TRANSGENIC MAIZE EVENT LP026-2 AND DETECTION METHOD THEREFOR

DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Status of claims Applicant’s response filed 9/9/2026 has been entered. The specification has been amended. Claims 5-12, 14, 20 have been canceled. Claims 1-2, 4, 13, 15-19 have been amended, including canceling the non-elected species. In summary, claims 1-4, 13, 15-19 are pending and examined in this office action. All previous objections and rejections not set forth below have been withdrawn in view of the applicant’s amendment and/or upon further consideration. See “Response to Arguments” at the end of office action. The following rejections are repeated, modified and/or added for the reasons of record as set forth in the last Office action of 6/10/2026, and/or necessitated by the applicant’s amendments. The applicant’s arguments filed 9/9/2026 have been thoroughly considered but are not deemed fully persuasive. Claim Objections Claims 1-4, 13, 15-19 are objected because of the following informalities: The amended claims have greyish underlined prints, which are hard to read. Claims 13, 15 and 19 are objected because of the following informalities. The following suggestions are made to correct such informalities: In claim 13, lines 3-4, the “according to claim 4” is suggested to be changed to --- of ---. In claim 15, line 2, the “according to claim 4” is suggested to be changed to --- of ---. Claim 19 is suggested to be changed to --- A method for cultivating maize plants with insect resistance and/or tolerance to glyphosate herbicide, characterized by comprising: growing at least one maize seed comprising a nucleic acid sequence of transgenic maize event LP026-2 wherein the representative sample of the seeds has been deposited under CCTCC deposit NO: P202207; growing and developing the maize seed into a maize plant; infecting the maize plant with a target insect and/or spraying the maize plant with an effective dose of glyphosate herbicide; and harvesting the plants with reduced plant damage as compared to other plants without the transgenic maize event LP026-2. See the requirement of 37 CFR 1.71(a) for “full, clear, and exact terms”. Appropriate corrections are required. Claim Rejections - 35 USC § 112 Enablement/Deposit The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claims 2, 4, 13, 15, 17, 19 is rejected under 35 U.S.C. 112(a), as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. Claims recite that the representative sample of the seeds comprising the transgenic maize event LPO26-2 has been deposited under deposit number China Center for Type Culture Collection CCTCC NO: P202207. Event LPO26-2 appears to be a new event, and the plant and seeds comprising the event appear to be new. The examiner noticed that in the amended (9/9/2026) specification ([0008]): “To achieve the above objectives, a nucleic acid sequence, which contains one or more selected from the sequences consisting of SEQ ID NOs:1-7 (i.e. SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7) and the complementary sequences thereof, is provided by the present invention. In some embodiments, the nucleic acid sequence is derived from plants, seeds or cells containing the maize event LP026-2, and the representative sample of the seeds containing the event was deposited at the China Center for Type Culture Collection (CCTCC for short, Address: Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, Postcode: 430072) on April 15th, 2022= under the CCTCC deposit NO: P202207. In some embodiments, the nucleic acid sequence is an amplicon for diagnosing the maize event LP026-2”. However, according to MPEP 2404.01, “The mere reference to a deposit or the biological material itself in any document or publication does not necessarily mean that the deposited biological material is readily available. Even a deposit made under the Budapest Treaty and referenced in a United States or foreign patent document would not necessarily meet the test for known and readily available unless the deposit was made under conditions that are consistent with those specified in these rules, including the provision that requires, with one possible exception (37 CFR 1.808(b)), that all restrictions on the accessibility be irrevocably removed by the applicant upon the granting of the patent. Ex parte Hildebrand, 15 USPQ2d 1662 (Bd. Pat. App. & Int. 1990).” In this case there is no affirmation that the deposit meets all of the requirements of 37 CFR 1.801-1.809. The examiner noticed that the deposit receipt was filed 9/9/2026 as “miscellaneous incoming letter”, and a declaration by Zhiwei Jia was filed 9/9/2026 as “miscellaneous incoming letter” stating that “The inventor, Zhiwei JIA, on behalf of the applicant LONGPING BIOTECH (HAINAN) CO., LTD., hereby declares that the bacterial material (the seeds comprising the transgenic maize event LP026-2), deposit number: CCTCC NO.P202207) deposited under the Budapest Treaty in the present application will be publicly available during pendency of the patent application and all restrictions imposed by the depositor on the availability to the public irrevocably removed upon the granting of the patent”. However, the “deposit meets all of the requirements of 37 CFR 1.801-1.809” statement is missing in the specification and in the declaration”. In addition, the above paragraph [0008] of the specification is not properly formatted as “Deposit” information. See details in the “Response to Arguments” at the end of office action. Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Amended Claim 16 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. Claim 16 recites a method for protecting maize plant from insects, wherein the transgenic maize plant-comprises the sequence of SEQ ID NO:5 in its genome; a target insect that has ingested transgenic maize plant cells is inhibited from further ingesting the maize plant. The claim is incomplete for omitting essential steps, essential elements, and/or essential structural cooperative relationships of elements. The omitted steps are: there is no step(s) recited. In fact, the claim does not comprise a main body, only preamble and wherein clauses, which do not sufficiently stand alone. Moreover, there is insufficient antecedent basis in the preamble for the wherein clause of “wherein the transgenic maize plant-comprises the sequence of SEQ ID NO:5 in its genome”. The preamble recites “protecting maize plant from insect”. Appropriate correction and clarification are required for one skill in the art to know the metes and bounds to carry out the invention as claimed. Remarks According to the specification ([0044], Table 2), SEQ ID NO: 5 is the full-length sequence of the transgenic maize event LP026-2. SEQ ID NOs: 1-4, 6-7 are specific regions of the event LP026-2. By the examiner’s search and alignments, SEQ ID NOs: 1-4, 6-7 are fragments of SEQ ID NO: 5. Prior art does not teach or suggest full length sequences of SEQ ID NOs: 1-7, or the full complement sequences thereof. Prior art discloses partial sequences of SEQ NO: 5, and partial sequences of SEQ ID NOs: 1-7, but does not teach or suggest that the sequence(s) serving as pairs of primers, or any sequence(s) hybridizing event LP026-2 but not hybridizing any maize not comprising event LP026-2, not to mention as primers, probes, markers or kits. Therefore, the applicant invented maize event LP026-2 comprising full-length sequence of SEQ ID NO: 5. Closest Sequence Matches Against Instant SEQ ID NO:5 RESULT 1 CG342774 LOCUS CG342774 965 bp DNA linear GSS 26-AUG-2003 DEFINITION OGYBG89TV ZM_0.7_1.5_KB Zea mays genomic clone ZMMBMa0640O09, genomic survey sequence. ACCESSION CG342774 VERSION CG342774.1 DBLINK BioSample: SAMN00182289 KEYWORDS GSS. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. REFERENCE 1 (bases 1 to 965) AUTHORS Whitelaw,C.A., Quackenbush,J., Van Aken,S., Utterback,T., Resnick,A., Fraser,C.M., Budiman,M.A., Bedell,J.A., Rohlfing,T., Citek,R.W., Nunberg,A., Robbins,D. and Lakey,N. TITLE Consortium for Maize Genomics JOURNAL Unpublished COMMENT Other_GSSs: OGYBG89TH Contact: Cathy Whitelaw TIGR 9712 Medical Center Drive, Rockville, MD 20850, USA Tel: 301-838-5843 Fax: 301-838-0208 Email: whitelaw\@tigr.org Seq primer: TF Class: methylation filtered. FEATURES Location/Qualifiers source 1..965 /organism="Zea mays" /mol_type="genomic DNA" /strain="B73" /db_xref="taxon:4577" /clone="ZMMBMa0640O09" /clone_lib="SAMN00182289 ZM_0.7_1.5_KB" /note="Vector: pBCSK-; Site_1: HincII; 0.7-1.5 kb methylation filtered genomic DNA library" ORIGIN Query Match 5.5%; Score 965; Length 965; Best Local Similarity 100.0%; Matches 965; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 8720 AGAGCCATCCCAGGATTCCCCAAAGAGAAACACTGGCAAGTTAGCAATCAGAACGTGTCT 8779 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 AGAGCCATCCCAGGATTCCCCAAAGAGAAACACTGGCAAGTTAGCAATCAGAACGTGTCT 60 Qy 8780 GACGTACAGGTCGCATCCGTGTACGAACGCTAGCAGCACGGATCTAACACAAACACGGAT 8839 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GACGTACAGGTCGCATCCGTGTACGAACGCTAGCAGCACGGATCTAACACAAACACGGAT 120 Qy 8840 CTAACACAAACATGAACAGAAGTAGAACTACCGGGCCCTAACCATGGACCGGAACGCCGA 8899 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTAACACAAACATGAACAGAAGTAGAACTACCGGGCCCTAACCATGGACCGGAACGCCGA 180 Qy 8900 TCTAGAGAAGGTAGAGAGGGGGGGGGGGGGAGGACGAGCGGCGTACCTTGAAGCGGAGGT 8959 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TCTAGAGAAGGTAGAGAGGGGGGGGGGGGGAGGACGAGCGGCGTACCTTGAAGCGGAGGT 240 Qy 8960 GCCGACGGGTGGATTTGGGGGAGATCTGGTTGTGTGTGTGTGCGCTCCGAACAACACGAG 9019 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GCCGACGGGTGGATTTGGGGGAGATCTGGTTGTGTGTGTGTGCGCTCCGAACAACACGAG 300 Qy 9020 GTTGGGGAAAGAGGGTGTGGAGGGGGTGTCTATTTATTACGGCGGGCGAGGAAGGGAAAG 9079 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GTTGGGGAAAGAGGGTGTGGAGGGGGTGTCTATTTATTACGGCGGGCGAGGAAGGGAAAG 360 Qy 9080 CGAAGGAGCGGTGGGAAAGGAATCCCCCGTAGCTGCCGGTGCCGTGAGAGGAGGAGGAGG 9139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CGAAGGAGCGGTGGGAAAGGAATCCCCCGTAGCTGCCGGTGCCGTGAGAGGAGGAGGAGG 420 Qy 9140 CCGCCTGCCGTGCCGGCTCACGTCTGCCGCTCCGCCACGCAATTTCTGGATGCCGACAGC 9199 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CCGCCTGCCGTGCCGGCTCACGTCTGCCGCTCCGCCACGCAATTTCTGGATGCCGACAGC 480 Qy 9200 GGAGCAAGTCCAACGGTGGAGCGGAACTCTCGAGAGGGGTCCAGAGGCAGCGACAGAGAT 9259 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GGAGCAAGTCCAACGGTGGAGCGGAACTCTCGAGAGGGGTCCAGAGGCAGCGACAGAGAT 540 Qy 9260 GCCGTGCCGTCTGCTTCGCTTGGCCCGACGCGACGCTGCTGGTTCGCTGGTTGGTGTCCG 9319 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GCCGTGCCGTCTGCTTCGCTTGGCCCGACGCGACGCTGCTGGTTCGCTGGTTGGTGTCCG 600 Qy 9320 TTAGACTCGTCGACGGCGTTTAACAGGCTGGCATTATCTACTCGAAACAAGAAAAATGTT 9379 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TTAGACTCGTCGACGGCGTTTAACAGGCTGGCATTATCTACTCGAAACAAGAAAAATGTT 660 Qy 9380 TCCTTAGTTTTTTTAATTTCTTAAAGGGTATTTGTTTAATTTTTAGTCACTTTATTTTAT 9439 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 TCCTTAGTTTTTTTAATTTCTTAAAGGGTATTTGTTTAATTTTTAGTCACTTTATTTTAT 720 Qy 9440 TCTATTTTATATCTAAATTATTAAATAAAAAAACTAAAATAGAGTTTTAGTTTTCTTAAT 9499 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 TCTATTTTATATCTAAATTATTAAATAAAAAAACTAAAATAGAGTTTTAGTTTTCTTAAT 780 Qy 9500 TTAGAGGCTAAAATAGAATAAAATAGATGTACTAAAAAAATTAGTCTATAAAAACCATTA 9559 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TTAGAGGCTAAAATAGAATAAAATAGATGTACTAAAAAAATTAGTCTATAAAAACCATTA 840 Qy 9560 ACCCTAAACCCTAAATGGATGTACTAATAAAATGGATGAAGTATTATATAGGTGAAGCTA 9619 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 ACCCTAAACCCTAAATGGATGTACTAATAAAATGGATGAAGTATTATATAGGTGAAGCTA 900 Qy 9620 TTTGCAAAAAAAAAGGAGAACACATGCACACTAAAAAGATAAAACTGTAGAGTCCTGTTG 9679 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 TTTGCAAAAAAAAAGGAGAACACATGCACACTAAAAAGATAAAACTGTAGAGTCCTGTTG 960 Qy 9680 TCAAA 9684 ||||| Db 961 TCAAA 965 Against Instant SEQ ID NO:1 RESULT 23 AM969402 LOCUS AM969402 471 bp mRNA linear EST 03-MAY-2011 DEFINITION AM969402 cDN09 Sparus aurata cDNA clone cDN09P0006A23 5', mRNA sequence. ACCESSION AM969402 VERSION AM969402.1 DBLINK BioSample: SAMN00165828 KEYWORDS EST. SOURCE Sparus aurata (gilthead seabream) ORGANISM Sparus aurata Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Eupercaria; Spariformes; Sparidae; Sparus. REFERENCE 1 (bases 1 to 471) AUTHORS Louro,B., Passos,A.L.S., Souche,E.L., Tsigenopoulos,C., Beck,A., Lagnel,J., Bonhomme,F., Cancela,L., Cerd,J., Clark,M.S., Lubzens,E., Magoulas,A., Planas,J.V., Volckaert,F.A.M., Reinhardt,R. and Canario,A.V.M. TITLE Gilthead sea bream (Sparus auratus) and European sea bass (Dicentrarchus labrax) expressed sequence tags: Characterization, tissue-specific expression and gene markers JOURNAL Mar Genomics 3 (3-4), 179-191 (2010) COMMENT Contact: Beck A proScience MPI for Molecular Genetics Ihnestrasse 73, D-14195 Berlin, GERMANY Total RNA was extracted from 9 specimens of both sex (4 females and 5 males) and weight range 350 g to 4kg. Collected tissue frozen in liq N2 and stored at -80C prior to RNA extraction. mRNA purification and concentration were performed using the Dynal's oligo-dT magnetic beads. Library construction was performed with Creator SMART cDNA library construction kit (Clontech) and the thermostable duplex-specific nuclease (Zhu et al., 2001). Initial LD PCR amplification of 22 cycles for enrichment of full length transcripts was verified on Agarose gels. cDNA sizes (>500 base pairs) were selected using filter columns based on agarose gels as described in the Clontech manual. Library construction and sequencing were performed at the MPI of Molecular Genetics Berlin. FEATURES Location/Qualifiers source 1..471 /organism="Sparus aurata" /mol_type="mRNA" /db_xref="taxon:8175" /clone="cDN09P0006A23" /sex="mixed" /tissue_type="trunk kidney" /clone_lib="SAMN00165828 cDN09" /dev_stage="adult" /note="Total RNA was extracted from 9 specimens of both sex (4 females and 5 males) and weight range 350 g to 4kg. Collected tissue frozen in liq N2 and stored at -80C prior to RNA extraction. mRNA purification and concentration were performed using the Dynal's oligo-dT magnetic beads. Library construction was performed with Creator SMART cDNA library construction kit (Clontech) and the thermostable duplex-specific nuclease (Zhu et al., 2001). Initial LD PCR amplification of 22 cycles for enrichment of full length transcripts was verified on Agarose gels. cDNA sizes (>500 base pairs) were selected using filter columns based on agarose gels as described in the Clontech manual. Library construction and sequencing were performed at the MPI of Molecular Genetics Berlin. isolation_source: aquaculture fish. collection_date: 10-Oct-2004. collected_by: Juan Fuentes and Carla Viegas" ORIGIN Query Match 81.8%; Score 18; Length 471; Best Local Similarity 100.0%; Matches 18; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CATCGAATGCCTCAAACA 18 |||||||||||||||||| Db 186 CATCGAATGCCTCAAACA 203 Against Instant SEQ ID NO:2 RESULT 4 EL901765/c LOCUS EL901765 831 bp mRNA linear EST 20-MAR-2007 DEFINITION CGF2003438_C08 WRO-02: Walnut root Juglans hindsii x Juglans regia cDNA clone WRO-02-5_I_C08 5', mRNA sequence. ACCESSION EL901765 VERSION EL901765.1 DBLINK BioSample: SAMN00152718 KEYWORDS EST. SOURCE Juglans hindsii x Juglans regia ORGANISM Juglans hindsii x Juglans regia Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Fagales; Juglandaceae; Juglans. REFERENCE 1 (bases 1 to 831) AUTHORS Britton,M., Leslie,C., McGranahan,G. and Dandekar,A. TITLE Analysis of genes expressed in nematode-infected walnut plants JOURNAL Unpublished COMMENT Contact: Abhaya Dandekar, PhD CAES Genome Facility UC Davis, Department of Pomology One Shields Ave, Davis, CA 95616, USA Tel: 530 752 7784 Fax: 530 752 8502 Email: amdandekar\@ucdavis.edu Seq primer: DNR-F2 ACGGTACCGGACATATG. FEATURES Location/Qualifiers source 1..831 /organism="Juglans hindsii x Juglans regia" /mol_type="mRNA" /cultivar="Paradox clone 'PX1'" /db_xref="taxon:432290" /clone="WRO-02-5_I_C08" /clone_lib="SAMN00152718 WRO-02: Walnut root" /dev_stage="Small greenhouse plants" /lab_host="E. coli DH10-Beta" /note="Organ: Root; Vector: pDNR-LIB; Site_1: SfiIA; Site_2: SfiIB; Five micropropagated plants of the walnut Paradox clone PX1 were grown in the greenhouse. On May 19, 2006 the roots of these plants were harvested, frozen in liquid nitrogen and stored at -80C. RNA was isolated from individual plants using the hot borate method. Total RNA was purified (Qiagen RNA/DNA Mini Kit) from each plant, pooled and used to construct a cDNA library (CLONTECH Creator SMART cDNA Library kit). Ligated plasmids were electroporated into E. coli DH10-Beta (Invitrogen). Individual colonies were picked and sequenced using plasmid primers to obtain 5' ESTs (UC Davis CA&ES Core Genomics Facility)." ORIGIN Query Match 86.4%; Score 19; Length 831; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 TTACACCACAAGCAATTCT 20 ||||||||||||||||||| Db 775 TTACACCACAAGCAATTCT 757 Against Instant SEQ ID NO:3 RESULT 2 BZ320063 LOCUS BZ320063 601 bp DNA linear GSS 06-NOV-2002 DEFINITION hz03b11.g1 WGS-ZmaysF (JM107 adapted methyl filtered) Zea mays genomic clone hz03b11 5', genomic survey sequence. ACCESSION BZ320063 VERSION BZ320063.1 DBLINK BioSample: SAMN00182102 KEYWORDS GSS. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. REFERENCE 1 (bases 1 to 601) AUTHORS Rabinowicz,P.D., O'Shaughnessy,A.L., Balija,V., Dedhia,N., Katzenburger,F., King,L., Miller,B., Muller,S., Nascimento,L., Zutavern,T., McCombie,W.R. and Martienssen,R.A. TITLE Genomic shotgun sequences from Zea mays (methyl-filtered) JOURNAL Unpublished COMMENT Contact: W. Richard McCombie Lita Annenberg Hazen Genome Sequencing Center Cold Spring Harbor Laboratory PO Box 100, Cold Spring Harbor, NY 11724, USA Tel: 516 367 8884 Fax: 516 367 8874 Email: mccombie\@cshl.org Plate: hz03 row: b column: 11 Seq primer: -21M13UnivRev Class: shotgun. FEATURES Location/Qualifiers source 1..601 /organism="Zea mays" /mol_type="genomic DNA" /cultivar="B73" /db_xref="taxon:4577" /clone="hz03b11" /clone_lib="SAMN00182102 WGS-ZmaysF (JM107 adapted methyl filtered)" /lab_host="JM107 or DH5a" /note="Organ: immature ears; Site_1: Xba I; Site_2: Xba I; The vector was digested with XbaI and one nucleotide was added by fill in in the recessive 3' end. The genomic DNA was nebulized, end repaired, adaptor ligated and size fractionated using sephadex. The resulting fragments were between 0.8 and 3 kb and were cloned into the vector (.x/y reads in M13mp19, .b/g reads in pUC19). The same ligation was transformed in either JM107 or DH5a." ORIGIN Query Match 36.6%; Score 547; Length 601; Best Local Similarity 100.0%; Matches 547; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCAGCTATCTTCGGATGGACGGATGTAATCAATCAAAAAGTCTTAGGTTGAGATCTTTAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 55 GCAGCTATCTTCGGATGGACGGATGTAATCAATCAAAAAGTCTTAGGTTGAGATCTTTAA 114 Qy 61 GGATGAGGCCATTAGCCCTTTTCATCTGATCAGTTCTTTGAGAGTGTGCAACCGAGGCAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 115 GGATGAGGCCATTAGCCCTTTTCATCTGATCAGTTCTTTGAGAGTGTGCAACCGAGGCAA 174 Qy 121 AATGCATAATAATTCCACATTCGGTGCAAAAATTCATGAACTTTTTAGAAAGTGAACTGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 175 AATGCATAATAATTCCACATTCGGTGCAAAAATTCATGAACTTTTTAGAAAGTGAACTGG 234 Qy 181 CTTCCATTATCAGTTATGGTGGTTCTCGGCACACCGAACTGATTGAAGATCTCTTTCGTG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 235 CTTCCATTATCAGTTATGGTGGTTCTCGGCACACCGAACTGATTGAAGATCTCTTTCGTG 294 Qy 241 AATTCCACTACTTTGGTTGATAAGATCTTGGCTACAAGCTTAGCCTCGACCCACTTTGTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 295 AATTCCACTACTTTGGTTGATAAGATCTTGGCTACAAGCTTAGCCTCGACCCACTTTGTC 354 Qy 301 AACTTATCAACGATCACAAAGAGATACGTGACTTCGCCCTTCACCGGTTTGAATGATCCA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 355 AACTTATCAACGATCACAAAGAGATACGTGACTTCGCCCTTCACCGGTTTGAATGATCCA 414 Qy 361 ATAATGTCTAGGCACCAAGTGGAGAATTGATAGGTGATAGGGATAGTCTAAAGTTGTGTA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 415 ATAATGTCTAGGCACCAAGTGGAGAATTGATAGGTGATAGGGATAGTCTAAAGTTGTGTA 474 Qy 421 GCTAGCATATGAGCCTGGTGTGAAAAACATTAGCACCCCTTGCATGTGCGTACGAGTTGT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 475 GCTAGCATATGAGCCTGGTGTGAAAAACATTAGCACCCCTTGCATGTGCGTACGAGTTGT 534 Qy 481 TTGGCGTCAGTTACTATTGTTGATCAGAAAAACCTGCTGATAAGCTTTCGCCACTAACGT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 535 TTGGCGTCAGTTACTATTGTTGATCAGAAAAACCTGCTGATAAGCTTTCGCCACTAACGT 594 Qy 541 TTTGGTG 547 ||||||| Db 595 TTTGGTG 601 Against Instant SEQ ID NO:4 RESULT 1 DX827727/c LOCUS DX827727 834 bp DNA linear GSS 06-FEB-2009 DEFINITION ZMMBLb0006H10.f ZMMBLb Zea mays genomic clone ZMMBLb0006H10 5', genomic survey sequence. ACCESSION DX827727 VERSION DX827727.1 DBLINK BioSample: SAMN00188269 KEYWORDS GSS. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. REFERENCE 1 (bases 1 to 834) AUTHORS Nelson,W., Luo,M., Ma,J., Estep,M., Estill,J., He,R., Talag,J., Sisneros,N., Kudrna,D., Kim,H., Ammiraju,J.S., Collura,K., Bharti,A.K., Messing,J., Wing,R.A., SanMiguel,P., Bennetzen,J.L. and Soderlund,C. TITLE Methylation-sensitive linking libraries enhance gene-enriched sequencing of complex genomes and map DNA methylation domains JOURNAL BMC Genomics 9, 621 (2008) PUBMED 19099592 COMMENT Contact: Soderlund C Department of Plant Sciences University of Arizona 303 Forbes, Tucson, AZ 85721, uSA Email: cari\@agcol.arizona.edu Class: BAC ends. FEATURES Location/Qualifiers source 1..834 /organism="Zea mays" /mol_type="genomic DNA" /cultivar="B73" /db_xref="taxon:4577" /clone="ZMMBLb0006H10" /tissue_type="immature ears" /clone_lib="SAMN00188269 ZMMBLb" /lab_host="DH10B T1 phage resistant" /note="Vector: pAGIBAC1; Site_1: Hpa II; Site_2: Hpa II; Methyl Spanning Linker Library (HpaII, BAC)" ORIGIN Query Match 57.2%; Score 337.4; Length 834; Best Local Similarity 92.0%; Matches 356; Conservative 0; Mismatches 31; Indels 0; Gaps 0; Qy 204 TATCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAAGCAATTCT 263 || |||| | || | || || | | || | | ||||||||| Db 543 TACTAGCAACGAGTCACCTAGAACTCGGACCCATCGAATGCCCAGAGTGATAGCAATTCT 484 Qy 264 TAAGCTGAGCAACATGGCCTCATACTGAGCAATATTATTGGTTGTAGGAAAGTGTATTTG 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 483 TAAGCTGAGCAACATGGCCTCATACTGAGCAATATTATTGGTTGTAGGAAAGTGTATTTG 424 Qy 324 TAGTATGTACCTGAATTTCTCACCTTTTGGTGAAGTAACAACAACTCACGCTCTTGCTCC 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 423 TAGTATGTACCTGAATTTCTCACCTTTTGGTGAAGTAACAACAACTCACGCTCTTGCTCC 364 Qy 384 ACTAAGCTATAAAGGTCCATCAAATTTGACTGTCCAGTGATCAAGGGGCTTCATTTCGAT 443 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 363 ACTAAGCTATAAAGGTCCATCAAATTTGACTGTCCAGTGATCAAGGGGCTTCATTTCGAT 304 Qy 444 TAGGACGTGTATCTCGGTCAACTTTGCAACAAAATCACTAAGAGTCTTGGCCTTGATCAC 503 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 303 TAGGACGTGTATCTCGGTCAACTTTGCAACAAAATCACTAAGAGTCTTGGCCTTGATCAC 244 Qy 504 CATACGAGGTTTGAATATAATGTCATATACTCCTAGCTCAATAGCACACTTGGCAACTCA 563 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 243 CATACGAGGTTTGAATATAATGTCATATACTCCTAGCTCAATAGCACACTTGGCAACTCA 184 Qy 564 GGCTGTAACATATTTCTTGTGCAGTAC 590 ||||||||||||||||||||||||||| Db 183 GGCTGTAACATATTTCTTGTGCAGTAC 157 Against Instant SEQ ID NO:6 RESULT 1 LN486195 LOCUS LN486195 506 bp DNA linear GSS 15-SEP-2014 DEFINITION Arabidopsis thaliana T-DNA flanking sequence GK-SALK_040252c-116547-CG26, genomic survey sequence. ACCESSION LN486195 VERSION LN486195.1 KEYWORDS GSS; genome survey sequence. SOURCE Arabidopsis thaliana (thale cress) ORGANISM Arabidopsis thaliana Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis. REFERENCE 1 AUTHORS Huep,G., Kleinboelting,N., Appelhagen,I., Viehoever,P. and Weisshaar,B. TITLE Analysis of structural features of Agrobacterium tumefaciens mediated T-DNA insertions in Arabidopsis thaliana on the basis of the insertion line collection GABI-Kat JOURNAL Unpublished REFERENCE 2 (bases 1 to 506) AUTHORS Weisshaar,B. TITLE Direct Submission JOURNAL Submitted (22-JUL-2014) Weisshaar Lab, CeBiTec & Department of Biology, Chair of Genome Research, Bielefeld University, Universitaetsstrasse 25, 50226 Bielefeld, 50226, GERMANY FEATURES Location/Qualifiers source 1..506 /organism="Arabidopsis thaliana" /mol_type="genomic DNA" /db_xref="taxon:3702" /clone="GK-SALK_040252c-116547-CG26" /clone_lib="Arabidopsis thaliana T-DNA insertion lines" /ecotype="Col-0" /note="PCR was performed on DNA from pools of Arabidopsis thaliana plants (T2) which contained the T-DNA from vector pROK2. The lines contain one or more T-DNA insertions. The DNA fragment(s) resulting from the PCR were directly sequenced to determine the genomic sequence flanking the insertion. The line was obtained from NASC (arabidopsis.info/StockInfo?NASC_id=N656401). Further details on the lines used can be found at http://signal.salk.edu/tdna_protocols.html" ORIGIN Query Match 28.1%; Score 140.4; Length 506; Best Local Similarity 90.4%; Matches 150; Conservative 0; Mismatches 16; Indels 0; Gaps 0; Qy 1 TCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCAAGAGCGGAGAAT 60 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Db 277 TCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAAT 336 Qy 61 TAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 337 TAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAA 396 Qy 121 CTGACAGAACCGCAACGCTGCAGGAATTGGCCGCAGGTGGATTTGT 166 ||||||||||||||||| || |||| | | || ||| | Db 397 CTGACAGAACCGCAACGTTGAAGGAGCCACTCAGCCGCGGGTTTCT 442 Against Instant SEQ ID NO:7 RESULT 3 DX108933/c LOCUS DX108933 276 bp DNA linear GSS 19-MAY-2010 DEFINITION ZHU1273_TT217-34-1_RB CSIROPIFGRTT_TDNA_TDNA_JUNCTION_B1 Oryza sativa Japonica Group genomic, genomic survey sequence. ACCESSION DX108933 VERSION DX108933.1 DBLINK BioSample: SAMN00187371 KEYWORDS GSS. SOURCE Oryza sativa Japonica Group (Japanese rice) ORGANISM Oryza sativa Japonica Group Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa. REFERENCE 1 (bases 1 to 276) AUTHORS Zhu,Q.-H., Ramm,K., Eamens,A.L., Dennis,E.S. and Upadhyaya,N.M. TITLE Transgene structures suggest that multiple mechanisms are involved in T-DNA integration in plants JOURNAL Unpublished (2006) COMMENT Contact: Upadhyaya NM Rice Functional Genomics Group (http://www.pi.csiro.au/fgrttpub/), Genomics and Plant Development Program CSIRO Plant Industry Cnr. Barry Drive and Clunies Ross Street, GPO Box 1600, Canberra, ACT 2601, Australia Tel: 61 2 6246 5491 Fax: 61 2 6246 5000 Email: narayana.upadhyaya\@csiro.au Contains 25 nt RB end followed by 1 nt microhomologous sequence and the sequence of another T-DNA (in RB-LB orientation) CONSTRUCT: pNU393 Seq primer: RBnest5 Class: Concatamer T-DNA junction. FEATURES Location/Qualifiers source 1..276 /organism="Oryza sativa Japonica Group" /mol_type="genomic DNA" /cultivar="Nipponbare" /db_xref="taxon:39947" /clone_lib="SAMN00187371 CSIROPIFGRTT_TDNA_TDNA_JUNCTION_B1" /note="Vector: Ds/T-DNA gene trapping vectors pSK100 or pEU334AN (AY488510) or pEU334BN (AY488511) or pNU393A1 (DQ225748) or pNU393B2 (DQ225749); T-DNA vector sequences flanking another T-DNA were rescued by either the built in plasmid rescue system comprising of an ampicillin resistance gene and a bacterial origin of replication or by TAIL PCR or PCR walking. Up to 25 nt of the LB or RB end sequence is retained." ORIGIN Query Match 21.7%; Score 55; Length 276; Best Local Similarity 100.0%; Matches 55; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCCC 55 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 106 GCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCCC 52ORIGIN Response to Arguments Claim Rejections - 35 USC 112(a) Lacking Written description, 35 USC 101 and 35 USC 102 In view of the claim amendments and/or cancelations, the above rejections are overcome, thus are withdrawn. Claim Objections The previous objections have been overcome. However, the amendments necessitated the new objections, as analyzed above. Claim Rejections - 35 USC 112(b) The previous rejections have been overcome. However, the amendments necessitated the new objections, as analyzed above. Claim Rejections - 35 USC 112(a) enablement/deposit The applicant has amended the specification to supplement the deposit information for the transgenic maize event LP026-2, and then argues that the amendment would satisfy the deposit requirement overcome the rejection. The argument is fully considered but not deemed persuasive. As analyzed above, the examiner noticed that in the amended (9/9/2026) specification ([0008]): “To achieve the above objectives, a nucleic acid sequence, which contains one or more selected from the sequences consisting of SEQ ID NOs:1-7 (i.e. SEQ ID NO:1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7) and the complementary sequences thereof, is provided by the present invention. In some embodiments, the nucleic acid sequence is derived from plants, seeds or cells containing the maize event LP026-2, and the representative sample of the seeds containing the event was deposited at the China Center for Type Culture Collection (CCTCC for short, Address: Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, Postcode: 430072) on April 15th, 2022= under the CCTCC deposit NO: P202207. In some embodiments, the nucleic acid sequence is an amplicon for diagnosing the maize event LP026-2”. However, according to MPEP 2404.01, “The mere reference to a deposit or the biological material itself in any document or publication does not necessarily mean that the deposited biological material is readily available. Even a deposit made under the Budapest Treaty and referenced in a United States or foreign patent document would not necessarily meet the test for known and readily available unless the deposit was made under conditions that are consistent with those specified in these rules, including the provision that requires, with one possible exception (37 CFR 1.808(b)), that all restrictions on the accessibility be irrevocably removed by the applicant upon the granting of the patent. Ex parte Hildebrand, 15 USPQ2d 1662 (Bd. Pat. App. & Int. 1990).” In this case there is no affirmation that the deposit meets all of the requirements of 37 CFR 1.801-1.809. The examiner noticed that the deposit receipt was filed 9/9/2026 as “miscellaneous incoming letter”, and a declaration by Zhiwei Jia was filed 9/9/2026 as “miscellaneous incoming letter” stating that “The inventor, Zhiwei JIA, on behalf of the applicant LONGPING BIOTECH (HAINAN) CO., LTD., hereby declares that the bacterial material (the seeds comprising the transgenic maize event LP026-2), deposit number: CCTCC NO.P202207) deposited under the Budapest Treaty in the present application will be publicly available during pendency of the patent application and all restrictions imposed by the depositor on the availability to the public irrevocably removed upon the granting of the patent”. However, the “deposit meets all of the requirements of 37 CFR 1.801-1.809” statement is missing in the specification and in the declaration”. In addition, the above paragraph [0008] of the specification is not properly formatted as “Deposit” information. For compact prosecution, it is suggested to use US Patent 10194605, under “Deposit Information”, as a reference regarding how a proper deposit information should be drafted. Conclusion Claims 2, 4, 13, 15-17, 19 are rejected. Claims 1, 3, 18 are objected. The applicant's amendment necessitated the new ground(s) of rejection presented in this Office action. Accordingly, THIS ACTION IS MADE FINAL. See MPEP § 706.07(a). The applicant is reminded of the extension of time policy as set forth in 37 CFR 1.136(a). A shortened statutory period for reply to this final action is set to expire THREE MONTHS from the mailing date of this action. In the event a first reply is filed within TWO MONTHS of the mailing date of this final action and the advisory action is not mailed until after the end of the THREE-MONTH shortened statutory period, then the shortened statutory period will expire on the date the advisory action is mailed, and any extension fee pursuant to 37 CFR 1.136(a) will be calculated from the mailing date of the advisory action. In no event, however, will the statutory period for reply expire later than SIX MONTHS from the date of this final action. Contact information Any inquiry concerning this communication or earlier communications from the examiner should be directed to WAYNE ZHONG whose telephone number is (571)270-0311. The examiner can normally be reached 8:30am to 5:00pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic, can be reached on 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Wayne Zhong/ Primary Examiner, Art Unit 1662