCAAGGGCCTCTACCATGGGAGCAAT 360 Qy 361 AGAGAACATTGGTCATCATCATCTATTGCACTCCCTTGGGGTGGGAGTGCTGTGATTTCT 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 AGAGAACATTGGTCATCATCATCTATTGCACTCCCTTGGGGTGGGAGTGCTGTGATTTCT 420 Qy 421 AGCAAAGAGAACTCAGGGCTGAGGTAGATAACAAAGACAACTTGGAATGTCTAACGTGAG 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 AGCAAAGAGAACTCAGGGCTGAGGTAGATAACAAAGACAACTTGGAATGTCTAACGTGAG 480 Qy 481 GAAGCATCCTTCTCTTCCTTTTGCTTTG 508 (INSTANT SEQ ID NO: 13) |||||||||||||||||||||||||||| Db 481 GAAGCATCCTTCTCTTCCTTTTGCTTTG 508 (18/717907 SEQ ID NO: 62)
Read full office action

Prosecution Timeline

Apr 04, 2024
Application Filed
Aug 12, 2026
Non-Final Rejection mailed — §102, §112, §DP (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12735677
METHOD FOR PRODUCING ASTROCYTE-LIKE CELLS
3y 6m to grant Granted Sep 15, 2026
Patent 12723062
METHODS OF TREATING MITOCHONDRIAL DISORDERS
2y 3m to grant Granted Sep 01, 2026
Patent 12686849
COMPOSITIONS AND METHODS FOR IMPROVING EMBRYO DEVELOPMENT
2y 5m to grant Granted Jul 21, 2026
Patent 12668781
MATERIALS AND METHODS FOR THE MANUFACTURE OF PLURIPOTENT STEM CELLS
2y 2m to grant Granted Jun 30, 2026
Patent 12624338
METHOD AND DEVICE FOR TARGET CELL SEPARATION
2y 10m to grant Granted May 12, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
60%
Grant Probability
99%
With Interview (+50.9%)
3y 5m (~12m remaining)
Median Time to Grant
Low
PTA Risk
Based on 112 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month