Prosecution Insights
Last updated: July 17, 2026
Application No. 18/699,034

CORONAVIRUS VACCINES

Non-Final OA §101§102§103§112
Filed
Apr 05, 2024
Priority
Oct 06, 2021 — GB 2114318.5 +2 more
Examiner
GILL, RACHEL B
Art Unit
1671
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Cambridge Enterprise Limited
OA Round
1 (Non-Final)
66%
Grant Probability
Favorable
1-2
OA Rounds
2m
Est. Remaining
94%
With Interview

Examiner Intelligence

Grants 66% — above average
66%
Career Allowance Rate
563 granted / 859 resolved
+5.5% vs TC avg
Strong +28% interview lift
Without
With
+28.0%
Interview Lift
resolved cases with interview
Typical timeline
2y 5m
Avg Prosecution
49 currently pending
Career history
906
Total Applications
across all art units

Statute-Specific Performance

§101
0.9%
-39.1% vs TC avg
§103
40.3%
+0.3% vs TC avg
§102
15.5%
-24.5% vs TC avg
§112
5.8%
-34.2% vs TC avg
Black line = Tech Center average estimate • Based on career data from 859 resolved cases

Office Action

§101 §102 §103 §112
Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . DETAILED ACTION Disposition of Claims Claims 1, 6-8, 29, 32, 36, 44, 48, 50, 56, 77, 80-81, 84, 86-88, 92, and 95 are pending. Examiner’s Note All paragraph numbers (¶) throughout this office action, unless otherwise noted, are from the US PGPub of this application US20250312437A1, Published 10/09/2025. Amendments to the specification presented on 10/14/2025 are acknowledged and entered. Applicant is encouraged to utilize the new web-based Automated Interview Request (AIR) tool for submitting interview requests; more information can be found at https://www.uspto.gov/patent/laws-and-regulations/interview-practice. Optional Authorization to Initiate Electronic Communications The Applicant’s representative may wish to consider supplying a written authorization in response to this Office action to correspond with the Examiner via electronic mail (e-mail). This authorization is optional on the part of the Applicant’s representative, but it should be noted that the Examiner may not initiate nor respond to communications via electronic mail unless and until Applicant’s representative authorizes such communications in writing within the official record of the patent application. A sample authorization is available at MPEP § 502.03, part II. If Applicant’s representative chooses to provide this authorization, please ensure to include a valid e-mail address along with said authorization. Priority Receipt is acknowledged of certified copies of papers required by 37 CFR 1.55. Notably, the disclosure of GB 2114318.5, filed 10/06/2021, does not provide written description support under 35 USC 112(a) for certain claimed elements. Namely, SEQ ID NOs: 88 and higher do not appear in this priority document, nor is a disclosure for the pURVac vector limitation provided. The pURVac vector was not disclosed until GB2214126.1, filed 09/27/2022. Accordingly, claim 48 is not entitled to the 10/06/2021 foreign priority date. Claim 48 is entitled only to the filing date of the earliest application in the priority chain that provides adequate written description for the pURVac vector limitation, which is 09/27/2022. Information Disclosure Statement The information disclosure statements (IDS) submitted on 02/12/2026 and 04/05/2024 are in compliance with the provisions of 37 CFR 1.97. Accordingly, the information disclosure statements are being considered by the examiner. Notably, the disclosure statement filed lists a Search Report. The listing of the references cited in a Search Report itself is not considered to be an information disclosure statement (IDS) complying with 37 CFR 1.98. 37 CFR 1.98(a)(2) requires a legible copy of: (1) each foreign patent; (2) each publication or that portion which caused it to be listed; (3) for each cited pending U.S. application, the application specification including claims, and any drawing of the application, or that portion of the application which caused it to be listed including any claims directed to that portion, unless the cited pending U.S. application is stored in the Image File Wrapper (IFW) system; and (4) all other information, or that portion which caused it to be listed. In addition, each IDS must include a list of all patents, publications, applications, or other information submitted for consideration by the Office (see 37 CFR 1.98(a)(1) and (b)), and MPEP § 609.04(a), subsection I. states, "the list ... must be submitted on a separate paper." Therefore, the references cited in the Search Report have not been considered. Applicant is advised that the date of submission of any item of information or any missing element(s) will be the date of submission for purposes of determining compliance with the requirements based on the time of filing the IDS, including all "statement" requirements of 37 CFR 1.97(e). See MPEP § 609.05(a). Note: If copies of the individual references cited on the Search Report are also cited separately on the IDS (and these references have not been lined-through) they have been considered. Drawings A petition filed under 37 CFR 1.84(a)(2) was granted on 12/11/2025 to allow color drawings in the instant application. Color photographs have therefore been accepted as the conditions for accepting color drawings and black and white photographs has been satisfied. See 37 CFR 1.84(b)(2). Claim Objections Claim 1 is objected to because of the following informalities: the claim is objected to under 37 CFR 1.75 as being informal. Claim 1 presents alternatives (a) and (b) through reproduced tables and recites “an amino acid sequence of SEQ ID NO:88” and “an amino acid sequence of SEQ ID NO: 87” without clearly stating whether the claimed sequences must be full-length sequences or whether fragments thereof are intended to be encompassed. In order to place the claim in better form, Applicant should rewrite claim 1 in conventional textual form, state whether the recited sequences and percentage-identity variants are full-length sequences, and identify the reference sequence over which percentage identity is calculated. The optional mutations and deletions should be stated in conventional mutational nomenclature rather than by reproduced tables. For example, if applicant intends to claim full-length sequences, claim 1 may be rewritten substantially as follows: “1. An isolated polypeptide comprising: (a) the full length amino acid sequence as set forth in SEQ ID NO: 88, or a full-length amino acid sequence having at least 98% amino acid identity across the entire length of SEQ ID NO: 88, wherein the amino acid sequence optionally comprises one or more mutations selected from L18F, T20N, P26S, H69del, V70del, Y144del, K417N, E484K, Q498R, N501Y, D614G, P681H, and deletion of K1255-T1273, wherein the amino acid residues are numbered according to SEQ ID NO: 52; or (b) the full-length amino acid sequence set forth in SEQ ID NO: 87, or a full-length amino acid sequence having at least 99% amino acid identity across the entire length of SEQ ID NO: 87, wherein the amino acid sequence optionally comprises one or more mutations selected from L18F, T20N, P26S, H69del, V70del, Y144del, K417N, E484K, Q498R, N501Y, D614G, and P681H, wherein the amino acid residues are numbered according to SEQ ID NO: 52.” Appropriate correction is required. Claim 32 is objected to because of the following informalities: the claim is objected to under 37 CFR 1.75 as being informal. Claim 32 recites a nucleic acid molecule comprising a nucleotide sequence of SEQ ID NO: 90 or SEQ ID NO: 91, or a nucleotide sequence having at least 70% to 99% nucleotide sequence identity “over its entire length” with a nucleotide sequence of SEQ ID NO: 90 or SEQ ID NO: 91, or "a complement thereof". The claim should be rewritten to place the claim in better form, namely to separately identify the exact sequence, sequence identity, and complement alternatives. In particular, applicant should clarify whether the recited nucleotide sequences must include the full-length sequences of SEQ ID NOs: 90 and 91, respectively, or whether fragments are intended to be encompassed. Applicant should also clarify that any sequence identity calculation is performed over the entire length of the applicable reference sequence, rather than only over the length of a shorter candidate sequence. Further, as set forth in the 35 USC 112b rejection infra, the “a complement thereof” should be revised to clearly identify the antecedent basis. The recitation of “at least 70%, 71%, 72%,…99% identity” is redundant because “at least 70% identity encompasses each higher stated identity threshold. For example, if Applicant intends to claim full-length coding sequences, claim 32 may be rewritten along the lines of the following: “32. The nucleic acid molecule of claim 29, wherein the nucleic acid molecule comprises: (a) the full-length nucleotide sequence as set forth in SEQ ID NO: 90; (b) the full-length nucleotide sequence as set forth in SEQ ID NO: 91; (c) a full-length nucleotide sequence having at least 70% nucleotide sequence identity to the nucleotide sequence set forth in SEQ ID NO: 90, wherein nucleotide sequence identity is determined by an alignment spanning the entire length of SEQ ID NO: 90; (d) a full-length nucleotide sequence having at least 70% nucleotide sequence identity to the nucleotide sequence set forth in SEQ ID NO: 91, wherein nucleotide sequence identity is determined by an alignment spanning the entire length of SEQ ID NO: 91; or (e) a complement of any one of (a) through (d).” Appropriate correction is required. Claim 95 is objected to because of the following informalities: the definitions of “SARS-CoV”, “SARS-CoV-2”, and “VOC” are not provided. For clarity, the first recitation of an abbreviation in a claim should be preceded by its non-abbreviated form. For instance, claim 95 can be amended to read “…severe acute respiratory syndrome coronavirus (SARS-CoV) or SARS-CoV type 2 (SARS-CoV-2), preferably wherein the beta-coronavirus is a SARS-CoV-2 variant of concern (VOC), optionally wherein the beta-coronavirus is a SARS-CoV-2 beta, gamma, delta, or omicron VOC.” Appropriate correction is required. Claim Rejections - 35 USC § 112(b); Second Paragraph The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION.—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. The following is a quotation of 35 U.S.C. 112 (pre-AIA ), second paragraph: The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the applicant regards as his invention. Claims 1 and 32 and dependent claims 6-8, 29, 36, 44, 48, 50, 56, 77, 80-81, 84, 86-88, 92, and 95 thereof are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 1 recites, in alternatives (a) and (b), an amino acid sequence having at least 98% or 99% amino acid identity, respectively, “over its entire length” with the amino acid sequence of SEQ ID NO: 88 or SEQ ID NO: 87. It is unclear as to the antecedent basis of “its”, making it unclear whether “its entire length” requires comparison over the entire length of SEQ ID NO: 88 or SEQ ID NO: 87, or instead permits comparison over the entire length of a shorter candidate sequence aligned to only a portion of the respective reference sequence. This ambiguity affects the claims scope as there are two clear and distinctly reasonable interpretations of the claim. One interpretation requires the candidate sequence to be compared over the entire length of the claimed SEQ ID NOs, while another interpretation allows for fragments of SARS CoV-2 S protein to be compared to the claimed SEQ ID NOs:. Claim 32 is rejected for similar reasoning with respect to the claimed nucleic acid sequence. Since a skilled artisan would not be reasonably apprised as to the metes and bounds of the claimed invention, instant claims 1 and 32 are rejected on the grounds of being indefinite. Claims 6-8, 29, 36, 44, 48, 50, 56, 77, 80-81, 84, 86-88, 92, and 95 are also rejected since they depend from claim 1 or 32, but do not remedy these deficiencies of claims 1 or 32. Claims 6-8, 29, 32, 36, 44, 48, 50, 56, 77, 80-81, 84, 86-88, 92, and 95 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. The claims refer to the independent claim upon which they depend using an indefinite article (e.g. “A” or “An”) instead of using a definite article (e.g. “The”), and subsequently, there is insufficient antecedent basis for this limitation in the claim as it is unclear as to what is specifically being referenced. It is suggested that all rejected claims use a definite article (e.g. with claim 32, it should be drawn to: “The nucleic acid molecule according to claim 29,” and with claim 29 it should be drawn to “An isolated nucleic acid molecule encoding the polypeptide according to claim 1,”) For at least these reasons, the metes and bounds of the claim are unclear. Claims 29, 32, 56, and 84 and dependent claims 36, 44, 48, 50, 77, 81, 86-88, 92, and 95 thereof are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 29 is drawn to an isolated nucleic acid molecule encoding the polypeptide according to claim 1 or the complement thereof. It is unclear whether “the complement thereof” refers to (i) the complement of the nucleotide sequence encoding the polypeptide; (ii) a double-stranded nucleic acid molecule comprising both a coding strand and its complementary strand; or (iii) a nucleic acid molecule in which the nucleotide sequence may be present in either orientation. This ambiguity materially affects the scope of the claim, as a nucleotide sequence encoding the polypeptide of claim 1 is ordinarily a coding-sense sequence. The single-stranded complement of that sequence does not by itself and in the same orientation, encode the same polypeptide. Accordingly, it is unclear whether the claim encompasses a separate antisense nucleic acid, a double-stranded nucleic acid molecule, or only a nucleotide sequence encoding the recited polypeptide. Claims 32, 56, and 84 are also rejected for similar reasoning regarding “the complement thereof”. For at least these reasons, the metes and bounds of claims 29, 32, 56, and 84 are unclear. Claims 36, 44, 48, 50, 77, 81, 86-88, 92, and 95 are rejected for depending upon claims 29, 32, 56, or 84, but not clarifying the issues of claims 29, 32, 56, or 84. Claims 36, 44, 48, 50, and 95 are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Regarding claims 36, 44, 48, 50, and 95, the phrase "preferably" renders the claim indefinite because it is unclear whether the limitation(s) following the phrase are part of the claimed invention. See MPEP § 2173.05(d). Additionally, as the use of “preferably” in certain claims follows or precedes the use of the term “optionally” (e.g. claims 36, 95) so it is unclear if the limitations are or are not required. Finally, the drafting of some claims, it is unclear if only the limitations immediately following “preferable” are required elements (e.g. the Markush grouping of claim 44; the “wherein the vector comprises a nucleotide sequence of SEQ ID NO:95” limitation of claim 48). Because the use of the term “preferable” makes it unclear as to what is or is not required in the claim, these claims are rejected on the grounds of being indefinite. For at least these reasons, the metes and bounds of the claim are unclear. Claim 48 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 48 recites the limitation "A vector according to claim 44, which is a pURVac vector" in line 1 of the claim. There is insufficient antecedent basis for this limitation in the claim, as claim 44 recites multiple vectors and it is unclear as to which vector claim 48 is further limiting. Furthermore, the specification notes SEQ ID NOs: 94 and 95 are both pURVac vectors which comprise additional materials. A search of the art does not make it clear what the sequence is for said specific vector, and an alignment of the two provides inconclusive data (see attached ClustalOmega alignment document in Search Results.) It is therefore suggested to clarify the metes and bounds of the claim to amend claim 48 to read upon the following: “48. The vector of claim 44, wherein the vaccine vector is a DNA vaccine vector that comprises the nucleotide sequence of SEQ ID NO:95.” Another suggestion is to amend claim 48 along the lines of the following, and have the sequence be an additional limiting factor in another dependent claim: “48. The vector of claim 44, wherein the vaccine vector is a DNA vaccine vector, and wherein said DNA vaccine vector is a pURVac vector.” For at least these reasons, the metes and bounds of claim 48 are unclear. Claim 50 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 50 recites the limitation "A vector according to claim 44, which is a Modified Vaccinia virus Ankara (MVA) vector, preferably wherein the MVA vector comprises a nucleic acid molecule encoding a polypeptide according to claim 1, wherein the vector comprises a nucleotide sequence of SEQ ID NO:98.". There is insufficient antecedent basis for the “vector” limitation in the claim, as claim 44 recites multiple vectors and it is unclear as to which vector claim 50 is further limiting. It is therefore suggested to clarify the metes and bounds of the claim to amend claim 50 to read upon the following: “50. The vector of claim 44, wherein the vaccine vector is a viral vaccine vector, wherein the viral vaccine vector is a Modified Vaccinia virus Ankara (MVA) vector.” For at least these reasons, the metes and bounds of claim 50 are unclear. Claim 77 and dependent claims 80 and 81 thereof are rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 77 recites “A nucleic acid molecule according to claim 29, a vector comprising a nucleic acid molecule according to claim 29, or a pharmaceutical composition comprising a nucleic acid molecule according to claim 29, wherein the nucleic acid molecule comprises one or more modified nucleosides.” It is unclear whether claim 77 is intended to set forth (i) the nucleic acid molecule of claim 29 having one or more modified nucleosides; (ii) a vector comprising the nucleic acid molecule of claim 29 having one or more modified nucleosides; or (iii) a pharmaceutical composition comprising a nucleic acid molecule of claim 29 having one or more modified nucleosides. The claim does not clearly and consistently identify the subject matter upon which it depends or the relationship of the modified nucleoside limitation to each recited alternative. Claims 80 and 81 depend upon claim 77 and repeat the same uncertainty and do not cure the deficiencies of claim 77. One suggestion is to parse out these limitations into three separate dependent claims, and have the nucleic acid molecule depend upon claim 29, the vector depend upon claim 36, and the pharmaceutical composition depend upon claim 56. Then claims 80 and 81 can be rewritten to depend from the respective nucleic acid, vector, or composition claims, rather than trying to preserve all three formats in a single unclear dependency claim. For at least these reasons, claim 77 is rejected on the basis of being indefinite. Claims 80 and 81 are also rejected for similar reasoning, and for depending upon claim 77, but not clarifying the issues of claim 77. Claim 81 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 81 recites the limitation "the open reading frame" in line 4. There is insufficient antecedent basis for this limitation in the claim. Claim 86 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor (or for applications subject to pre-AIA 35 U.S.C. 112, the applicant), regards as the invention. Claim 86 recites the limitation "a nucleic acid" in line 2, “a vector” in line 2, and “a pharmaceutical composition” in line 3. There is insufficient antecedent basis for this limitation in the claim, as claim 86 depends upon claim 84 and should clearly recite back to “the nucleic acid of part (b), the vector of part (c), or the pharmaceutical composition of part (d)”. Claim Interpretation The claims in this application are given their broadest reasonable interpretation using the plain meaning of the claim language in light of the specification as it would be understood by one of ordinary skill in the art. Claim 1 is drawn to an isolated polypeptide which comprises: (a) an amino acid sequence of SEQ ID NO: 88, or an amino acid sequence having at least 98% amino acid identity across its entire length with the amino acid sequence of SEQ ID NO: 88, wherein the amino acid sequence optionally comprises one or more mutations selected from L18F, T20N, P26S, H69del, V70del, Y144del, K417N, E484K, Q498R, N501Y, D614G, P681H, and deletion of K1255-T1273, wherein the amino acid residues are numbered according to SEQ ID NO: 52; or (b) an amino acid sequence of SEQ ID NO: 87, or an amino acid sequence having at least 99% amino acid identity across its entire length with the amino acid sequence of SEQ ID NO: 87, wherein the amino acid sequence optionally comprises one or more mutations selected from L18F, T20N, P26S, H69del, V70del, Y144del, K417N, E484K, Q498R, N501Y, D614G, and P681H, wherein the amino acid residues are numbered according to SEQ ID NO: 52. Further limitations on the polypeptide according to claim 1 are wherein the polypeptide comprises an R amino acid residue at a position corresponding to amino acid residue position Q498 of SEQ ID NO:52 (claim 6); wherein the polypeptide comprises a deletion of amino acid residues at positions corresponding to amino acid residue positions K1255-T1273 of SEQ ID NO:52 (claim 7); wherein the polypeptide comprises an amino acid residue P at a position corresponding to amino acid residue position K986 of SEQ ID NO:52, and an amino acid residue P at a position corresponding to amino acid residue position V987 of SEQ ID NO:52 (claim 8) Claim 29 is drawn to an isolated nucleic acid molecule encoding the polypeptide according to claim 1. Further limitations on the nucleic acid molecule according to claim 29 are wherein the nucleic acid molecule comprises: (a) a nucleotide sequence as set forth in SEQ ID NO: 90; (b) a nucleotide sequence as set forth in SEQ ID NO: 91; (c) a nucleotide sequence having at least 70% nucleotide sequence identity to the nucleotide sequence set forth in SEQ ID NO: 90, wherein nucleotide sequence identity is determined by an alignment spanning the entire length of SEQ ID NO: 90; (d) a nucleotide sequence having at least 70% nucleotide sequence identity to the nucleotide sequence set forth in SEQ ID NO: 91, wherein nucleotide sequence identity is determined by an alignment spanning the entire length of SEQ ID NO: 91; or (e) a complement of any one of (a) through (d)(claim 32) Further limitations on the nucleic acid molecule of claim 29, are wherein said nucleic acid molecule comprises one or more modified nucleosides, and wherein said molecule is isolated, in a vector, or in a pharmaceutical composition (claim 77), wherein said nucleic acid molecule is messenger RNA (mRNA)(claim 80), wherein the one or more modified nucleosides are uridines modified to incorporate 1-methylpseudouridine; optionally, wherein at least 80% of the uridines in the nucleic acid molecule have been modified (claim 81). Claim 36 is drawn to a vector comprising the nucleic acid molecule of claim 29, optionally which further comprises a promoter operably linked to the nucleic acid, preferably wherein the promoter is for expression of a polypeptide encoded by the nucleic acid in mammalian cells. Further limitations on the vector according to claim 36 are wherein said vector is a vaccine vector, wherein said vaccine vector is a viral vaccine vector, a bacterial vaccine vector, an RNA vaccine vector, a DNA vaccine vector, or an mRNA vaccine vector (claim 44), wherein the vaccine vector is a DNA vaccine vector, and wherein said DNA vaccine vector is a pURVac vector (claim 48), and wherein the vaccine vector is a viral vaccine vector, and wherein the viral vaccine vector is a Modified Vaccinia virus Ankara (MVA) (claim 50). Claim 56 is drawn to a pharmaceutical composition comprising: a) the polypeptide according to claim 1; b) a nucleic acid molecule comprising a nucleotide sequence encoding the polypeptide of (a), or the complement thereof; or c) a vector comprising a nucleic acid molecule of (b), and a pharmaceutically acceptable carrier, excipient, or diluent, optionally which further comprises an adjuvant for enhancing an immune response in a subject to the polypeptide, or to a polypeptide encoded by the nucleic acid molecule, of the composition. Claim 84 is drawn to a method of inducing an immune response to a coronavirus (CoV) in a subject, or of immunizing a subject against a coronavirus (CoV), wherein said method comprises administering to the subject an effective amount of: a) the polypeptide according to claim 1; b) a nucleic acid molecule comprising a nucleotide sequence encoding the polypeptide of (a), or the complement thereof; c) a vector comprising the nucleic acid molecule of (b); d) a pharmaceutical composition comprising the polypeptide of (a) and a pharmaceutically acceptable carrier, excipient, or diluent; or e) a pharmaceutical composition comprising the nucleic acid molecule of (b), or the vector of (c), and a pharmaceutically acceptable carrier, excipient, or diluent. Further limitations on the method according to claim 84 are wherein the method comprises administering the nucleic acid of part (b), the vector of part (c), or the pharmaceutical composition of part (d), wherein the nucleic acid, vector, or pharmaceutical composition is administered as part of a heterologous prime boost regimen (claim 86), wherein the heterologous prime boost regimen comprises a DNA prime followed by an MVA boost (claim 87), wherein the DNA prime comprises administration of a DNA vaccine vector comprising the nucleic acid molecule of claim 29, and the MVA boost comprises administration of an MVA vector comprising the nucleic acid molecule of claim 29, optionally wherein the DNA vaccine vector and MVA vector nucleic acid molecules encode the same amino acid sequence (claim 88); wherein the coronavirus is a beta-coronavirus, optionally wherein the β-coronavirus is a lineage B beta-coronavirus (claim 92), and wherein the lineage B β-coronavirus is severe acute respiratory syndrome coronavirus (SARS-CoV) or SARS-CoV type 2 (SARS-CoV-2), and when the lineage B β-coronavirus is a SARS-CoV-2 virus, said SARS-CoV-2 virus is a variant of concern (VOC) selected from the group consisting of a beta, gamma, delta, or omicron VOC (claim 95). Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claims 1 and 56 are rejected under 35 U.S.C. 101 because the claimed invention is directed to naturally occurring severe acute respiratory syndrome coronavirus type 2 (SARS-CoV-2) spike (S) protein variants without significantly more. The claims recite an isolated polypeptide comprising, inter alia, an amino acid sequence having at least 99% identity over its entire length with the amino acid sequence of SEQ ID NO: 87, or an amino acid sequence having at least 98% identity over its entire length with the amino acid sequence of SEQ ID NO: 88. As set forth in the 35 USC 112b rejection supra, it is unclear if the “its” refers to the comparison sequence or the deposited SEQ ID NO:. Regardless, natural S protein variants, such as QVK75183 (Howard D, et. al. Surface glycoprotein [Severe acute respiratory syndrome coronavirus 2]. GenBank: QVK75183.1. Dep. 05/18/2021.) have at least 98% identity to SEQ ID NO: 88 and 98.9% identity to SEQ ID NO: 87, which meets the limitations under both reasonable interpretations. QVK75183 has K417T, E484K, N501Y, and D614G substitution mutations. It is 98.9% identical to SEQ ID NO: 87 over 100% of the entire length of QVK75183, and it is 98.88% identical to SEQ ID NO: 88 over 100% of the entire length of SEQ ID NO: 88, as determined by NCBI BLAST alignment (see attached search results). This naturally occurring Spike protein does not possess markedly different structural, functional, or other characteristics from the polypeptide recited in claim 1. The recitation that the polypeptide is “isolated” does not impart markedly different characteristics. Further, the mutations and deletions listed in claim 1 are optional for the applicable sequence-identity alternative, and do not exclude the naturally occurring spike protein from the scope of the claim. Claim 56 is also rejected as it encompasses a pharmaceutical composition which comprises the naturally occurring peptide of claim 1, and the composition comprises a pharmaceutically acceptable carrier, excipient, or diluent. As noted by the specification at ¶[0826], water is considered to be an acceptable carrier, and would not markedly or distinctly change the naturally occurring polypeptide. The claims do not include additional elements that are sufficient to amount to significantly more than the judicial exception because sequence of the polypeptide does not comprise additional structural limitations to distinguish it from the naturally occurring protein, nor do the elements in the pharmaceutical composition markedly change the protein. Accordingly, the claims considered individually and in combination, do not amount to significantly more than the judicial exception. One suggestion is to incorporate limitations into the independent claim which were not included in this rejection. Another is to narrow the percent identity of the claimed polypeptide to that which cannot read upon naturally-occurring variants. Another suggestion for at least claim 56 is to add specific elements to the composition which markedly change the protein, such as adjuvants. Claim Rejections - 35 USC § 112(a); First Paragraph The following is a quotation of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. The following is a quotation of the first paragraph of pre-AIA 35 U.S.C. 112: The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same and shall set forth the best mode contemplated by the inventor of carrying out his invention. Claims 36, 44, 48, 50, 56, 84, 86-88, 92, and 95 are rejected under 35 U.S.C. 112(a) or 35 U.S.C. 112 (pre-AIA ), first paragraph, because the specification, while being enabling for isolated nucleic acids and isolated vectors comprising the S protein encoding sequences, does not reasonably provide enablement for any nucleic acids or any vectors which may comprise said S protein coding sequences. The specification does not enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention commensurate in scope with these claims. The claims are directed broadly to “a vector” or “a nucleic acid” without limitation as to form, environment, or method of use. As such, the claim encompasses the nucleic acid and/or vector in a wide range of contexts, including incorporation into vectors, plasmids, artificial chromosomes (e.g. bacterial or yeast artificial chromosomes (BACs or YACs)), cosmids, prokaryotic and eukaryotic cells, and organismal systems (e.g. Bacteria and Archaea, Eukaryotes (including vertebrate and invertebrate animals, plants, and fungi), and viruses). The specification does not provide guidance sufficient to enable the use of the claimed vector or nucleic acid across this full scope, including in complex biological systems where expression, stability, and functionality may vary depending on the host environment and delivery method. Accordingly, undue experimentation would be required to determine how to make and use the claimed vectors and nucleic acids across the full scope of the claim. It is suggested that the claims be amended to read upon “an isolated nucleic acid” [emphasis added] or “an isolated vector” in order to overcome this rejection. Claim Rejections - 35 USC § 102 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale, or otherwise available to the public before the effective filing date of the claimed invention. (a)(2) the claimed invention was described in a patent issued under section 151, or in an application for patent published or deemed published under section 122(b), in which the patent or application, as the case may be, names another inventor and was effectively filed before the effective filing date of the claimed invention. Claims 1, 6-8, 29, 32, 36, 44, 56, 77, 80-81, 84, 86, 92, and 95 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Roth et. al. (US20220202930A1; Priority 12/22/2020; hereafter “Roth”.) 17558257 The Prior Art Roth teaches nucleic acids suitable for use in treatment or prophylaxis of an infection with a coronavirus, preferably from infection with a Coronavirus SARS-CoV-2, or a disorder related to such an infection, such as COVID-19, as well as to compositions, polypeptides, and vaccines thereof (entire document; see abstract.) Roth teaches that the coding sequence could be RNA, and can code for a sequence of SEQ ID NO:1 that comprises any number of known mutations (insertions, substitutions, deletions) that are associated with known SARS-CoV-2 strains or emerging variants (reference claim 1; ¶[0002-0008]). SEQ ID NO: 1 of Roth aligns with 98.4% identity to instant SEQ ID NO: 87 and 96.9% identity to SEQ ID NO: 88, but Roth teaches specific mutants of the SARS-CoV-2 that align with 99.3% identity to instant SEQ ID NOs: 87 and 88 (SEQ ID NO: 27087 of Roth; See ABSS sequence alignments for .rai files). Roth therefore teaches instant claims 1 and 29. Roth teaches the S protein may have a Q498R mutation (¶[0122][0130-0131]; instant claim 6), and that the S protein may be C-terminally truncated compared to the amino acid sequence of the original S protein (¶[0037][0100]), namely wherein the C-terminal truncation lacks the C-terminal amino acids (aa) 531 to up to aa 1273 of the full length SARS-CoV-2 variant protein, namely lacking the C-terminal transmembrane domain (that is, lacking aa 1212 to aa 1273 or lacking aa 1148 to aa 1273) (amino acid positions according to reference SEQ ID NO: 1)(¶[0238]; instant claim 7). Roth teaches that the S protein may have the “2P stabilization” mutations at K986P and V987P (¶[0169-0176]; instant claim 8). Roth teaches a nucleic acid RNA sequence of SEQ ID NO: 22765, which is at least 77.6% identical to instant SEQ ID NO: 90 (see alignment below, 22765 Qy, 90 Db; instant claim 32.) Roth teaches the nucleic acid may be encoded by a viral vector (¶[0939][1044][1047][1051-1052]; instant claims 36, 44). Roth teaches pharmaceutical compositions which comprise the nucleic acid encoding the polypeptide (¶[0581-0593]), wherein said composition includes a pharmaceutically acceptable carrier or excipient (¶[0594]; instant claim 56). Said RNA may comprise modified nucleotides (¶[0572]) such as N(1)-methylpseudouridine (m1ψ) or pseudouridine (ψ) instead of uracil (¶[1115]; instant claims 77, 81). Roth teaches the RNA may be mRNA (reference claim 1; instant claim 80). Roth teaches the compositions may be used in methods by delivery of an effective amount of the composition to a subject in need thereof to induce an immune response against SARS-CoV-2 (¶[0113][0951-0952][0965-0967][0969-1066]; instant claims 84, 92, 95). Said vaccination regimens to induce an immune response can be prime/boost vaccination regimens (¶[0913][1181-1183][1043]; instant claim 86). Roth teaches that the prime/boost may be heterologous prime/boost in that the compositions are different (¶[0021][0910-0913][1240]). For at least these reasons, Roth teaches the limitations of instant claims 1, 6-8, 29, 32, 36, 44, 56, 77, 80-81, 84, 86, 92, and 95, and anticipates the invention encompassed by said claims. RESULT 1 US-18-699-034-90 Query Match 77.6%; Score 2965.6; DB 1; Length 3810; Best Local Similarity 71.5%; Matches 2729; Conservative 571; Mismatches 509; Indels 9; Gaps 2; Qy 1 AUGUUCGUGUUCCUGGUCCUCCUGCCCCUGGUGAGCUCCCAGUGCGUGAACCUCACCACC 60 |:|::||:|:: |:||: |: |:||| |:||:| | ||||:|||:|||| :||||| | Db 1 ATGTTCGTGTTTCTGGTGCTGCTGCCTCTGGTGTCCAGCCAGTGCGTGAACTTCACCAAC 60 Qy 61 CGCACGCAGCUGCCGCCCGCCUACACCAACAGCUUCACCCGGGGCGUCUACUACCCCGAC 120 | || ||||:||| ||||:|||||||||||:: ||| | ||||: :||:|||||||| Db 61 AGAACCCAGCTGCCTAGCGCCTACACCAACAGCTTTACCAGAGGCGTGTACTACCCCGAC 120 Qy 121 AAGGUGUUCCGCUCCAGCGUGCUGCACUCCACCCAGGACCUCUUCCUGCCCUUCUUCAGC 180 ||||:|::| | :||||||:||:||||:| ||||||||||: ::||:||| ::|::|||| Db 121 AAGGTGTTCAGATCCAGCGTGCTGCACTCTACCCAGGACCTGTTCCTGCCTTTCTTCAGC 180 Qy 181 AACGUCACGUGGUUCCACGCCAUCCACGUGUCCGGGACCAACGGCACCAAGCGGUUCGAC 240 ||||: || :||::||||||||:| ||| ||||| ||||||||| | ::|||| Db 181 AACGTGACCTGGTTCCACGCCATC------AGCGGCACCAATGGCACCAAGAGATTCGAC 234 Qy 241 AACCCGGUGCUGCCCUUCAACGACGGGGUCUACUUCGCGAGCACCGAGAAGUCCAACAUC 300 ||||| |:||:||||::|||||||||||: :||:: || ||||||||||||:||||||:| Db 235 AACCCCGTGCTGCCCTTCAACGACGGGGTGTACTTTGCCAGCACCGAGAAGTCCAACATC 294 Qy 301 AUCCGCGGCUGGAUCUUCGGGACGACCCUCGACAGCAAGACCCAGUCCCUGCUGAUCGUG 360 |:| | |||:|||:|::||| || || |: ||||||||||||||| ||:||:||:||:| Db 295 ATCAGAGGCTGGATCTTCGGCACCACACTGGACAGCAAGACCCAGAGCCTGCTGATCGTG 354 Qy 361 AACAACGCCACCAACGUGGUCAUCAAGGUGUGCGAGUUCCAGUUCUGCAACGACCCCUUC 420 ||||||||||||||||:||:||:||| |:|:|||||::||||::|:|||||||||||::| Db 355 AACAACGCCACCAACGTGGTCATCAAAGTGTGCGAGTTCCAGTTCTGCAACGACCCCTTC 414 Qy 421 CUCGGCGUGUACUACCACAAGAACAACAAGAGCUGGAUGGAGUCCGAGUUCCGGGUCUAC 480 |: ||||:| :||||||||||||||||||||:|||:||| ||||::|||||: :|| Db 415 CTGGGCGTG---TACCACAAGAACAACAAGAGCTGGATGGAAAGCGAGTTCCGGGTGTAC 471 Qy 481 AGCUCCGCCAACAACUGCACGUUCGAGUACGUGAGCCAGCCCUUCCUGAUGGACCUGGAG 540 ||| ||||||||||:|||| ::||||:|||:| |||||| ::||:||:|||||:||| Db 472 AGCAGCGCCAACAACTGCACCTTCGAGTACGTGTCCCAGCCTTTCCTGATGGACCTGGAA 531 Qy 541 GGCAAGCAGGGGAACUUCAAGAACCUCCGCGAGUUCGUGUUCAAGAACAUCGACGGCUAC 600 ||||||||||| |||::||||||||: ||||||::||:|::||||||||:|||||||:|| Db 532 GGCAAGCAGGGCAACTTCAAGAACCTGCGCGAGTTCGTGTTCAAGAACATCGACGGCTAC 591 Qy 601 UUCAAGAUCUACUCCAAGCACACCCCGAUCAACCUGGUCCGGGACCUGCCCCAGGGGUUC 660 ::||| |:|:|| |||||||||||| |:|||||: |: ||||| |:||| ||||| ::| Db 592 TTCAAAATCTACAGCAAGCACACCCCTATCAACCTCGTGCGGGATCTGCCTCAGGGCTTC 651 Qy 661 AGCGCCCUCGAGCCCCUGGUGGACCUGCCCAUCGGCAUCAACAUCACCCGCUUCCAGACC 720 || |: || ||||:||:||| |:|||||:|||||:|||||:|||||| :: ||||| Db 652 TCTGCTCTGGAACCCCTGGTGGATCTGCCCATCGGCATCAACATCACCCGGTTTCAGACA 711 Qy 721 CUCCUGGCCCUGCACCGGUCCUACCUCACGCCGGGGGACAGCAGCUCCGGCUGGACCGCG 780 |: |:|||||:|||| | |:|||: || || || || |||||| ||| :|||| || Db 712 CTGCTGGCCCTGCACAGAAGCTACCTGACACCTGGCGATAGCAGCAGCGGATGGACAGCT 771 Qy 781 GGCGCCGCCGCCUACUACGUGGGGUACCUGCAGCCCCGCACCUUCCUGCUCAAGUACAAC 840 || |||||||| :||:|||:||| :|||: ||||| | |||::||:||: |||:||||| Db 772 GGTGCCGCCGCTTACTACGTGGGATACCTCCAGCCTAGAACCTTCCTGCTGAAGTACAAC 831 Qy 841 GAGAACGGCACCAUCACGGACGCGGUCGACUGCGCCCUGGACCCCCUGAGCGAGACCAAG 900 |||||||||||||:||| ||||| |: || :| || |:|||||| |:||||||||| ||| Db 832 GAGAACGGCACCATCACCGACGCCGTGGATTGTGCTCTGGACCCTCTGAGCGAGACAAAG 891 Qy 901 UGCACCCUCAAGUCCUUCACCGUGGAGAAGGGGAUCUACCAGACGAGCAACUUCCGGGUG 960 :||||||: |||:||::|||||:||| ||||| |:|:||||||| ||||||::|||||:| Db 892 TGCACCCTGAAGTCCTTCACCGTGGAAAAGGGCATCTACCAGACCAGCAACTTCCGGGTG 951 Qy 961 CAGCCCACCGAGUCCAUCGUCCGCUUCCCGAACAUCACCAACCUGUGCCCCUUCGGCGAG 1020 ||||||||||| :|||:||: || ::||| || |:|||||| |:|:|||||::||||||| Db 952 CAGCCCACCGAATCCATCGTGCGGTTCCCCAATATCACCAATCTGTGCCCCTTCGGCGAG 1011 Qy 1021 GUGUUCAACGCCACCCGGUUCGCCAGCGUCUACGCCUGGAACCGCAAGCGGAUCUCCAAC 1080 |:|::||| |||||| | ::|||| |: :|||||:||||||| |||||||:| ||| Db 1012 GTGTTCAATGCCACCAGATTCGCCTCTGTGTACGCCTGGAACCGGAAGCGGATCAGCAAT 1071 Qy 1081 UGCGUGGCGGACUACAGCGUGCUGUACAACUCCGCCAGCUUCUCCACGUUCAAGUGCUAC 1140 :|||:||| |||:|| ||:||:|:|||||:||||||||::| ||| ::||||:||:|| Db 1072 TGCGTGGCCGACTACTCCGTGCTGTACAACTCCGCCAGCTTCAGCACCTTCAAGTGCTAC 1131 Qy 1141 GGCGUCAGCCCCACCAAGCUCAACGACCUGUGCUUCACCAACGUGUACGCCGACUCCUUC 1200 ||||: ||| |||||||: |||||||:|:||::||| ||||:|:|||||||| |::| Db 1132 GGCGTGTCCCCTACCAAGCTGAACGACCTGTGCTTCACAAACGTGTACGCCGACAGCTTC 1191 Qy 1201 GUGAUCCGCGGGGACGAGGUCCGGCAGAUCGCCCCCGGCCAGACCGGGAAGAUCGCCGAC 1260 |:||:||| || || || |: |||||||: ||||| || |||||||| || |:||||||| Db 1192 GTGATCCGGGGAGATGAAGTGCGGCAGATTGCCCCTGGACAGACCGGCAATATCGCCGAC 1251 Qy 1261 UACAACUACAAGCUGCCGGACGACUUCACGGGCUGCGUGAUCGCGUGGAACAGCAACAAC 1320 :|||||:||||||:||| ||||||::||| |||:| |:||: || :|||||||||||||| Db 1252 TACAACTACAAGCTGCCCGACGACTTCACCGGCTGTGTGATTGCCTGGAACAGCAACAAC 1311 Qy 1321 CUCGACUCCAAGGUCGGGGGCAACUACAACUACCUGUACCGCCUGUUCCGCAAGAGCAAC 1380 |: |||:|||| |:||| ||||||:|||| :|||:|:|||| |:|::||| ||| ||| Db 1312 CTGGACTCCAAAGTCGGCGGCAACTACAATTACCTGTACCGGCTGTTCCGGAAGTCCAAT 1371 Qy 1381 CUCAAGCCCUUCGAGCGGGACAUCUCCACCGAGAUCUACCAGGCCGGCAGCACCCCCUGC 1440 |: ||||||::|||||||||||:| |||||| |:|:| ||||||||||||||||| :|| Db 1372 CTGAAGCCCTTCGAGCGGGACATCAGCACCGAAATCTATCAGGCCGGCAGCACCCCTTGC 1431 Qy 1441 AACGGGGUGGAGGGCUUCAACUGCUACUUCCCCCUGCAGUCCUACGGGUUCCAGCCGACC 1500 || || |:| |||||:: |||:||:||::||| |:||| |:|||| ::|| ||| || Db 1432 AATGGCGTGAAGGGCTTTAACTGCTACTTCCCACTGCAAAGCTACGGCTTCCGGCCAACA 1491 Qy 1501 AACGGCGUGGGGUACCAGCCCUACCGGGUGGUCGUGCUGAGCUUCGAGCUCCUGCACGCC 1560 ||||||:||| :||||||| :|| | |:||: |:||:||||::|||||: |:||| || Db 1492 TACGGCGTGGGCTACCAGCCTTACAGAGTGGTGGTGCTGAGCTTCGAGCTGCTGCATGCT 1551 Qy 1561 CCCGCCACGGUGUGCGGCCCCAAGAAGUCCACCAACCUGGUCAAGAACAAGUGCGUGAAC 1620 || ||||| |:|:||||||| ||||| :||||||| |: |: |||||||| :|||: ||| Db 1552 CCTGCCACAGTGTGCGGCCCTAAGAAATCCACCAATCTCGTGAAGAACAAATGCGTCAAC 1611 Qy 1621 UUCAACUUCAACGGCCUCACCGGGACCGGCGUGCUGACCGAGAGCAACAAGAAGUUCCUG 1680 ::||| ::||||||||: ||||| |||||||:||:||| |||||||||||||||::||:| Db 1612 TTCAATTTCAACGGCCTGACCGGCACCGGCGTGCTGACAGAGAGCAACAAGAAGTTCCTG 1671 Qy 1681 CCGUUCCAGCAGUUCGGGCGCGACAUCGCCGACACGACCGACGCGGUCCGCGACCCCCAG 1740 || ::|||||||::||| || ||||: ||||| || || || || |:| | || |||||| Db 1672 CCATTCCAGCAGTTCGGCCGGGACATTGCCGATACCACAGATGCCGTCAGAGATCCCCAG 1731 Qy 1741 ACCCUGGAGAUCCUCGACAUCACCCCCUGCAGCUUCGGCGGGGUGUCCGUGAUCACGCCG 1800 || |:||| |:||: ||||:|||||| :|||||::|||||| |:|:| |:||:||| || Db 1732 ACACTGGAAATCCTGGACATCACCCCATGCAGCTTCGGCGGAGTGTCTGTGATCACCCCT 1791 Qy 1801 GGCACCAACACCAGCAACCAGGUCGCCGUGCUGUACCAGGGCGUGAACUGCACCGAGGUC 1860 ||||||||||||||||| ||||: || |:||:|:|||||||||: |||:| || ||||: Db 1792 GGCACCAACACCAGCAATCAGGTGGCAGTGCTGTACCAGGGCGTCAACTGTACAGAGGTG 1851 Qy 1861 CCCGUGGCCAUCCACGCCGACCAGCUGACGCCCACCUGGCGGGUGUACUCCACCGGCAGC 1920 || |:|||||: |||||||| ||||:||| || || :||||||:|:||:|||| |||||| Db 1852 CCAGTGGCCATTCACGCCGATCAGCTGACCCCTACTTGGCGGGTGTACTCCACAGGCAGC 1911 Qy 1921 AACGUCUUCCAGACCCGCGCCGGGUGCCUCAUCGGCGCGGAGCACGUGAACAACUCCUAC 1980 || |: :: |||||| | ||||| :| |: |:||| || |||||||:|||||| |:|| Db 1912 AATGTGTTTCAGACCAGAGCCGGCTGTCTGATCGGAGCCGAGCACGTGAACAATAGCTAC 1971 Qy 1981 GAGUGCGACAUCCCCAUCGGGGCCGGCAUCUGCGCCAGCUACCAGACGCAGACCAACUCC 2040 |||:||||||:|||||:||| || ||||:|:||||| :||||||| ||||||||| | Db 1972 GAGTGCGACATCCCCATCGGCGCTGGCATCTGCGCCTCTTACCAGACACAGACCAACAGC 2031 Qy 2041 CCGCGGCGCGCCCGGAGCGUGGCGUCCCAGAGCAUCAUCGCCUACACCAUGUCCCUGGGC 2100 | | || || | ||||:||| ||||||||:||: |||:|||| |:|:| |:|||| Db 2032 CACAGACGGGCTAGAAGCGTGGCCAGCCAGAGCATCATTGCCTACACAATGTCTCTGGGC 2091 Qy 2101 GCCGAGAACAGCGUCGCCUACUCCAACAACAGCAUCGCCAUCCCCACCAACUUCACGAUC 2160 |||||||||||||: |||:||:|||||||| |:||| |:||||||||| ::||| |:| Db 2092 GCCGAGAACAGCGTGGCCTACTCCAACAACTCTATCGCTATCCCCACCAATTTCACCATC 2151 Qy 2161 UCCGUGACCACCGAGAUCCUGCCCGUGAGCAUGACCAAGACGAGCGUCGACUGCACCAUG 2220 ||:|||||||||||:||:||| |:| ||:||||||||| ||||: |||:||||||:| Db 2152 AGCGTGACCACCGAGATCCTGCCTGTGTCCATGACCAAGACCAGCGTGGACTGCACCATG 2211 Qy 2221 UACAUCUGCGGGGACUCCACCGAGUGCAGCAACCUCCUGCUGCAGUACGGCUCCUUCUGC 2280 :|||:|:|||| || :||||||||:|| |||||: |:||: |||:||||| |::|:|| Db 2212 TACATCTGCGGCGATTCCACCGAGTGCTCCAACCTGCTGCTCCAGTACGGCAGCTTCTGC 2271 Qy 2281 ACCCAGCUCAACCGCGCGCUGACGGGGAUCGCCGUGGAGCAGGACAAGAACACCCAGGAG 2340 |||||||: || | || |:||| ||||:|||||:||| ||||||||||||||||| ||| Db 2272 ACCCAGCTGAATAGAGCCCTGACAGGGATCGCCGTGGAACAGGACAAGAACACCCAAGAG 2331 Qy 2341 GUGUUCGCCCAGGUCAAGCAGAUCUACAAGACGCCCCCGAUCAAGGACUUCGGCGGGUUC 2400 |:|::|||||| |: ||||| |:|:||||||| || || |:|||||||::|||||| ::| Db 2332 GTGTTCGCCCAAGTGAAGCAAATCTACAAGACCCCTCCTATCAAGGACTTCGGCGGCTTC 2391 Qy 2401 AACUUCAGCCAGAUCCUGCCCGACCCCUCCAAGCCCAGCAAGCGGUCCUUCAUCGAGGAC 2460 |||::||||||||: |:|||||| || |||||||||||||||| |::||:||||||| Db 2392 AACTTCAGCCAGATTCTGCCCGATCCTAGCAAGCCCAGCAAGCGGAGCTTCATCGAGGAC 2451 Qy 2461 CUCCUGUUCAACAAGGUGACCCUGGCCGACGCCGGCUUCAUCAAGCAGUACGGCGACUGC 2520 |: |:|::|||||| |:||| |:|||||||||||||::||:|||||||:||||||| :| Db 2452 CTGCTGTTCAACAAAGTGACACTGGCCGACGCCGGCTTCATCAAGCAGTACGGCGATTGT 2511 Qy 2521 CUCGGGGACAUCGCGGCCCGCGACCUGAUCUGCGCCCAGAAGUUCAACGGCCUGACCGUG 2580 |: || ||||: || ||| | || |:||:|:|||||||||||:: ||||| |:||| |:| Db 2512 CTGGGCGACATTGCAGCCAGGGATCTGATCTGCGCCCAGAAGTTTAACGGACTGACAGTG 2571 Qy 2581 CUCCCGCCCCUGCUGACCGACGAGAUGAUCGCCCAGUACACCAGCGCCCUCCUGGCGGGG 2640 |: || || |:||:|||||| ||||:||:|||||||:|||| ||||: |:||| || Db 2572 CTGCCTCCTCTGCTGACCGATGAGATGATCGCCCAGTACACATCTGCCCTGCTGGCCGGC 2631 Qy 2641 ACCAUCACGUCCGGCUGGACCUUCGGGGCCGGCGCCGCCCUGCAGAUCCCCUUCGCGAUG 2700 || |:||| ||||:|||| :: || || |||||||| |: ||||: || ::||| |:| Db 2632 ACAATCACAAGCGGCTGGACATTTGGAGCTGGCGCCGCTCTCCAGATTCCATTCGCTATG 2691 Qy 2701 CAGAUGGCCUACCGGUUCAACGGCAUCGGGGUCACCCAGAACGUGCUCUACGAGAACCAG 2760 ||||:||||:|| ||::||||||||:||| |: |||||||| |:||: :||||||||||| Db 2692 CAGATGGCCTACAGGTTCAACGGCATCGGAGTGACCCAGAATGTGCTGTACGAGAACCAG 2751 Qy 2761 AAGCUGAUCGCCAACCAGUUCAACAGCGCCAUCGGCAAGAUCCAGGACUCCCUGAGCUCC 2820 ||||:||:||||||||||::|||||||||||:||||||||:||||||| ||:|||| | Db 2752 AAGCTGATCGCCAACCAGTTCAACAGCGCCATCGGCAAGATCCAGGACAGCCTGAGCAGC 2811 Qy 2821 ACCGCCAGCGCGCUCGGGAAGCUGCAGGACGUGGUCAACCAGAACGCCCAGGCCCUGAAC 2880 || || ||||| |: || ||||: |||||||:||:||||||||| |||||||| |:|||| Db 2812 ACAGCAAGCGCCCTGGGAAAGCTCCAGGACGTGGTCAACCAGAATGCCCAGGCACTGAAC 2871 Qy 2881 ACGCUCGUGAAGCAGCUGUCCAGCAACUUCGGCGCCAUCUCCAGCGUGCUGAACGACAUC 2940 || |: |: |||||||:|:|| ||||::||||||||:|:| ||||:||:|||||| |:| Db 2872 ACCCTGGTCAAGCAGCTGTCCTCCAACTTCGGCGCCATCTCTAGCGTGCTGAACGATATC 2931 Qy 2941 CUCUCCCGCCUGGACCCGCCCGAGGCCGAGGUGCAGAUCGACCGGCUGAUCACCGGGCGC 3000 |: | | |:|||||| || ||||||||||:|||||:|||| | |:||:||| || || Db 2932 CTGAGCAGACTGGACCCACCTGAGGCCGAGGTGCAGATCGACAGACTGATCACAGGCCGG 2991 Qy 3001 CUCCAGAGCCUGCAGACCUACGUGACCCAGCAGCUGAUCCGGGCGGCCGAGAUCCGCGCC 3060 |:||||||||: ||||| :|||: || |||||||:||:| | || |||||||: | ||| Db 2992 CTCCAGAGCCTCCAGACATACGTTACACAGCAGCTGATCAGAGCCGCCGAGATTAGAGCC 3051 Qy 3061 AGCGCCAACCUCGCCGCGACCAAGAUGUCCGAGUGCGUCCUGGGCCAGAGCAAGCGGGUG 3120 ||||| |: ||||| |||||||:|:| |||:| |: |:||||||||||||| | |:| Db 3052 TCTGCCAATCTGGCCGCCACCAAGATGTCTGAGTGTGTGCTGGGCCAGAGCAAGAGAGTG 3111 Qy 3121 GACUUCUGCGGCAAGGGGUACCACCUGAUGUCCUUCCCCCAGAGCGCCCCGCACGGCGUG 3180 |||:: :|||||||||| :||||||:||:| |::||| ||| || || |||||||:| Db 3112 GACTTTTGCGGCAAGGGCTACCACCTGATGAGCTTCCCTCAGTCTGCACCACACGGCGTG 3171 Qy 3181 GUCUUCCUCCACGUGACGUACGUCCCCGCCCAGGAGAAGAACUUCACCACCGCCCCCGCG 3240 |: :: |: ||||:||| :|||: ||||| || |||||||||:: |||||||| || || Db 3172 GTGTTTCTGCACGTGACATACGTGCCCGCTCAAGAGAAGAACTTTACCACCGCTCCAGCC 3231 Qy 3241 AUCUGCCACGACGGGAAGGCCCACUUCCCCCGCGAGGGCGUGUUCGUGUCCAACGGGACC 3300 |:|:|||||||||| || ||||||:: || | || ||||:|::||:|:||||||| ||| Db 3232 ATCTGCCACGACGGCAAAGCCCACTTTCCTAGAGAAGGCGTGTTCGTGTCCAACGGCACC 3291 Qy 3301 CACUGGUUCGUCACGCAGCGGAACUUCUACGAGCCGCAGAUCAUCACCACCGACAACACC 3360 || :||::||: || |||||||||::|:||||||| ||||:||:|||||||||||||||| Db 3292 CATTGGTTCGTGACCCAGCGGAACTTCTACGAGCCCCAGATCATCACCACCGACAACACC 3351 Qy 3361 UUCGUGAGCGGCAACUGCGACGUGGUCAUCGGCAUCGUGAACAACACGGUGUACGACCCC 3420 ::||:| |||||||:||||||: |: |:|||||: |:|||||| || |:|:||||||| Db 3352 TTCGTGTCCGGCAACTGCGACGTCGTGATCGGCATTGTGAACAATACCGTGTACGACCCT 3411 Qy 3421 CUGCAGCCCGAGCUGGACUCCUUCAAGGAGGAGCUCGACAAGUACUUCAAGAACCACACC 3480 |: ||||| || |:||||:||::||| ||||| |: || |||:||:: ||||||||||| Db 3412 CTCCAGCCGGAACTGGACTCCTTCAAAGAGGAACTGGATAAGTACTTTAAGAACCACACA 3471 Qy 3481 AGCCCCGACGUCGACCUGGGGGACAUCUCCGGCAUCAACGCCAGCGUGGUGAACAUCCAG 3540 ||||||||||: ||||:||| || |:| ||| |:||| |||||||: |:|||||:|||| Db 3472 AGCCCCGACGTGGACCTGGGCGATATCAGCGGAATCAATGCCAGCGTCGTGAACATCCAG 3531 Qy 3541 AAGGAGAUCGACCGCCUGAACGAGGUCGCCAAGAACCUCAACGAGUCCCUGAUCGACCUG 3600 || ||||:|||||| |:||||||||: |||||||| |: |||||| ||:||:|||||:| Db 3532 AAAGAGATCGACCGGCTGAACGAGGTGGCCAAGAATCTGAACGAGAGCCTGATCGACCTG 3591 Qy 3601 CAGGAGCUCGGGAAGUACGAGCAGUACAUCAAGUGGCCGUGGUACAUCUGGCUGGGCUUC 3660 || || |: ||||||:||||||||:|||:||||:|||| :||:|||:|:|||:||||:: Db 3592 CAAGAACTGGGGAAGTACGAGCAGTACATCAAGTGGCCTTGGTACATCTGGCTGGGCTTT 3651 Qy 3661 AUCGCCGGCCUGAUCGCGAUCGUGAUGGUGACCAUCAUGCUCUGCUGCAUGACCAGCUGC 3720 |:|||||| |:||: || |:||:||:||: || |:||:||: :| :|||:|||||||:| Db 3652 ATCGCCGGACTGATTGCCATCGTGATGGTCACAATCATGCTGTGTTGCATGACCAGCTGT 3711 Qy 3721 UGCUCCUGCCUGAAGGGGUGCUGCAGCUGCGGCUCCUGCUGCAAGUUCGACGAGGACGAC 3780 :|| |:|||:|||||| :||:| |||:| |||:||:||:|||||::|||||||||||| Db 3712 TGCAGCTGCCTGAAGGGCTGCTGTAGCTGTGGCTCCTGCTGCAAGTTCGACGAGGACGAT 3771 Qy 3781 AGCGAGCCCGUCCUGAAGGGGGUGAAGCUCCACUACAC 3818 |||||||: |:|||||| |:||| |: |||:|||| Db 3772 TCTGAGCCCGTGCTGAAGGGCGTGAAACTGCACTACAC 3809 Claims 1, 6-8, 29, 32, 36, 44, 50, 56, 84, and 86 are rejected under 35 U.S.C. 102(a)(2) as being anticipated by Heeney et. al. (US20240285751A1; Priority 04/01/2020; hereafter “Heeney”.) The applied reference has a common assignee and at least one common inventor with the instant application. Based upon the earlier effectively filed date of the reference, it constitutes prior art under 35 U.S.C. 102(a)(2). This rejection under 35 U.S.C. 102(a)(2) might be overcome by: (1) a showing under 37 CFR 1.130(a) that the subject matter disclosed in the reference was obtained directly or indirectly from the inventor or a joint inventor of this application and is thus not prior art in accordance with 35 U.S.C. 102(b)(2)(A); (2) a showing under 37 CFR 1.130(b) of a prior public disclosure under 35 U.S.C. 102(b)(2)(B) if the same invention is not being claimed; or (3) a statement pursuant to 35 U.S.C. 102(b)(2)(C) establishing that, not later than the effective filing date of the claimed invention, the subject matter disclosed in the reference and the claimed invention were either owned by the same person or subject to an obligation of assignment to the same person or subject to a joint research agreement. The Prior Art Heeney teaches coronavirus polypeptide sequences, and teaches their use as vaccines against viruses of the coronavirus family, wherein the designed sequences include designed coronavirus spike (S) proteins and fragments thereof, including designed S protein receptor binding domain (RBD) sequence SEQ ID NO:17, and designed truncated S protein sequence SEQ ID NO:15. Heeney teaches nucleic acid molecules encoding the polypeptides, vectors, fusion proteins, pharmaceutical compositions, cells, and their use as vaccines against viruses of the coronavirus family (entire document; see abstract.) Heeney teaches SEQ ID NO: 53, which is 99.9% identical to SEQ ID NO:87 (See alignments in ABSS with App. 17/916,369; instant claims 1 and 29). Heeney teaches the S protein may have a Q498R mutation (¶[0227-0229]; instant claim 6), be deleted at 1255 at the C-terminus (SEQ ID NO: 1; ¶[0303][0583][0589][0608]; Example 2; instant claim 7), and/or comprise the 2P stabilizing mutations at 986 and 987 (K986P, V987P; ¶[0216][0219][0223][0928]; instant claim 8). Heeney teaches SEQ ID NO: 8, which is 95.7% identical to instant SEQ ID NO: 91 (see ABSS search results .rnpbm for 17916369; instant claim 32). Heeney teaches the nucleic acid molecule may be within a vector (¶[0355][0386-0450]; instant claim 36), such as a viral vaccine vector (¶[0437]; reference claim 200; instant claim 44), including MVA viral vectors (¶[0441]; instant claim 50). Heeney teaches pharmaceutical compositions which comprise the polypeptide, and include pharmaceutically acceptable carrier, excipient, or diluents (¶[0451-0525]; instant claim 56). Heeney teaches methods of inducing an immune response to a coronavirus in a subject, which comprises administering to the subject an effective amount of the S polypeptide, nucleic acid or vector encoding said polypeptide, or pharmaceutical compositions comprising said polypeptides, nucleic acids, or vectors (reference claim 217; instant claim 84). Said administration may be a heterologous prime-boost vaccination regimen (¶[0440]; instant claim 86). For at least these reasons, Heeney teaches the limitations of instant claims 1, 6-8, 29, 32, 36, 44, 50, 56, 84, and 86, and anticipates the invention encompassed by said claims. Claim Rejections - 35 USC § 103 In the event the determination of the status of the application as subject to AIA 35 U.S.C. 102 and 103 (or as subject to pre-AIA 35 U.S.C. 102 and 103) is incorrect, any correction of the statutory basis (i.e., changing from AIA to pre-AIA ) for the rejection will not be considered a new ground of rejection if the prior art relied upon, and the rationale supporting the rejection, would be the same under either status. The following is a quotation of 35 U.S.C. 103 which forms the basis for all obviousness rejections set forth in this Office action: A patent for a claimed invention may not be obtained, notwithstanding that the claimed invention is not identically disclosed as set forth in section 102, if the differences between the claimed invention and the prior art are such that the claimed invention as a whole would have been obvious before the effective filing date of the claimed invention to a person having ordinary skill in the art to which the claimed invention pertains. Patentability shall not be negated by the manner in which the invention was made. The factual inquiries for establishing a background for determining obviousness under 35 U.S.C. 103 are summarized as follows: 1. Determining the scope and contents of the prior art. 2. Ascertaining the differences between the prior art and the claims at issue. 3. Resolving the level of ordinary skill in the pertinent art. 4. Considering objective evidence present in the application indicating obviousness or nonobviousness. This application currently names joint inventors. In considering patentability of the claims the examiner presumes that the subject matter of the various claims was commonly owned as of the effective filing date of the claimed invention(s) absent any evidence to the contrary. Applicant is advised of the obligation under 37 CFR 1.56 to point out the inventor and effective filing dates of each claim that was not commonly owned as of the effective filing date of the later invention in order for the examiner to consider the applicability of 35 U.S.C. 102(b)(2)(C) for any potential 35 U.S.C. 102(a)(2) prior art against the later invention. Claims 50 and 87-88 are rejected under 35 U.S.C. 103 as being unpatentable over Roth as applied to claims 1, 6-8, 29, 32, 36, 44, 56, 77, 80-81, 84, 86, 92, and 95 above, and further in view of Garcia-Arriaza et. al. (WO2021260065A1; Priority 06/24/2020; hereafter “Garcia-Arriaza”.) The Prior Art The teachings of Roth have been set forth supra. While Roth teaches the SARS-CoV-2 polypeptides and nucleic acids of the instant claims, and teaches that said nucleic acids may be encoded by viral vectors, Roth is silent on said vectors being vaccinia viruses such as MVA. Additionally, while Roth teaches that heterologous prime/boost regimens can be used, Roth does not teach DNA prime/ MVA boost heterologous vaccination regimens. However, such limitations were known to a skilled artisan in the vaccine art, as evidenced by the teachings of Garcia-Arriaza. Garcia-Arriaza teaches recombinant modified vaccinia virus Ankara (MVA) vectors which carry one or more nucleic acid sequences encoding an antigenic protein of SARS-CoV-2 useful for vaccinating against COVID19, and vaccine compositions comprising said recombinant MVA, and methods of using said compositions to enhance T cell and humoral immune responses in a mammal against COVID19 (entire document; see abstract.) Garcia-Arriaza teaches the MVA vector comprises at least one nucleic acid encoding an antigenic structural spike (S) protein of at least one SARS-CoV-2 virus subtype (reference claim 1), wherein said S protein may comprise mutations such as D614G (“Materials and Methods: 1.4.2”; NB: In light of the 35 USC 112b rejection supra, the limitation of “SEQ ID NO: 98” in instant claim 50 is not under examination as it is not clear it is a required element of the claim; instant claim 50.) Garcia-Arriaza teaches homologous (MVA/MVA) and heterologous (DNA/MVA) prime/boost vaccination regimens using S antigens (Figs. 3-10; see figure legends; claims 87-88). Given the teachings by Roth, a skilled artisan would be apprised as to the numerous mutations in SARS-CoV-2 S protein variants, and would be apprised as to which variants would be useful in generating vaccine antigens against. Given the teachings of Garcia-Arriaza, one of skill in the art would be apprised also as to S protein variants, as well as specific types of viral vaccine vector systems suggested for delivery of said S protein antigens. Given the teachings of Garcia-Arriaza, one of skill in the art would find it obvious to try and deliver S protein via MVA vectors to a person in need thereof, especially in DNA prime/MVA boost vaccination regimens. Therefore, arriving at the limitations of instant claims 50 and 87-88 would be obvious to a skilled artisan, given the teachings of Roth and Garcia-Arriaza. It would have been obvious to one of ordinary skill in the art to modify the methods and compositions taught by Roth in order to use MVA as a vaccine vector, thereby generating a viral vector to efficiently deliver S protein nucleic acid to be encoded in the target host. One would have been motivated to do so, given the suggestion by Garcia-Arriaza that MVA vectors successfully encoded antigenic S protein that was especially useful in DNA prime/MVA boost vaccination regimens. There would have been a reasonable expectation of success, given the knowledge that Garcia-Arriaza provides the skills, teachings, and motivation to generate MVA vectors encoding S protein variants for vaccines. Thus, the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art at the time the invention was made. Claim 48 is rejected under 35 U.S.C. 103 as being unpatentable over Roth as applied to claims 1, 6-8, 29, 32, 36, 44, 56, 77, 80-81, 84, 86, 92, and 95 above, and further in view of Neckermann et. al. (Neckermann P, et. al. Front Immunol. 2021 Oct 28;12:761214.; hereafter “Neckermann”.) As noted supra, the earliest effective priority date for claim 48 is that of the ‘126 filing, 09/27/2022. The Prior Art The teachings of Roth have been set forth supra. While Roth teaches the SARS-CoV-2 polypeptides and nucleic acids of the instant claims, and teaches that said nucleic acids may be encoded by vectors, Roth is silent on said vectors being PURVac vectors. However, such limitations were known to a skilled artisan in the vaccine art, as evidenced by the teachings of Neckermann. Neckermann teaches the generation of DNA-based vaccine vectors against viral infection for testing in mice and non-human primates (NHP) (entire document; see abstract), wherein viral antigens in the study were cloned into pURVac, noted as a derivative of a DNA vaccine vector with a proven track record in various NHP and clinical trials (p. 3, left col., ¶1; p. 5, left col., ¶2 and right col., ¶5; Fig. 2). Neckermann teaches the pURVac vector comprising the viral antigens was able to express said antigens correctly and that said antigens were immunogenic in vivo (Figs. 2-3). Given the teachings by Roth, a skilled artisan would be apprised as to the numerous mutations in SARS-CoV-2 S protein variants, and would be motivated to utilize expression platforms, such as vectors and plasmids, for expression of said variants for diagnostic and vaccine purposes. Given the teachings of Neckermann, one of skill in the art would be apprised to DNA based vaccine vectors with proven immunogenicity in multiple animal modes, such as pURVac, which would be useful for delivery of S protein antigens. Given the teachings of Neckermann, one of skill in the art would find it obvious to try and deliver S protein via pURVac vectors to a person in need thereof, especially given their noted track record of safety and usefulness in the most relevant human animal model, NHP. Therefore, arriving at the limitations of instant claim 48 would be obvious to a skilled artisan, given the teachings of Roth and Neckermann. It would have been obvious to one of ordinary skill in the art to modify the methods and compositions taught by Roth in order to use pURVac as a vaccine vector, thereby generating a DNA vector to efficiently deliver S protein nucleic acid to be encoded in the target host. One would have been motivated to do so, given the suggestion by Neckermann that pURVac vectors successfully encoded antigenic viral proteins that were especially useful in DNA vaccination regimens in mice and NHP. There would have been a reasonable expectation of success, given the knowledge that Neckermann provides the skills, teachings, and motivation to generate pURVac vectors encoding viral proteins for vaccines. Thus, the invention as a whole was clearly prima facie obvious to one of ordinary skill in the art at the time the invention was made. Conclusion No claims are allowed. The prior art made of record and not relied upon is considered pertinent to applicant's disclosure and is listed below. US20240100151A1. Teaches SARS-CoV-2 S protein mRNA vaccines with the variant amino acids as instantly claimed. Not utilized as rejection would be redundant to those set forth supra. US20230218743A1. Teaches SARS-CoV-2 S protein vaccines with the variant amino acids as instantly claimed. Not utilized as rejection would be redundant to those set forth supra. US20240321387A1. Teaches how to identify SARS-CoV-2 S protein VOCs and selection of immunogens for vaccines with the variant amino acids as instantly claimed. Not utilized as rejection would be redundant to those set forth supra. Any inquiry concerning this communication or earlier communications from the examiner should be directed to RACHEL B GILL whose telephone number is (571)272-3129. The examiner can normally be reached on M to F 8:00 AM to 5:00 PM Eastern. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, MICHAEL ALLEN can be reached on 571-270-3497. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /RACHEL B GILL/ Primary Examiner, Art Unit 1671
Read full office action

Prosecution Timeline

Apr 05, 2024
Application Filed
Jul 09, 2026
Non-Final Rejection mailed — §101, §102, §103 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12655447
COMPOSITIONS AND METHODS FOR THE TREATMENT OF SKIN DISEASES
5y 2m to grant Granted Jun 16, 2026
Patent 12622960
VARICELLA ZOSTER VIRUS (VZV) VACCINE
2y 3m to grant Granted May 12, 2026
Patent 12618839
NOVEL ANTIBODIES FOR DETECTING EPSTEIN BARR VIRUS-POSITIVE GASTRIC CANCER
4y 0m to grant Granted May 05, 2026
Patent 12611454
RECOMBINANT VACCINE AGAINST COVID-19 BASED ON A PARAMYXOVIRUS VIRAL VECTOR
3y 5m to grant Granted Apr 28, 2026
Patent 12605454
MODIFIED VIRUS-LIKE PARTICLES OF CMV
4y 0m to grant Granted Apr 21, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
66%
Grant Probability
94%
With Interview (+28.0%)
2y 5m (~2m remaining)
Median Time to Grant
Low
PTA Risk
Based on 859 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month