Prosecution Insights
Last updated: July 17, 2026
Application No. 18/699,269

TRANSGENIC MAIZE EVENT LP026-2 AND DETECTION METHOD THEREFOR

Non-Final OA §101§102§112
Filed
Apr 06, 2024
Priority
Sep 23, 2022 — CN 202211161744.2 +1 more
Examiner
ZHONG, WAYNESHAOBIN
Art Unit
1662
Tech Center
1600 — Biotechnology & Organic Chemistry
Assignee
Longping Biotech (Hainan) Co. Ltd.
OA Round
1 (Non-Final)
72%
Grant Probability
Favorable
1-2
OA Rounds
7m
Est. Remaining
94%
With Interview

Examiner Intelligence

Grants 72% — above average
72%
Career Allowance Rate
388 granted / 536 resolved
+12.4% vs TC avg
Strong +22% interview lift
Without
With
+21.6%
Interview Lift
resolved cases with interview
Typical timeline
2y 11m
Avg Prosecution
29 currently pending
Career history
562
Total Applications
across all art units

Statute-Specific Performance

§101
3.2%
-36.8% vs TC avg
§103
58.5%
+18.5% vs TC avg
§102
10.4%
-29.6% vs TC avg
§112
17.6%
-22.4% vs TC avg
Black line = Tech Center average estimate • Based on career data from 536 resolved cases

Office Action

§101 §102 §112
DETAILED ACTION Notice of Pre-AIA or AIA Status The present application, filed on or after March 16, 2013, is being examined under the first inventor to file provisions of the AIA . Information Disclosure Statement The Information Disclosure Statements filed on 4/6/2024 have been entered and considered. Initialed copies of the form PTO-1449 are enclosed with this action. Election/Restrictions and status of claims On 5/19/2026, the Applicant elected SEQ ID NO: 5 for Election 1, and elected SEQ ID NOs: 1-2, a pair of primers, for Election 2, without traverse. SEQ ID NOs: 1-4, 6-7 are fragments of SEQ ID NO: 5. Thus, upon further consideration, all of SEQ ID NOs: 1-7 are examined in the office action. SEQ ID NOs: 1-2 are also examined as primers; SEQ ID NOs: 3-4, 6-7 are also examined as markers. In summary, claims 1-20 are pending and examined in the office action. Other non-elected species are withdrawn. The restriction is made final. Priority Instant 18699269, filed 04/06/2024, is a National Stage entry of PCT/CN2023/102064, International Filing Date: 06/25/2023, and claims foreign priority to 202211161744.2, filed 09/23/2022. PCT/CN2023/102064 disclosed the claimed subject matter including the SEQ ID NOs. Thus, the priority date of 6/25/2023 is recognized. A certified copy of foreign priority was received. However, the English translation is still missing. Thus, the foreign priority is not recognized until the English translation is filed and received. Claim Objections Claims 1-2, 7, 10, 14-20 are objected to because of the following informalities: In claim 1, line2, claim 7, line1, claim 10, line 1, claim 14, line 2, claim 15, line 1, claim 18, line 2, and claim 19, line 2, the “characterized by comprising” is suggested to be changed to ---comprising---. In Claim 2, “CCTCC” appears in a claim for the first. The full name should be provided, followed by the abbreviation in a (). In addition, the “deposit number CCTCC NO: P202207” should be --- CCTCC deposit number NO: P202207---. In claims 16-18, line 5 of claim 16, last line of claim 17, last line of claim 18, the “shown in” is suggested to be changed to ---of---. Claims 19-20 both are independent claims. Maize event LP026-2 appear to be new. The claims recite maize event LP026-2 without reciting the CCTCC deposit number nor reciting any SEQ ID NO(s). See the requirement of 37 CFR 1.71(a) for “full, clear, and exact terms”. Appropriate corrections are required. Claim Rejections - 35 USC § 112 Indefiniteness The following is a quotation of 35 U.S.C. 112(b): (b) CONCLUSION—The specification shall conclude with one or more claims particularly pointing out and distinctly claiming the subject matter which the inventor or a joint inventor regards as the invention. Claim 17 is rejected under 35 U.S.C. 112(b) or 35 U.S.C. 112 (pre-AIA ), second paragraph, as being indefinite for failing to particularly point out and distinctly claim the subject matter which the inventor or a joint inventor, or for pre-AIA the applicant regards as the invention. Claim 17 recites method for protecting maize plant from damage caused by an herbicide, wherein, growing at least one transgenic maize plant comprising a nucleic acid sequence of the transgenic maize event LP026-2, wherein the transgenic maize plant comprises, sequentially, SEQ ID NO:1, the nucleic acid sequence at positions 1007-17140 of SEQ ID NO:5 and SEQ ID NO: 2 in its genome; or alternatively, the transgenic maize plant comprises the sequence shown in SEQ ID NO:5 in its genome. The claim is incomplete for omitting essential steps, essential elements, and/or essential structural cooperative relationships of elements. The omitted steps are: there is no step(s) recited. In fact, the claim does not comprise a main body, only preamble and wherein clauses, which do not sufficiently stand alone. In addition, there is no “and” or “or” between the 2 wherein clauses. Hence, it is unclear if both are required, or if each is optional. Moreover, there is insufficient antecedent basis in the preamble for the wherein clause of “wherein, growing at least one transgenic maize plant comprising a nucleic acid sequence of the transgenic maize event LP026-2”. The preamble recites “protecting maize plant from damage”. Appropriate correction and clarification are required for one skill in the art to know the metes and bounds to carry out the invention as claimed. Enablement/Deposit The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claim 2 is rejected under 35 U.S.C. 112(a), as failing to comply with the enablement requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to enable one skilled in the art to which it pertains, or with which it is most nearly connected, to make and/or use the invention. Claim 2 recites that the representative sample of the seeds comprising the transgenic maize event LPO26-2 has been deposited under deposit number CCTCC NO: P202207. Event LPO26-2 appears to be a new event, and the plant and seeds comprising the event appear to be new. The examiner noticed that in the specification ([0008]): “the representative sample of the seeds containing the event was deposited at the China Center for Type Culture Collection (CCTCC for short, Address: Wuhan University Collection Center, No. 299 Bayi Road, Wuchang District, Wuhan City, Hubei Province, Postcode: 430072) on April 15th, 2022”, but there is no clear Deposit information in the specification. In addition, the applicant does not provide a deposit receipt from CCTCC. According to MPEP 2404.01, “The mere reference to a deposit or the biological material itself in any document or publication does not necessarily mean that the deposited biological material is readily available. Even a deposit made under the Budapest Treaty and referenced in a United States or foreign patent document would not necessarily meet the test for known and readily available unless the deposit was made under conditions that are consistent with those specified in these rules, including the provision that requires, with one possible exception (37 CFR 1.808(b)), that all restrictions on the accessibility be irrevocably removed by the applicant upon the granting of the patent. Ex parte Hildebrand, 15 USPQ2d 1662 (Bd. Pat. App. & Int. 1990).” In this case there is no indication as to whether the seeds have actually been deposited under the Budapest Treaty nor an affirmation that the deposit meets all of the requirements of 37 CFR 1.801-1.809, and has been accepted. If the deposit has been made under the terms of the Budapest Treaty, then a statement, affidavit or declaration by Applicants, or a statement by an attorney of record over his or her signature and registration number, or someone empowered to make such a statement, stating that the specific strain has been deposited under the Budapest Treaty and that the strain will be irrevocably and without restriction released to the public upon the issuance of a patent, and will be publicly available for the enforceable life of the patent, would satisfy the deposit requirement made herein. If the deposit has not been made under the Budapest Treaty, then in order to certify that the deposit meets the criteria set forth in 37 C.F.R. 1.801-1.809 and MPEP 2402-2411.05, Applicants may provide assurance of compliance by statement, affidavit or declaration, or by someone empowered to make the same, or by a statement by an attorney of record over his or her signature and registration number, showing that (a) during the pendency of the application, access to the invention will be afforded to the Commissioner upon request; (b) all restrictions upon availability to the public will be irrevocably removed upon granting of the patent for the enforceable life of the patent in accordance with 37 CFR § 1.808(a)(2); (c) the deposit will be maintained in a public depository for a period of 30 years or 5 years after the last request or for the enforceable life of the patent, whichever is longer; and (d) the viability of the biological material at the time of deposit will be tested (see 37 CFR 1.807). The applicant is reminded to amend the specification to include the Deposit information. Lacking written description The following is a quotation of the first paragraph of 35 U.S.C. 112(a): (a) IN GENERAL.—The specification shall contain a written description of the invention, and of the manner and process of making and using it, in such full, clear, concise, and exact terms as to enable any person skilled in the art to which it pertains, or with which it is most nearly connected, to make and use the same, and shall set forth the best mode contemplated by the inventor or joint inventor of carrying out the invention. Claims 4-15, 17, 19 are rejected under 35 U.S.C. 112(a), as failing to comply with the written description requirement. The claim(s) contains subject matter which was not described in the specification in such a way as to reasonably convey to one skilled in the relevant art that the inventor or a joint inventor, or for pre-AIA the inventor(s), at the time the application was filed, had possession of the claimed invention. To claim a genus under the written description requirement, the applicant is required to describe a representative number of species to reflect the variation within the genus or structures sufficient to define the genus. The factors to be considered include disclosure of complete or partial structure, physical and/or chemical properties, functional characteristics, structure/function correlation, methods of making the claimed product, or any combinations thereof. By court’s statement in Regents of the Univ. of Cal. v. Eli Lilly, 119 F.3d 1559, 1566, 43 USPQ2d 1398, 1404 (Fed. Cir. 1997), a written description of an invention “requires a precise definition, such as a structure, formula, or chemical name, of the claimed subject matter sufficient to distinguish it from other materials”; further, a written description of a claimed genus requires a description of a representative number of species of the claimed genus, and one of skill in the art should be able to “visualize or recognize the identity of the members of the genus”. BY BRI, “a sequence of” is interpreted as a fragment of. Note: “the sequence of” is interpreted as the full-length sequence of. Accordingly, claim 4 is broadly drawn to a genus of primers comprising partial sequences of SEQ ID NO: 5 or a genus of fragments of complementary sequences thereof. The claimed function is detecting transgenic maize event LPO26-2. Claim 14 is drawn to methods comprising:(1) contacting a sample to be detected with the DNA probe according to claim 7 and/or a genus of marker nucleic acid molecules, wherein the genus of the marker nucleic acid molecules comprise partial sequences of SEQ ID NO:5 or a genus of fragments of complementary sequences thereof, the marker nucleic acid molecules hybridize with a DNA molecule containing a nucleic acid sequence selected from the sequences consisting of SEQ ID NOs: 1-7 and the complementary sequences thereof. The claimed function is detecting a DNA containing transgenic maize event LP026-2. Claim 17 is broadly drawn to methods comprising growing at least one transgenic maize plant comprising a genus of fragments of the transgenic maize event LP026-2. The claimed function is protecting maize plant from damage caused by an herbicide in maize event LP026-2. Claim 19 is broadly drawn to methods comprising growing at least one maize seed comprising a genus of fragments of transgenic maize event LP026-2. The claimed function is cultivating maize plants with insect resistance and/or tolerance to glyphosate herbicide, in maize event LP026-2. Claim 7 is broadly drawn to DNA probes comprising a partial sequence of SEQ ID NO:5 or a complementary sequence thereof. The claimed function is that DNA probes hybridize with SEQ ID NO: 1-6 or 7, but do not hybridize SEQ ID NO: 1-6 or 7. Claim 10 is broadly drawn to marker nucleic acid molecules comprising a partial sequence of SEQ ID NO:5 or a complementary sequence thereof. The claimed function is that marker nucleic acid molecules hybridize with SEQ ID NO: 1-6 or 7, but do not hybridize SEQ ID NO: 1-6 or 7. Claim 15 is broadly drawn to DNA detection kits comprising the pair of DNA primers according to claim 4, a DNA probe, and/or a marker nucleic acid molecule. Thus, the claim essentially recites the subject matter of claims 4, 7 or 10 and/or the combination thereof. The specification described SEQ ID NOs: 1-7 by sequence listing. According to the specification ([0044], Table 2), SEQ ID NO: 5 is the full-length sequence of the transgenic maize event LP026-2. SEQ ID NOs: 1-4, 6-7 are specific regions of the event LP026-2, which distinguish the transgenic maize event LP026-2 from other maize plants. By the examiner’s search and alignments, SEQ ID NOs: 1-4, 6-7 are fragments of SEQ ID NO: 5. Thus, maize event LP026-2 must comprise full-length sequence of SEQ ID NO: 5. Any of the SEQ ID NO: 1-4, 6 or 7 can serve as markers, probes or primers of maize event LP026-2, and distinguish the transgenic maize event LP026-2 from other maize plants. Again, “a sequence of” is interpreted as a fragment of. However, the specification does not describe a single species of that “a partial sequence of SEQ ID NO: 5”, “a complementary sequence” (a fragment of the full-length of the complement sequence) of SEQ ID NOs: 1-7, a sequence that hybridizes SEQ ID NOs: 1-7, “a nucleic acid sequence” (a fragment) of the transgenic maize event LP026-2 (claims 17 and 19), that is sufficiently distinguish the event LP026-2 from other maize plants. In contrary, in the art, Whitelaw et al (CG342774, 2023) disclose a partial sequence of SEQ ID NO: 5, 100% local similarity. See “Sequence Matches” at the end of office action. Such sequence is a fragment of genomic DNA of B73 maize cultivar, which does not comprise the event LP026-2. A pair of primers from such partial sequence of SEQ ID NO: 5 do not amplify or detect event LP026-2. Partial sequences of SEQ ID NO: 1-4, 6 or 7 had also been disclosed in the art, which does not comprise the event LP026-2, or is not sufficient to detect event LP026-2. Regarding hybridizing sequences, in the art, Zhang et al (Predicting DNA Hybridization Kinetics from Sequence. Nature Chemistry. 10:91-98, 2018) teach that hybridization are complementary sequences and allow mismatch, shorter or longer sequences (p91, left col, 1st and 2nd para; p96, left col, 3rd para; p98, left col, 1st para). Using hybridization to predict new sequence would have a 91% accuracy at best in a stringent condition (p91, abstract; p95, left col, 2nd para). Thus, hybridizing sequences are broader in scope than complementary sequences. For example, Louro et al (AM969402, 2011) disclose a partial sequence of SEQ ID NO: 1, 81.8% sequence identity, 100% local similarity. See “Sequence Matches” at the end of office action. Such sequence would hybridize to the complement sequence of SEQ ID NO: 1, but is a natural sequence that does not comprise the event LP026-2. Regarding claims 7 and 10, claims are drawn to a partial sequence, a complement (fragments) of SEQ ID NO: 5 as probes and/or markers. As analyzed above, the fragments can be very short, and hybridizing sequences are not accurately predictable. Thus, the structure that is sufficiently connected to the function is not described. Regarding claim 17, the claim is indefinite. By BRI, it is interpreted that each of the 2 wherein clauses is optional. Thus, the claim merely requires growing at least one transgenic maize plant comprising a nucleic acid sequence (meaning a fragment) of the transgenic maize event LP026-2. As analyzed above, a fragment of LP026-2 is not sufficiently described by the specification, a fragment of LP026-2 does not actually describe event LP026-2. As analyzed above. For example, would the sequence of Whitelaw et al (CG342774, 2023, no inclusion of event LP026-2) hybridize the claimed genus of sequences under “stringent condition”? Would the sequence of Louro et al (AM969402, 2011, no inclusion of event LP026-2) hybridize the claimed genus of sequences under “stringent condition”? If the answers are yes, then such probe does not distinguish event LP026-2 from a control plant. If the answers are no, then such probe still does not distinguish event LP026-2 from a control plant. Thus, the applicant does not sufficiently describe the structure and the connection to the function. Regarding claim 15, as analyzed above, the claim essentially recites the subject matter of claims 4, 7 or 10 and/or the combination thereof. And as analyzed above, claims 4, 7 or 10 are not sufficiently described. Thus, claim 15 is not sufficiently described. Regarding the description of a representative number of species, SEQ ID NO: 5 has 17487 base pairs. There are extremely large number of partial sequences. Many of the partial sequences would complement and/or hybridize to SEQ ID NO: 1-4, 6 or 7. Those sequences are an extremely large number. The “a sequence” are fragments, which are an extremely large number. The hybridizing sequences can be longer, shorter and can have mismatches, which are an extremely large number. Thus, applicant claims an extremely large number of species. In addition, the sequences are heterologous in structure, and not sufficiently associated to the claimed functions. Hence, SEQ ID NO: 1-6 or 7 does not describe the common structure feature of the genus, and is not sufficient to represent the claimed genus. Therefore, the application has not met either of the two elements of the written description requirement as set forth in the court’s decision in Eli Lilly, and has not shown her/his possession of the claimed genus at the time of the application. Dependent claims do not sufficiently cure the deficiencies, thus are included. Claim Rejections - 35 USC § 101 35 U.S.C. 101 reads as follows: Whoever invents or discovers any new and useful process, machine, manufacture, or composition of matter, or any new and useful improvement thereof, may obtain a patent therefor, subject to the conditions and requirements of this title. Claim 20 is rejected under 35 U.S.C. 101 because the claimed invention is directed to non-statutory subject matter. The claimed invention is directed to a judicial exception (natural product and natural process) without significantly more. Claim 20 is drawn to a processed product produced from transgenic maize event LP026-2, wherein, the processed product is maize powder, maize flour, maize oil, maize ear silk or maize starch. The proceed product is not required to comprise any cell of maize event LP026-2 or any specific DNA or protein unique to the event LP026-2. In addition, pure oil and pure starch do not comprise any DNAs or proteins. Therefore, the claimed oil or starch is not distinguishable from natural oil or natural starch. There is no non-natural product added, not to mention significantly more, to such natural product. Therefore, claim 20 is directed to natural product without significantly more. Claim Rejections - 35 USC § 102 The following is a quotation of the appropriate paragraphs of 35 U.S.C. 102 that form the basis for the rejections under this section made in this Office action: A person shall be entitled to a patent unless – (a)(1) the claimed invention was patented, described in a printed publication, or in public use, on sale or otherwise available to the public before the effective filing date of the claimed invention. Claim 20 is rejected under 35 U.S.C. 102(a)(1) as anticipated by Beadle et al (Composition of Corn Oil. THE JOURNAL OF THE AMERICAN 0IL CHEMISTS' SOCIETY, 90-95, 1965). Claim 20 is drawn to a processed product produced from transgenic maize event LP026-2, wherein, the processed product is maize powder, maize flour, maize oil, maize ear silk or maize starch. The claim is a product by process claim. The proceed product is not required to comprise any cell of maize event LP026-2 or any specific DNA or protein unique to the event LP026-2. Determination of patentability is based on the product itself. The patentability of a product does not depend on its method of production. See MPEP 2113. See In re Thorpe, 227 USPQ 964, 966 (Fed. Cir. 1985), which teaches that a product-by-process claim may be properly rejectable over prior art teaching the same product produced by a different process, if the process of making the product fails to distinguish the two products. Beadle et al teach a corn oil (p90, Abstract; p93, left col, “Results and Discussion”). The instantly claimed oil is not different or not distinguishable from the oil taught by Beadle et al. Therefore, Beadle et al, or any prior art teaching a corn oil, anticipate claim 20. Remarks According to the specification ([0044], Table 2), SEQ ID NO: 5 is the full-length sequence of the transgenic maize event LP026-2. SEQ ID NOs: 1-4, 6-7 are specific regions of the event LP026-2. By the examiner’s search and alignments, SEQ ID NOs: 1-4, 6-7 are fragments of SEQ ID NO: 5. Prior art does not teach or suggest full length sequences of SEQ ID NOs: 1-7, or the full complement sequences thereof. Prior art discloses partial sequences of SEQ NO: 5, and partial sequences of SEQ ID NOs: 1-7, but does not teach or suggest that the sequence(s) serving as pairs of primers, or any sequence(s) hybridizing event LP026-2 but not hybridizing any maize not comprising event LP026-2, not to mention as probes, markers or kits. The following reference is relevant to instant application, thus, is filed but not cited by the examiner: Chen et al (Efficacy of Bt-(Cry1Ab + Cry2Ab + Cry1Fa) maize against Spodoptera frugiperda and other lepidopteran migratory pests in tropical Asia. Published online in Wiley Online Library: 10 November 2025). Chen et al disclosed and described maize event LP026-2. Not a prior art. Closest Sequence Matches Instant SEQ ID NO:5 RESULT 1 CG342774 LOCUS CG342774 965 bp DNA linear GSS 26-AUG-2003 DEFINITION OGYBG89TV ZM_0.7_1.5_KB Zea mays genomic clone ZMMBMa0640O09, genomic survey sequence. ACCESSION CG342774 VERSION CG342774.1 DBLINK BioSample: SAMN00182289 KEYWORDS GSS. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. REFERENCE 1 (bases 1 to 965) AUTHORS Whitelaw,C.A., Quackenbush,J., Van Aken,S., Utterback,T., Resnick,A., Fraser,C.M., Budiman,M.A., Bedell,J.A., Rohlfing,T., Citek,R.W., Nunberg,A., Robbins,D. and Lakey,N. TITLE Consortium for Maize Genomics JOURNAL Unpublished COMMENT Other_GSSs: OGYBG89TH Contact: Cathy Whitelaw TIGR 9712 Medical Center Drive, Rockville, MD 20850, USA Tel: 301-838-5843 Fax: 301-838-0208 Email: whitelaw\@tigr.org Seq primer: TF Class: methylation filtered. FEATURES Location/Qualifiers source 1..965 /organism="Zea mays" /mol_type="genomic DNA" /strain="B73" /db_xref="taxon:4577" /clone="ZMMBMa0640O09" /clone_lib="SAMN00182289 ZM_0.7_1.5_KB" /note="Vector: pBCSK-; Site_1: HincII; 0.7-1.5 kb methylation filtered genomic DNA library" ORIGIN Query Match 5.5%; Score 965; Length 965; Best Local Similarity 100.0%; Matches 965; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 8720 AGAGCCATCCCAGGATTCCCCAAAGAGAAACACTGGCAAGTTAGCAATCAGAACGTGTCT 8779 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 1 AGAGCCATCCCAGGATTCCCCAAAGAGAAACACTGGCAAGTTAGCAATCAGAACGTGTCT 60 Qy 8780 GACGTACAGGTCGCATCCGTGTACGAACGCTAGCAGCACGGATCTAACACAAACACGGAT 8839 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 61 GACGTACAGGTCGCATCCGTGTACGAACGCTAGCAGCACGGATCTAACACAAACACGGAT 120 Qy 8840 CTAACACAAACATGAACAGAAGTAGAACTACCGGGCCCTAACCATGGACCGGAACGCCGA 8899 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 121 CTAACACAAACATGAACAGAAGTAGAACTACCGGGCCCTAACCATGGACCGGAACGCCGA 180 Qy 8900 TCTAGAGAAGGTAGAGAGGGGGGGGGGGGGAGGACGAGCGGCGTACCTTGAAGCGGAGGT 8959 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 181 TCTAGAGAAGGTAGAGAGGGGGGGGGGGGGAGGACGAGCGGCGTACCTTGAAGCGGAGGT 240 Qy 8960 GCCGACGGGTGGATTTGGGGGAGATCTGGTTGTGTGTGTGTGCGCTCCGAACAACACGAG 9019 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 241 GCCGACGGGTGGATTTGGGGGAGATCTGGTTGTGTGTGTGTGCGCTCCGAACAACACGAG 300 Qy 9020 GTTGGGGAAAGAGGGTGTGGAGGGGGTGTCTATTTATTACGGCGGGCGAGGAAGGGAAAG 9079 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 301 GTTGGGGAAAGAGGGTGTGGAGGGGGTGTCTATTTATTACGGCGGGCGAGGAAGGGAAAG 360 Qy 9080 CGAAGGAGCGGTGGGAAAGGAATCCCCCGTAGCTGCCGGTGCCGTGAGAGGAGGAGGAGG 9139 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 361 CGAAGGAGCGGTGGGAAAGGAATCCCCCGTAGCTGCCGGTGCCGTGAGAGGAGGAGGAGG 420 Qy 9140 CCGCCTGCCGTGCCGGCTCACGTCTGCCGCTCCGCCACGCAATTTCTGGATGCCGACAGC 9199 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 421 CCGCCTGCCGTGCCGGCTCACGTCTGCCGCTCCGCCACGCAATTTCTGGATGCCGACAGC 480 Qy 9200 GGAGCAAGTCCAACGGTGGAGCGGAACTCTCGAGAGGGGTCCAGAGGCAGCGACAGAGAT 9259 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 481 GGAGCAAGTCCAACGGTGGAGCGGAACTCTCGAGAGGGGTCCAGAGGCAGCGACAGAGAT 540 Qy 9260 GCCGTGCCGTCTGCTTCGCTTGGCCCGACGCGACGCTGCTGGTTCGCTGGTTGGTGTCCG 9319 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 541 GCCGTGCCGTCTGCTTCGCTTGGCCCGACGCGACGCTGCTGGTTCGCTGGTTGGTGTCCG 600 Qy 9320 TTAGACTCGTCGACGGCGTTTAACAGGCTGGCATTATCTACTCGAAACAAGAAAAATGTT 9379 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 601 TTAGACTCGTCGACGGCGTTTAACAGGCTGGCATTATCTACTCGAAACAAGAAAAATGTT 660 Qy 9380 TCCTTAGTTTTTTTAATTTCTTAAAGGGTATTTGTTTAATTTTTAGTCACTTTATTTTAT 9439 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 661 TCCTTAGTTTTTTTAATTTCTTAAAGGGTATTTGTTTAATTTTTAGTCACTTTATTTTAT 720 Qy 9440 TCTATTTTATATCTAAATTATTAAATAAAAAAACTAAAATAGAGTTTTAGTTTTCTTAAT 9499 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 721 TCTATTTTATATCTAAATTATTAAATAAAAAAACTAAAATAGAGTTTTAGTTTTCTTAAT 780 Qy 9500 TTAGAGGCTAAAATAGAATAAAATAGATGTACTAAAAAAATTAGTCTATAAAAACCATTA 9559 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 781 TTAGAGGCTAAAATAGAATAAAATAGATGTACTAAAAAAATTAGTCTATAAAAACCATTA 840 Qy 9560 ACCCTAAACCCTAAATGGATGTACTAATAAAATGGATGAAGTATTATATAGGTGAAGCTA 9619 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 841 ACCCTAAACCCTAAATGGATGTACTAATAAAATGGATGAAGTATTATATAGGTGAAGCTA 900 Qy 9620 TTTGCAAAAAAAAAGGAGAACACATGCACACTAAAAAGATAAAACTGTAGAGTCCTGTTG 9679 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 901 TTTGCAAAAAAAAAGGAGAACACATGCACACTAAAAAGATAAAACTGTAGAGTCCTGTTG 960 Qy 9680 TCAAA 9684 ||||| Db 961 TCAAA 965 Instant SEQ ID NO:1 RESULT 23 AM969402 LOCUS AM969402 471 bp mRNA linear EST 03-MAY-2011 DEFINITION AM969402 cDN09 Sparus aurata cDNA clone cDN09P0006A23 5', mRNA sequence. ACCESSION AM969402 VERSION AM969402.1 DBLINK BioSample: SAMN00165828 KEYWORDS EST. SOURCE Sparus aurata (gilthead seabream) ORGANISM Sparus aurata Eukaryota; Metazoa; Chordata; Craniata; Vertebrata; Euteleostomi; Actinopterygii; Neopterygii; Teleostei; Neoteleostei; Acanthomorphata; Eupercaria; Spariformes; Sparidae; Sparus. REFERENCE 1 (bases 1 to 471) AUTHORS Louro,B., Passos,A.L.S., Souche,E.L., Tsigenopoulos,C., Beck,A., Lagnel,J., Bonhomme,F., Cancela,L., Cerd,J., Clark,M.S., Lubzens,E., Magoulas,A., Planas,J.V., Volckaert,F.A.M., Reinhardt,R. and Canario,A.V.M. TITLE Gilthead sea bream (Sparus auratus) and European sea bass (Dicentrarchus labrax) expressed sequence tags: Characterization, tissue-specific expression and gene markers JOURNAL Mar Genomics 3 (3-4), 179-191 (2010) COMMENT Contact: Beck A proScience MPI for Molecular Genetics Ihnestrasse 73, D-14195 Berlin, GERMANY Total RNA was extracted from 9 specimens of both sex (4 females and 5 males) and weight range 350 g to 4kg. Collected tissue frozen in liq N2 and stored at -80C prior to RNA extraction. mRNA purification and concentration were performed using the Dynal's oligo-dT magnetic beads. Library construction was performed with Creator SMART cDNA library construction kit (Clontech) and the thermostable duplex-specific nuclease (Zhu et al., 2001). Initial LD PCR amplification of 22 cycles for enrichment of full length transcripts was verified on Agarose gels. cDNA sizes (>500 base pairs) were selected using filter columns based on agarose gels as described in the Clontech manual. Library construction and sequencing were performed at the MPI of Molecular Genetics Berlin. FEATURES Location/Qualifiers source 1..471 /organism="Sparus aurata" /mol_type="mRNA" /db_xref="taxon:8175" /clone="cDN09P0006A23" /sex="mixed" /tissue_type="trunk kidney" /clone_lib="SAMN00165828 cDN09" /dev_stage="adult" /note="Total RNA was extracted from 9 specimens of both sex (4 females and 5 males) and weight range 350 g to 4kg. Collected tissue frozen in liq N2 and stored at -80C prior to RNA extraction. mRNA purification and concentration were performed using the Dynal's oligo-dT magnetic beads. Library construction was performed with Creator SMART cDNA library construction kit (Clontech) and the thermostable duplex-specific nuclease (Zhu et al., 2001). Initial LD PCR amplification of 22 cycles for enrichment of full length transcripts was verified on Agarose gels. cDNA sizes (>500 base pairs) were selected using filter columns based on agarose gels as described in the Clontech manual. Library construction and sequencing were performed at the MPI of Molecular Genetics Berlin. isolation_source: aquaculture fish. collection_date: 10-Oct-2004. collected_by: Juan Fuentes and Carla Viegas" ORIGIN Query Match 81.8%; Score 18; Length 471; Best Local Similarity 100.0%; Matches 18; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 CATCGAATGCCTCAAACA 18 |||||||||||||||||| Db 186 CATCGAATGCCTCAAACA 203 Instant SEQ ID NO:2 RESULT 4 EL901765/c LOCUS EL901765 831 bp mRNA linear EST 20-MAR-2007 DEFINITION CGF2003438_C08 WRO-02: Walnut root Juglans hindsii x Juglans regia cDNA clone WRO-02-5_I_C08 5', mRNA sequence. ACCESSION EL901765 VERSION EL901765.1 DBLINK BioSample: SAMN00152718 KEYWORDS EST. SOURCE Juglans hindsii x Juglans regia ORGANISM Juglans hindsii x Juglans regia Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; fabids; Fagales; Juglandaceae; Juglans. REFERENCE 1 (bases 1 to 831) AUTHORS Britton,M., Leslie,C., McGranahan,G. and Dandekar,A. TITLE Analysis of genes expressed in nematode-infected walnut plants JOURNAL Unpublished COMMENT Contact: Abhaya Dandekar, PhD CAES Genome Facility UC Davis, Department of Pomology One Shields Ave, Davis, CA 95616, USA Tel: 530 752 7784 Fax: 530 752 8502 Email: amdandekar\@ucdavis.edu Seq primer: DNR-F2 ACGGTACCGGACATATG. FEATURES Location/Qualifiers source 1..831 /organism="Juglans hindsii x Juglans regia" /mol_type="mRNA" /cultivar="Paradox clone 'PX1'" /db_xref="taxon:432290" /clone="WRO-02-5_I_C08" /clone_lib="SAMN00152718 WRO-02: Walnut root" /dev_stage="Small greenhouse plants" /lab_host="E. coli DH10-Beta" /note="Organ: Root; Vector: pDNR-LIB; Site_1: SfiIA; Site_2: SfiIB; Five micropropagated plants of the walnut Paradox clone PX1 were grown in the greenhouse. On May 19, 2006 the roots of these plants were harvested, frozen in liquid nitrogen and stored at -80C. RNA was isolated from individual plants using the hot borate method. Total RNA was purified (Qiagen RNA/DNA Mini Kit) from each plant, pooled and used to construct a cDNA library (CLONTECH Creator SMART cDNA Library kit). Ligated plasmids were electroporated into E. coli DH10-Beta (Invitrogen). Individual colonies were picked and sequenced using plasmid primers to obtain 5' ESTs (UC Davis CA&ES Core Genomics Facility)." ORIGIN Query Match 86.4%; Score 19; Length 831; Best Local Similarity 100.0%; Matches 19; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 2 TTACACCACAAGCAATTCT 20 ||||||||||||||||||| Db 775 TTACACCACAAGCAATTCT 757 Instant SEQ ID NO:3 RESULT 2 BZ320063 LOCUS BZ320063 601 bp DNA linear GSS 06-NOV-2002 DEFINITION hz03b11.g1 WGS-ZmaysF (JM107 adapted methyl filtered) Zea mays genomic clone hz03b11 5', genomic survey sequence. ACCESSION BZ320063 VERSION BZ320063.1 DBLINK BioSample: SAMN00182102 KEYWORDS GSS. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. REFERENCE 1 (bases 1 to 601) AUTHORS Rabinowicz,P.D., O'Shaughnessy,A.L., Balija,V., Dedhia,N., Katzenburger,F., King,L., Miller,B., Muller,S., Nascimento,L., Zutavern,T., McCombie,W.R. and Martienssen,R.A. TITLE Genomic shotgun sequences from Zea mays (methyl-filtered) JOURNAL Unpublished COMMENT Contact: W. Richard McCombie Lita Annenberg Hazen Genome Sequencing Center Cold Spring Harbor Laboratory PO Box 100, Cold Spring Harbor, NY 11724, USA Tel: 516 367 8884 Fax: 516 367 8874 Email: mccombie\@cshl.org Plate: hz03 row: b column: 11 Seq primer: -21M13UnivRev Class: shotgun. FEATURES Location/Qualifiers source 1..601 /organism="Zea mays" /mol_type="genomic DNA" /cultivar="B73" /db_xref="taxon:4577" /clone="hz03b11" /clone_lib="SAMN00182102 WGS-ZmaysF (JM107 adapted methyl filtered)" /lab_host="JM107 or DH5a" /note="Organ: immature ears; Site_1: Xba I; Site_2: Xba I; The vector was digested with XbaI and one nucleotide was added by fill in in the recessive 3' end. The genomic DNA was nebulized, end repaired, adaptor ligated and size fractionated using sephadex. The resulting fragments were between 0.8 and 3 kb and were cloned into the vector (.x/y reads in M13mp19, .b/g reads in pUC19). The same ligation was transformed in either JM107 or DH5a." ORIGIN Query Match 36.6%; Score 547; Length 601; Best Local Similarity 100.0%; Matches 547; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCAGCTATCTTCGGATGGACGGATGTAATCAATCAAAAAGTCTTAGGTTGAGATCTTTAA 60 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 55 GCAGCTATCTTCGGATGGACGGATGTAATCAATCAAAAAGTCTTAGGTTGAGATCTTTAA 114 Qy 61 GGATGAGGCCATTAGCCCTTTTCATCTGATCAGTTCTTTGAGAGTGTGCAACCGAGGCAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 115 GGATGAGGCCATTAGCCCTTTTCATCTGATCAGTTCTTTGAGAGTGTGCAACCGAGGCAA 174 Qy 121 AATGCATAATAATTCCACATTCGGTGCAAAAATTCATGAACTTTTTAGAAAGTGAACTGG 180 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 175 AATGCATAATAATTCCACATTCGGTGCAAAAATTCATGAACTTTTTAGAAAGTGAACTGG 234 Qy 181 CTTCCATTATCAGTTATGGTGGTTCTCGGCACACCGAACTGATTGAAGATCTCTTTCGTG 240 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 235 CTTCCATTATCAGTTATGGTGGTTCTCGGCACACCGAACTGATTGAAGATCTCTTTCGTG 294 Qy 241 AATTCCACTACTTTGGTTGATAAGATCTTGGCTACAAGCTTAGCCTCGACCCACTTTGTC 300 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 295 AATTCCACTACTTTGGTTGATAAGATCTTGGCTACAAGCTTAGCCTCGACCCACTTTGTC 354 Qy 301 AACTTATCAACGATCACAAAGAGATACGTGACTTCGCCCTTCACCGGTTTGAATGATCCA 360 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 355 AACTTATCAACGATCACAAAGAGATACGTGACTTCGCCCTTCACCGGTTTGAATGATCCA 414 Qy 361 ATAATGTCTAGGCACCAAGTGGAGAATTGATAGGTGATAGGGATAGTCTAAAGTTGTGTA 420 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 415 ATAATGTCTAGGCACCAAGTGGAGAATTGATAGGTGATAGGGATAGTCTAAAGTTGTGTA 474 Qy 421 GCTAGCATATGAGCCTGGTGTGAAAAACATTAGCACCCCTTGCATGTGCGTACGAGTTGT 480 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 475 GCTAGCATATGAGCCTGGTGTGAAAAACATTAGCACCCCTTGCATGTGCGTACGAGTTGT 534 Qy 481 TTGGCGTCAGTTACTATTGTTGATCAGAAAAACCTGCTGATAAGCTTTCGCCACTAACGT 540 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 535 TTGGCGTCAGTTACTATTGTTGATCAGAAAAACCTGCTGATAAGCTTTCGCCACTAACGT 594 Qy 541 TTTGGTG 547 ||||||| Db 595 TTTGGTG 601 Instant SEQ ID NO:4 RESULT 1 DX827727/c LOCUS DX827727 834 bp DNA linear GSS 06-FEB-2009 DEFINITION ZMMBLb0006H10.f ZMMBLb Zea mays genomic clone ZMMBLb0006H10 5', genomic survey sequence. ACCESSION DX827727 VERSION DX827727.1 DBLINK BioSample: SAMN00188269 KEYWORDS GSS. SOURCE Zea mays ORGANISM Zea mays Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; PACMAD clade; Panicoideae; Andropogonodae; Andropogoneae; Tripsacinae; Zea. REFERENCE 1 (bases 1 to 834) AUTHORS Nelson,W., Luo,M., Ma,J., Estep,M., Estill,J., He,R., Talag,J., Sisneros,N., Kudrna,D., Kim,H., Ammiraju,J.S., Collura,K., Bharti,A.K., Messing,J., Wing,R.A., SanMiguel,P., Bennetzen,J.L. and Soderlund,C. TITLE Methylation-sensitive linking libraries enhance gene-enriched sequencing of complex genomes and map DNA methylation domains JOURNAL BMC Genomics 9, 621 (2008) PUBMED 19099592 COMMENT Contact: Soderlund C Department of Plant Sciences University of Arizona 303 Forbes, Tucson, AZ 85721, uSA Email: cari\@agcol.arizona.edu Class: BAC ends. FEATURES Location/Qualifiers source 1..834 /organism="Zea mays" /mol_type="genomic DNA" /cultivar="B73" /db_xref="taxon:4577" /clone="ZMMBLb0006H10" /tissue_type="immature ears" /clone_lib="SAMN00188269 ZMMBLb" /lab_host="DH10B T1 phage resistant" /note="Vector: pAGIBAC1; Site_1: Hpa II; Site_2: Hpa II; Methyl Spanning Linker Library (HpaII, BAC)" ORIGIN Query Match 57.2%; Score 337.4; Length 834; Best Local Similarity 92.0%; Matches 356; Conservative 0; Mismatches 31; Indels 0; Gaps 0; Qy 204 TATCCGCAATGTGTTATTAAGTTGTCTAAGCGTCAATTTGTTTACACCACAAGCAATTCT 263 || |||| | || | || || | | || | | ||||||||| Db 543 TACTAGCAACGAGTCACCTAGAACTCGGACCCATCGAATGCCCAGAGTGATAGCAATTCT 484 Qy 264 TAAGCTGAGCAACATGGCCTCATACTGAGCAATATTATTGGTTGTAGGAAAGTGTATTTG 323 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 483 TAAGCTGAGCAACATGGCCTCATACTGAGCAATATTATTGGTTGTAGGAAAGTGTATTTG 424 Qy 324 TAGTATGTACCTGAATTTCTCACCTTTTGGTGAAGTAACAACAACTCACGCTCTTGCTCC 383 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 423 TAGTATGTACCTGAATTTCTCACCTTTTGGTGAAGTAACAACAACTCACGCTCTTGCTCC 364 Qy 384 ACTAAGCTATAAAGGTCCATCAAATTTGACTGTCCAGTGATCAAGGGGCTTCATTTCGAT 443 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 363 ACTAAGCTATAAAGGTCCATCAAATTTGACTGTCCAGTGATCAAGGGGCTTCATTTCGAT 304 Qy 444 TAGGACGTGTATCTCGGTCAACTTTGCAACAAAATCACTAAGAGTCTTGGCCTTGATCAC 503 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 303 TAGGACGTGTATCTCGGTCAACTTTGCAACAAAATCACTAAGAGTCTTGGCCTTGATCAC 244 Qy 504 CATACGAGGTTTGAATATAATGTCATATACTCCTAGCTCAATAGCACACTTGGCAACTCA 563 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 243 CATACGAGGTTTGAATATAATGTCATATACTCCTAGCTCAATAGCACACTTGGCAACTCA 184 Qy 564 GGCTGTAACATATTTCTTGTGCAGTAC 590 ||||||||||||||||||||||||||| Db 183 GGCTGTAACATATTTCTTGTGCAGTAC 157 Instant SEQ ID NO:6 RESULT 1 LN486195 LOCUS LN486195 506 bp DNA linear GSS 15-SEP-2014 DEFINITION Arabidopsis thaliana T-DNA flanking sequence GK-SALK_040252c-116547-CG26, genomic survey sequence. ACCESSION LN486195 VERSION LN486195.1 KEYWORDS GSS; genome survey sequence. SOURCE Arabidopsis thaliana (thale cress) ORGANISM Arabidopsis thaliana Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; eudicotyledons; Gunneridae; Pentapetalae; rosids; malvids; Brassicales; Brassicaceae; Camelineae; Arabidopsis. REFERENCE 1 AUTHORS Huep,G., Kleinboelting,N., Appelhagen,I., Viehoever,P. and Weisshaar,B. TITLE Analysis of structural features of Agrobacterium tumefaciens mediated T-DNA insertions in Arabidopsis thaliana on the basis of the insertion line collection GABI-Kat JOURNAL Unpublished REFERENCE 2 (bases 1 to 506) AUTHORS Weisshaar,B. TITLE Direct Submission JOURNAL Submitted (22-JUL-2014) Weisshaar Lab, CeBiTec & Department of Biology, Chair of Genome Research, Bielefeld University, Universitaetsstrasse 25, 50226 Bielefeld, 50226, GERMANY FEATURES Location/Qualifiers source 1..506 /organism="Arabidopsis thaliana" /mol_type="genomic DNA" /db_xref="taxon:3702" /clone="GK-SALK_040252c-116547-CG26" /clone_lib="Arabidopsis thaliana T-DNA insertion lines" /ecotype="Col-0" /note="PCR was performed on DNA from pools of Arabidopsis thaliana plants (T2) which contained the T-DNA from vector pROK2. The lines contain one or more T-DNA insertions. The DNA fragment(s) resulting from the PCR were directly sequenced to determine the genomic sequence flanking the insertion. The line was obtained from NASC (arabidopsis.info/StockInfo?NASC_id=N656401). Further details on the lines used can be found at http://signal.salk.edu/tdna_protocols.html" ORIGIN Query Match 28.1%; Score 140.4; Length 506; Best Local Similarity 90.4%; Matches 150; Conservative 0; Mismatches 16; Indels 0; Gaps 0; Qy 1 TCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCAAGAGCGGAGAAT 60 |||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| Db 277 TCAAACACTGATAGTTTAAACTGAAGGCGGGAAACGACAATCTGATCATGAGCGGAGAAT 336 Qy 61 TAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAA 120 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 337 TAAGGGAGTCACGTTATGACCCCCGCCGATGACGCGGGACAAGCCGTTTTACGTTTGGAA 396 Qy 121 CTGACAGAACCGCAACGCTGCAGGAATTGGCCGCAGGTGGATTTGT 166 ||||||||||||||||| || |||| | | || ||| | Db 397 CTGACAGAACCGCAACGTTGAAGGAGCCACTCAGCCGCGGGTTTCT 442 Instant SEQ ID NO:7 RESULT 3 DX108933/c LOCUS DX108933 276 bp DNA linear GSS 19-MAY-2010 DEFINITION ZHU1273_TT217-34-1_RB CSIROPIFGRTT_TDNA_TDNA_JUNCTION_B1 Oryza sativa Japonica Group genomic, genomic survey sequence. ACCESSION DX108933 VERSION DX108933.1 DBLINK BioSample: SAMN00187371 KEYWORDS GSS. SOURCE Oryza sativa Japonica Group (Japanese rice) ORGANISM Oryza sativa Japonica Group Eukaryota; Viridiplantae; Streptophyta; Embryophyta; Tracheophyta; Spermatophyta; Magnoliopsida; Liliopsida; Poales; Poaceae; BOP clade; Oryzoideae; Oryzeae; Oryzinae; Oryza; Oryza sativa. REFERENCE 1 (bases 1 to 276) AUTHORS Zhu,Q.-H., Ramm,K., Eamens,A.L., Dennis,E.S. and Upadhyaya,N.M. TITLE Transgene structures suggest that multiple mechanisms are involved in T-DNA integration in plants JOURNAL Unpublished (2006) COMMENT Contact: Upadhyaya NM Rice Functional Genomics Group (http://www.pi.csiro.au/fgrttpub/), Genomics and Plant Development Program CSIRO Plant Industry Cnr. Barry Drive and Clunies Ross Street, GPO Box 1600, Canberra, ACT 2601, Australia Tel: 61 2 6246 5491 Fax: 61 2 6246 5000 Email: narayana.upadhyaya\@csiro.au Contains 25 nt RB end followed by 1 nt microhomologous sequence and the sequence of another T-DNA (in RB-LB orientation) CONSTRUCT: pNU393 Seq primer: RBnest5 Class: Concatamer T-DNA junction. FEATURES Location/Qualifiers source 1..276 /organism="Oryza sativa Japonica Group" /mol_type="genomic DNA" /cultivar="Nipponbare" /db_xref="taxon:39947" /clone_lib="SAMN00187371 CSIROPIFGRTT_TDNA_TDNA_JUNCTION_B1" /note="Vector: Ds/T-DNA gene trapping vectors pSK100 or pEU334AN (AY488510) or pEU334BN (AY488511) or pNU393A1 (DQ225748) or pNU393B2 (DQ225749); T-DNA vector sequences flanking another T-DNA were rescued by either the built in plasmid rescue system comprising of an ampicillin resistance gene and a bacterial origin of replication or by TAIL PCR or PCR walking. Up to 25 nt of the LB or RB end sequence is retained." ORIGIN Query Match 21.7%; Score 55; Length 276; Best Local Similarity 100.0%; Matches 55; Conservative 0; Mismatches 0; Indels 0; Gaps 0; Qy 1 GCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCCC 55 ||||||||||||||||||||||||||||||||||||||||||||||||||||||| Db 106 GCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCCC 52ORIGIN Conclusion No claim is allowed. Contact information Any inquiry concerning this communication or earlier communications from the examiner should be directed to WAYNE ZHONG whose telephone number is (571)270-0311. The examiner can normally be reached 8:30am to 5:00pm EST. Examiner interviews are available via telephone, in-person, and video conferencing using a USPTO supplied web-based collaboration tool. To schedule an interview, applicant is encouraged to use the USPTO Automated Interview Request (AIR) at http://www.uspto.gov/interviewpractice. If attempts to reach the examiner by telephone are unsuccessful, the examiner’s supervisor, Bratislav Stankovic, can be reached on 571-270-0305. The fax phone number for the organization where this application or proceeding is assigned is 571-273-8300. Information regarding the status of published or unpublished applications may be obtained from Patent Center. Unpublished application information in Patent Center is available to registered users. To file and manage patent submissions in Patent Center, visit: https://patentcenter.uspto.gov. Visit https://www.uspto.gov/patents/apply/patent-center for more information about Patent Center and https://www.uspto.gov/patents/docx for information about filing in DOCX format. For additional questions, contact the Electronic Business Center (EBC) at 866-217-9197 (toll-free). If you would like assistance from a USPTO Customer Service Representative, call 800-786-9199 (IN USA OR CANADA) or 571-272-1000. /Wayne Zhong/ Primary Examiner, Art Unit 1662
Read full office action

Prosecution Timeline

Apr 06, 2024
Application Filed
Jun 10, 2026
Non-Final Rejection mailed — §101, §102, §112 (current)

Precedent Cases

Applications granted by this same examiner with similar technology

Patent 12660775
WHEAT VARIETY 6PAZF90B
2y 5m to grant Granted Jun 23, 2026
Patent 12653122
TRITICALE CULTIVAR APT1415420
3y 9m to grant Granted Jun 16, 2026
Patent 12655440
GENETICALLY MODIFIED PLANTS THAT EXHIBIT AN INCREASE IN SEED YIELD COMPRISING A FIRST BIOTIN ATTACHMENT DOMAIN-CONTAINING (BADC) GENE HOMOZYGOUS FOR A WILD-TYPE ALLELE, A SECOND BADC GENE HOMOZYGOUS FOR A MUTANT ALLELE, AND HOMOLOGS OF THE FIRST AND SECOND BADC GENES
3y 5m to grant Granted Jun 16, 2026
Patent 12644127
HAPLOID MAIZE TRANSFORMATION
11y 1m to grant Granted Jun 02, 2026
Patent 12642235
SOYBEAN CULTIVAR 29120104
2y 3m to grant Granted Jun 02, 2026
Study what changed to get past this examiner. Based on 5 most recent grants.

Strategy Recommendation AI-generated — please review before filing

Get a prosecution strategy drawn from examiner precedents, rejection analysis, and claim mapping.
Typically takes 5-10 seconds — AI-generated, attorney review required before filing

Prosecution Projections

1-2
Expected OA Rounds
72%
Grant Probability
94%
With Interview (+21.6%)
2y 11m (~7m remaining)
Median Time to Grant
Low
PTA Risk
Based on 536 resolved cases by this examiner. Grant probability derived from career allowance rate.

Sign in with your work email

Enter your email to receive a magic link. No password needed.

Personal email addresses (Gmail, Yahoo, etc.) are not accepted.

Free tier: 3 strategy analyses per month